ID: 919941046

View in Genome Browser
Species Human (GRCh38)
Location 1:202286486-202286508
Sequence GATGGGGAAACTGAGACAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 2758
Summary {0: 1, 1: 8, 2: 77, 3: 565, 4: 2107}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
919941039_919941046 29 Left 919941039 1:202286434-202286456 CCAATCACTTGTTGAGAAAGACA 0: 1
1: 0
2: 0
3: 11
4: 194
Right 919941046 1:202286486-202286508 GATGGGGAAACTGAGACAGAAGG 0: 1
1: 8
2: 77
3: 565
4: 2107
919941038_919941046 30 Left 919941038 1:202286433-202286455 CCCAATCACTTGTTGAGAAAGAC 0: 1
1: 0
2: 1
3: 13
4: 144
Right 919941046 1:202286486-202286508 GATGGGGAAACTGAGACAGAAGG 0: 1
1: 8
2: 77
3: 565
4: 2107

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
919941046 Original CRISPR GATGGGGAAACTGAGACAGA AGG Intronic