ID: 919944166

View in Genome Browser
Species Human (GRCh38)
Location 1:202307678-202307700
Sequence TTGTTGGTGGATAGAGAGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 362
Summary {0: 1, 1: 1, 2: 0, 3: 34, 4: 326}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
919944166_919944173 -3 Left 919944166 1:202307678-202307700 CCATCCTCTCTATCCACCAACAA 0: 1
1: 1
2: 0
3: 34
4: 326
Right 919944173 1:202307698-202307720 CAAAGAGGATATATTGGGCCTGG 0: 1
1: 0
2: 2
3: 27
4: 238
919944166_919944177 19 Left 919944166 1:202307678-202307700 CCATCCTCTCTATCCACCAACAA 0: 1
1: 1
2: 0
3: 34
4: 326
Right 919944177 1:202307720-202307742 GAATCCCTTCACACATAGGAGGG 0: 1
1: 0
2: 0
3: 4
4: 126
919944166_919944170 -9 Left 919944166 1:202307678-202307700 CCATCCTCTCTATCCACCAACAA 0: 1
1: 1
2: 0
3: 34
4: 326
Right 919944170 1:202307692-202307714 CACCAACAAAGAGGATATATTGG 0: 1
1: 0
2: 2
3: 15
4: 175
919944166_919944171 -8 Left 919944166 1:202307678-202307700 CCATCCTCTCTATCCACCAACAA 0: 1
1: 1
2: 0
3: 34
4: 326
Right 919944171 1:202307693-202307715 ACCAACAAAGAGGATATATTGGG 0: 1
1: 0
2: 1
3: 17
4: 269
919944166_919944176 18 Left 919944166 1:202307678-202307700 CCATCCTCTCTATCCACCAACAA 0: 1
1: 1
2: 0
3: 34
4: 326
Right 919944176 1:202307719-202307741 GGAATCCCTTCACACATAGGAGG 0: 1
1: 0
2: 0
3: 4
4: 91
919944166_919944178 22 Left 919944166 1:202307678-202307700 CCATCCTCTCTATCCACCAACAA 0: 1
1: 1
2: 0
3: 34
4: 326
Right 919944178 1:202307723-202307745 TCCCTTCACACATAGGAGGGTGG 0: 1
1: 0
2: 0
3: 16
4: 140
919944166_919944175 15 Left 919944166 1:202307678-202307700 CCATCCTCTCTATCCACCAACAA 0: 1
1: 1
2: 0
3: 34
4: 326
Right 919944175 1:202307716-202307738 CCTGGAATCCCTTCACACATAGG 0: 1
1: 0
2: 1
3: 17
4: 213

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
919944166 Original CRISPR TTGTTGGTGGATAGAGAGGA TGG (reversed) Intronic
900075424 1:812377-812399 ATGTTGGTGGAAATGGAGGATGG + Intergenic
901306210 1:8234859-8234881 GTGTTGATGGAAGGAGAGGAGGG + Intergenic
902404214 1:16174230-16174252 CTCTGGGTGGATGGAGAGGAGGG - Intergenic
904225019 1:29009999-29010021 TTGTTGGTAGAGGGTGAGGAAGG + Intronic
905734859 1:40317692-40317714 TTGTTTGTGCTTGGAGAGGAAGG - Intronic
905806422 1:40880814-40880836 TTGTTAGTGAATAGAGGAGAGGG + Intergenic
907091881 1:51732734-51732756 TTGTTTTTGGATAAAAAGGATGG - Intronic
908759354 1:67497874-67497896 TGGGTGGTGGACAGAGTGGAGGG - Intergenic
911234898 1:95401911-95401933 TTGTTGGTGGGTTGGGAGGGAGG - Intergenic
914748755 1:150518212-150518234 TAGTTGGAGGGTAAAGAGGATGG - Intergenic
916141517 1:161703615-161703637 GAGAAGGTGGATAGAGAGGAAGG + Intergenic
917580273 1:176370069-176370091 TTGGTGATGGATTGAGAGGTAGG + Intergenic
917642382 1:176995760-176995782 CTTTTGGTGGCTAGAGAGGAAGG + Intronic
918431214 1:184462761-184462783 CTGATGTTGGATGGAGAGGAAGG - Intronic
919421812 1:197379081-197379103 TTGTTTGTGGATAGGAAAGATGG + Intronic
919944166 1:202307678-202307700 TTGTTGGTGGATAGAGAGGATGG - Intronic
920241136 1:204551486-204551508 TTTTTGGAGGATAGGGAGTATGG + Exonic
920654893 1:207867905-207867927 TGGTAGGAGGACAGAGAGGAGGG - Intergenic
920911643 1:210223507-210223529 TTGATGGTGGGGAGACAGGAGGG - Intergenic
