ID: 919941037 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 1:202286432-202286454 |
Sequence | TCTTTCTCAACAAGTGATTG GGG (reversed) |
Strand | - |
Crispr in exon? | No |
Crispr in intron? | Yes |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | 263 | |||
Summary | {0: 1, 1: 0, 2: 1, 3: 19, 4: 242} |
Found 3 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
919941037_919941044 | 15 | Left | 919941037 | 1:202286432-202286454 | CCCCAATCACTTGTTGAGAAAGA | 0: 1 1: 0 2: 1 3: 19 4: 242 |
||
Right | 919941044 | 1:202286470-202286492 | GTATCCTCATGTTACAGATGGGG | 0: 1 1: 5 2: 165 3: 1248 4: 4542 |
||||
919941037_919941043 | 14 | Left | 919941037 | 1:202286432-202286454 | CCCCAATCACTTGTTGAGAAAGA | 0: 1 1: 0 2: 1 3: 19 4: 242 |
||
Right | 919941043 | 1:202286469-202286491 | TGTATCCTCATGTTACAGATGGG | 0: 1 1: 1 2: 15 3: 98 4: 674 |
||||
919941037_919941042 | 13 | Left | 919941037 | 1:202286432-202286454 | CCCCAATCACTTGTTGAGAAAGA | 0: 1 1: 0 2: 1 3: 19 4: 242 |
||
Right | 919941042 | 1:202286468-202286490 | GTGTATCCTCATGTTACAGATGG | 0: 1 1: 0 2: 5 3: 48 4: 359 |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
919941037 | Original CRISPR | TCTTTCTCAACAAGTGATTG GGG (reversed) | Intronic | ||