ID: 919941046 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 1:202286486-202286508 |
| Sequence | GATGGGGAAACTGAGACAGA AGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | 2758 | |||
| Summary | {0: 1, 1: 8, 2: 77, 3: 565, 4: 2107} |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 919941038_919941046 | 30 | Left | 919941038 | 1:202286433-202286455 | CCCAATCACTTGTTGAGAAAGAC | 0: 1 1: 0 2: 1 3: 13 4: 144 |
||
| Right | 919941046 | 1:202286486-202286508 | GATGGGGAAACTGAGACAGAAGG | 0: 1 1: 8 2: 77 3: 565 4: 2107 |
||||
| 919941039_919941046 | 29 | Left | 919941039 | 1:202286434-202286456 | CCAATCACTTGTTGAGAAAGACA | 0: 1 1: 0 2: 0 3: 11 4: 194 |
||
| Right | 919941046 | 1:202286486-202286508 | GATGGGGAAACTGAGACAGAAGG | 0: 1 1: 8 2: 77 3: 565 4: 2107 |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 919941046 | Original CRISPR | GATGGGGAAACTGAGACAGA AGG | Intronic | ||