ID: 919941037

View in Genome Browser
Species Human (GRCh38)
Location 1:202286432-202286454
Sequence TCTTTCTCAACAAGTGATTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 263
Summary {0: 1, 1: 0, 2: 1, 3: 19, 4: 242}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
919941037_919941044 15 Left 919941037 1:202286432-202286454 CCCCAATCACTTGTTGAGAAAGA 0: 1
1: 0
2: 1
3: 19
4: 242
Right 919941044 1:202286470-202286492 GTATCCTCATGTTACAGATGGGG 0: 1
1: 5
2: 165
3: 1248
4: 4542
919941037_919941043 14 Left 919941037 1:202286432-202286454 CCCCAATCACTTGTTGAGAAAGA 0: 1
1: 0
2: 1
3: 19
4: 242
Right 919941043 1:202286469-202286491 TGTATCCTCATGTTACAGATGGG 0: 1
1: 1
2: 15
3: 98
4: 674
919941037_919941042 13 Left 919941037 1:202286432-202286454 CCCCAATCACTTGTTGAGAAAGA 0: 1
1: 0
2: 1
3: 19
4: 242
Right 919941042 1:202286468-202286490 GTGTATCCTCATGTTACAGATGG 0: 1
1: 0
2: 5
3: 48
4: 359

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
919941037 Original CRISPR TCTTTCTCAACAAGTGATTG GGG (reversed) Intronic