ID: 919941038

View in Genome Browser
Species Human (GRCh38)
Location 1:202286433-202286455
Sequence GTCTTTCTCAACAAGTGATT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 159
Summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 144}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
919941038_919941046 30 Left 919941038 1:202286433-202286455 CCCAATCACTTGTTGAGAAAGAC 0: 1
1: 0
2: 1
3: 13
4: 144
Right 919941046 1:202286486-202286508 GATGGGGAAACTGAGACAGAAGG 0: 1
1: 8
2: 77
3: 565
4: 2107
919941038_919941044 14 Left 919941038 1:202286433-202286455 CCCAATCACTTGTTGAGAAAGAC 0: 1
1: 0
2: 1
3: 13
4: 144
Right 919941044 1:202286470-202286492 GTATCCTCATGTTACAGATGGGG 0: 1
1: 5
2: 165
3: 1248
4: 4542
919941038_919941043 13 Left 919941038 1:202286433-202286455 CCCAATCACTTGTTGAGAAAGAC 0: 1
1: 0
2: 1
3: 13
4: 144
Right 919941043 1:202286469-202286491 TGTATCCTCATGTTACAGATGGG 0: 1
1: 1
2: 15
3: 98
4: 674
919941038_919941042 12 Left 919941038 1:202286433-202286455 CCCAATCACTTGTTGAGAAAGAC 0: 1
1: 0
2: 1
3: 13
4: 144
Right 919941042 1:202286468-202286490 GTGTATCCTCATGTTACAGATGG 0: 1
1: 0
2: 5
3: 48
4: 359

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
919941038 Original CRISPR GTCTTTCTCAACAAGTGATT GGG (reversed) Intronic