ID: 919937940

View in Genome Browser
Species Human (GRCh38)
Location 1:202267184-202267206
Sequence GTTGTCTTAGAGGATACCAG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 90
Summary {0: 1, 1: 1, 2: 2, 3: 5, 4: 81}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
919937938_919937940 27 Left 919937938 1:202267134-202267156 CCACAGGGCGGATAATGAATATG 0: 1
1: 0
2: 0
3: 9
4: 67
Right 919937940 1:202267184-202267206 GTTGTCTTAGAGGATACCAGAGG 0: 1
1: 1
2: 2
3: 5
4: 81

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
919937940 Original CRISPR GTTGTCTTAGAGGATACCAG AGG Intronic
902536873 1:17124266-17124288 GTTGTCTGAGGGGCTGCCAGGGG + Intergenic
905394300 1:37657321-37657343 GTGGTCCTAGAGGATTCCAGAGG + Intergenic
910033912 1:82766970-82766992 CTTAGGTTAGAGGATACCAGAGG + Intergenic
911162311 1:94693460-94693482 ATTGACTTTAAGGATACCAGTGG - Intergenic
919937940 1:202267184-202267206 GTTGTCTTAGAGGATACCAGAGG + Intronic
1063717801 10:8545862-8545884 GTTCTTTTGGAGGATATCAGAGG - Intergenic
1063824110 10:9875266-9875288 GTTGGCTTAGAGGTTGCCTGAGG - Intergenic
1068829734 10:61479715-61479737 GTTTTCTCAGAGGATTCCAAAGG + Intergenic
1079160835 11:17992786-17992808 TTTGCCTAAGAGCATACCAGTGG + Intronic
1080108514 11:28538784-28538806 GTTGTTTGACATGATACCAGAGG - Intergenic
1081691496 11:45081303-45081325 GTTATCGTACAGGATAGCAGGGG + Intergenic
1084121316 11:67070672-67070694 GTCGTCTTAGAGGCTGTCAGAGG + Intronic
1086529970 11:87773316-87773338 GTTTTCGTAGAGGTTACCACCGG + Intergenic
1090060976 11:123464010-123464032 GCTGTTTTAGAAGATAACAGGGG + Intergenic
1095173839 12:39067224-39067246 GTGGTCTAAGAGGATAAAAGAGG + Intergenic
1101756570 12:107625667-107625689 GTGGTGTTAGAGGATGCCACTGG - Intronic
1102080245 12:110091955-110091977 GTTGACTTAGAGGAAACCAGAGG + Intergenic
1102789566 12:115633540-115633562 GTTGCCAAAGAGGATCCCAGGGG + Intergenic
1103462538 12:121116552-121116574 GTTGACTCAGAGAAAACCAGAGG - Intergenic
1105008225 12:132736458-132736480 CTTGTCTGAGAGGAAGCCAGCGG + Intronic
1105767194 13:23573554-23573576 ATTTTCTTAGATGATGCCAGTGG + Intronic
1108181663 13:47846158-47846180 GTGGTCTTTGAGGAGACCTGCGG + Intergenic
1111700749 13:91684721-91684743 CATGTCTTAAAGGATAACAGTGG - Intronic
1113977701 13:114242343-114242365 GTTGACTTAGAAGATTTCAGAGG - Intronic
1115353322 14:32420870-32420892 CTTTTCTTAAAAGATACCAGAGG - Intronic
1116825092 14:49665441-49665463 GCTGTCTTAGAAGGTACCTGGGG - Intronic
1117637815 14:57764850-57764872 TTTGTCTTACAGGAAAGCAGAGG + Intronic
1135274569 16:21101171-21101193 TTTGTCTTAGATGATAACTGTGG - Intronic
1135903210 16:26486056-26486078 TTTGTATTAGAGGATATCAAAGG - Intergenic
1143546763 17:7601521-7601543 GTTGACTGGGAGGAAACCAGTGG + Exonic
1146595636 17:34166096-34166118 TTTGTCTTAGGAGAAACCAGTGG - Intronic
1148006654 17:44436908-44436930 GTTGTGTAGGAGGATATCAGTGG - Intronic
1149250360 17:54761095-54761117 GTTGACTTAGAGGAGGGCAGAGG + Intergenic
1154323518 18:13373126-13373148 GTTGTGGTAGAGGATGCCAAAGG - Intronic
1155117765 18:22786357-22786379 GTCCTTTTAGAGGATCCCAGAGG - Intergenic
1164199005 19:23001418-23001440 GTTGTCTTATGGGAGATCAGAGG + Intronic
1164560343 19:29287764-29287786 GCTGTCTTGGAGAATCCCAGGGG + Intergenic
928755985 2:34526282-34526304 GTTGGCTTTGAGGAAACAAGAGG - Intergenic
931104527 2:59040763-59040785 GTTGACTTAGAGAATACAAAAGG + Intergenic
938417478 2:131115927-131115949 CTTGTTTTAGAGGAGACTAGTGG + Intronic
