ID: 919941043

View in Genome Browser
Species Human (GRCh38)
Location 1:202286469-202286491
Sequence TGTATCCTCATGTTACAGAT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 789
Summary {0: 1, 1: 1, 2: 15, 3: 98, 4: 674}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
919941038_919941043 13 Left 919941038 1:202286433-202286455 CCCAATCACTTGTTGAGAAAGAC 0: 1
1: 0
2: 1
3: 13
4: 144
Right 919941043 1:202286469-202286491 TGTATCCTCATGTTACAGATGGG 0: 1
1: 1
2: 15
3: 98
4: 674
919941039_919941043 12 Left 919941039 1:202286434-202286456 CCAATCACTTGTTGAGAAAGACA 0: 1
1: 0
2: 0
3: 11
4: 194
Right 919941043 1:202286469-202286491 TGTATCCTCATGTTACAGATGGG 0: 1
1: 1
2: 15
3: 98
4: 674
919941036_919941043 15 Left 919941036 1:202286431-202286453 CCCCCAATCACTTGTTGAGAAAG 0: 1
1: 0
2: 1
3: 13
4: 154
Right 919941043 1:202286469-202286491 TGTATCCTCATGTTACAGATGGG 0: 1
1: 1
2: 15
3: 98
4: 674
919941037_919941043 14 Left 919941037 1:202286432-202286454 CCCCAATCACTTGTTGAGAAAGA 0: 1
1: 0
2: 1
3: 19
4: 242
Right 919941043 1:202286469-202286491 TGTATCCTCATGTTACAGATGGG 0: 1
1: 1
2: 15
3: 98
4: 674

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
919941043 Original CRISPR TGTATCCTCATGTTACAGAT GGG Intronic