947937061 2:234016290-234016312 GTTGTCTCTGAGGCCACCAGTGG - Intronic
948185246 2:236016144-236016166 GTTGTCTGTTAAGATACCAGTGG + Intronic
948521777 2:238543765-238543787 GATGTCTTAGAGCATCCCTGAGG - Intergenic
948522259 2:238547402-238547424 GGTGTCTTAGAGCATCCCTGAGG - Intergenic
1173770091 20:45648729-45648751 TTTGTTTTACAGGAAACCAGTGG - Exonic
1182637429 22:31739688-31739710 GTTGTCTGAGAGGATGAAAGTGG + Intronic
949409727 3:3750312-3750334 GTTGCCTTAGATGAGAACAGTGG - Intronic
950058795 3:10051498-10051520 GTTCTCTCAGAGGTTACCAGAGG - Intronic
950300438 3:11872765-11872787 GTTCTCTCAGAGGTTACCAGGGG - Intergenic
958187607 3:90143083-90143105 ATTGTCTTAAAGGCTACTAGGGG + Intergenic
959289654 3:104457675-104457697 GTGGTCTTACAGGATACCAGTGG - Intergenic
960723378 3:120646323-120646345 GATGTCTTTGAGGAGACCAGGGG - Exonic
962846086 3:139275130-139275152 GTGGGGTTAGGGGATACCAGGGG - Intronic
964069080 3:152610245-152610267 GGTGTTTTAGAGGATATTAGAGG - Intergenic
966293604 3:178390059-178390081 TTTGAGTTAGAGGATAGCAGTGG - Intergenic
966594678 3:181714976-181714998 ATTGTCTGAGAGGAAACAAGTGG + Intergenic
969298184 4:6281639-6281661 TTAGTCTTAGAGGGTACAAGGGG + Intronic
975725240 4:77285261-77285283 TGTGTCTTAGAGGAAACTAGAGG - Intronic
975939400 4:79623896-79623918 GTTGTCTTGGAGGCTATCTGTGG + Intergenic
976086568 4:81412967-81412989 GCTGATTTAGAGGAAACCAGAGG + Intergenic
983297440 4:165883803-165883825 CTTGTTTTAAAAGATACCAGAGG + Intronic
983461201 4:168027629-168027651 GTTGTCTTACAGGATAACCCAGG + Intergenic
986046208 5:4040815-4040837 GTTGTCTGAGAAGAGAACAGAGG - Intergenic
990318252 5:54604583-54604605 GGTATCATAGAGGTTACCAGGGG + Intergenic
991644724 5:68790281-68790303 GATGTCTCAGAGGAAACTAGAGG - Intergenic
996349070 5:122518497-122518519 GCTGACTCTGAGGATACCAGAGG - Intergenic
996411318 5:123162321-123162343 GGTGTCTAAGAGCATACCACTGG + Intronic
996787501 5:127256040-127256062 GATTTCCCAGAGGATACCAGTGG - Intergenic
998841073 5:146254675-146254697 GATGTTTTAGAGTATACAAGAGG + Intronic
999450403 5:151673381-151673403 GCTGCCTTAGAGGTCACCAGGGG + Intronic
1009553270 6:65127711-65127733 GGTGTCTGAGAGAATAGCAGTGG + Intronic
1012289362 6:97433831-97433853 GTTGTGTTTGAGGATGCAAGAGG - Intergenic
1013157916 6:107511473-107511495 CTTCTCTTTGAGGGTACCAGAGG + Intronic
1016329597 6:142943880-142943902 GATGACTTCGAGGAGACCAGAGG - Intronic
1016631959 6:146243362-146243384 GTTTTCTTAATGGAAACCAGAGG + Intronic
1016752127 6:147642402-147642424 GTTGTATGAGATGATCCCAGAGG + Intronic
1030195829 7:106852602-106852624 GTTTTCTTAGAGGATACCAGAGG + Intergenic
1030413079 7:109206172-109206194 GTTGTTTTAAAGTATACCAGAGG + Intergenic
1033508145 7:142026660-142026682 GTTGTCTCAGAGAAGACTAGAGG + Intronic
1039836759 8:41262541-41262563 GTTATCTTAGAAGATAGCATGGG - Exonic
1040481573 8:47831995-47832017 TTTGTCTTTGAGGAAACCCGAGG - Intronic
1045138344 8:99249058-99249080 ATTAGATTAGAGGATACCAGGGG - Intronic
1048471472 8:134707722-134707744 CTGGCCTTAGAGGATGCCAGTGG - Intronic
1050774087 9:9238258-9238280 TTTGGCTTTGAGGATACCAAGGG + Intronic
1055825948 9:80324884-80324906 GTTTTCTTAGAAGAAGCCAGTGG + Intergenic
1187301155 X:18051033-18051055 GCTGTCTTATAGGATAGCAAGGG + Intergenic
1193044114 X:77033924-77033946 ATTGTCTTACTGGCTACCAGGGG - Intergenic
1198511066 X:137352277-137352299 ATTGTCTTAGGAGCTACCAGAGG - Intergenic
1200115885 X:153769546-153769568 GCTGCCTTAAAGGATTCCAGGGG - Intronic
1201907965 Y:19104523-19104545 GCTGTCTAAGAGGATACCTTAGG - Intergenic