921108686 1:212011046-212011068 TCGTTGGTGGGTTGAGAGAAGGG - Intronic
921756891 1:218868106-218868128 TTGTTGGTGAACACAGAGGGTGG - Intergenic
922271268 1:224037251-224037273 ATGTTGGTGGAAATGGAGGATGG + Intergenic
923437690 1:233983179-233983201 TTGTTGAGAGATAGAGAGGGAGG - Intronic
924243247 1:242059508-242059530 GAGCTGGTGGATTGAGAGGATGG - Intergenic
1063782752 10:9345052-9345074 ATGTTGGGGGAGAGAGAGAAGGG + Intergenic
1064280256 10:13945033-13945055 TTGCTGGTGGAGAGACCGGAGGG - Intronic
1064957497 10:20927022-20927044 GTGGTGGTGGAAAGAAAGGATGG + Intronic
1067719004 10:48712615-48712637 TTGGTGGTGGAAAGAAAGGTGGG + Intronic
1067833648 10:49624690-49624712 TTGTTGGCTGAAAGAGTGGAAGG + Intronic
1068726862 10:60312812-60312834 TTGTTGCTGCATGGAAAGGAAGG - Intronic
1069198565 10:65584949-65584971 TTGTTGGTGGTTACAGATGTAGG + Intergenic
1069292325 10:66795599-66795621 TTGTTGGTGGCTAGAGCAGCTGG - Intronic
1070542118 10:77423551-77423573 GTCATGGTGGATGGAGAGGAAGG + Intronic
1071121244 10:82281494-82281516 TGGTTGGTGGTTGGTGAGGATGG + Intronic
1071984433 10:91036429-91036451 TCGATTGTGGATAGAGAGGTGGG - Intergenic
1072848103 10:98855328-98855350 GGGATTGTGGATAGAGAGGAGGG + Intronic
1072934899 10:99702786-99702808 TTGTGAGGGGGTAGAGAGGAAGG - Intronic
1073311958 10:102549303-102549325 ATGTTGGTGGAAGGAGAAGAGGG + Intronic
1075768070 10:124910555-124910577 TTTGTGGTGGACATAGAGGAAGG + Intergenic
1076220313 10:128728501-128728523 TTGTTGGAGTTGAGAGAGGAAGG - Intergenic
1076428485 10:130384206-130384228 TTGTTGGTTGGTAGATAGGCGGG - Intergenic
1078043706 11:7893528-7893550 TGGTTGGAGGAGAGAGTGGATGG - Intergenic
1078043737 11:7893703-7893725 TTGTTGGAGCAGAGAGTGGATGG + Intergenic
1078276766 11:9856047-9856069 TTACTGGAGGGTAGAGAGGAAGG + Intronic
1078968073 11:16370766-16370788 TTGTTGGATGATAGAAAGAAAGG - Intronic
1079559198 11:21801856-21801878 TTGTTGTTGTAGAGAGAGCAGGG + Intergenic
1080221578 11:29911714-29911736 TGGTTGTTGTATAGAGAGAATGG + Intergenic
1081180151 11:39974899-39974921 TTGTTGGTGGGAAGAGAAGTTGG - Intergenic
1081467149 11:43331565-43331587 TAGTAGGTGGAGAAAGAGGAGGG + Intronic
1084046894 11:66574218-66574240 TGGTTGAGGGATAGAGAGGTTGG - Intergenic
1084229802 11:67743403-67743425 TTCTAGGTGGAGAGAAAGGATGG - Intergenic
1084424710 11:69078347-69078369 CTGTGGCTGGATAGATAGGACGG + Intronic
1087036745 11:93763901-93763923 TTTTTGGTGGTTAGGGAGTAGGG + Intronic
1087883340 11:103446059-103446081 TTGTTGTTGTTTAGGGAGGAGGG + Intronic
1088044413 11:105430474-105430496 TTTTGGGGGGATGGAGAGGATGG - Intergenic
1088406784 11:109490143-109490165 TTGTTTGTGGAAAGGAAGGATGG + Intergenic
1088883754 11:113991526-113991548 TTGTTGATGGATAGAGATTAGGG + Intergenic
1089769623 11:120793827-120793849 TGGGTGGTGGTTAGAGGGGAAGG + Intronic
1089860216 11:121583403-121583425 TTGGTGGGGGATGGAGATGAGGG + Intronic
1092665183 12:10788544-10788566 TTATTGGATGATAGAAAGGAAGG + Intergenic
1093497187 12:19771730-19771752 ATGTTGGTGGTTAGGGAGGAAGG + Intergenic
1095319148 12:40804567-40804589 GGGTTGATGGATAGAGGGGAGGG + Intronic
1095846230 12:46748045-46748067 TTGTTGGTGTATAGAAATGCCGG - Intergenic
1099853437 12:88134259-88134281 TTGTTGGAGGAGAGGGAGGATGG - Intronic
1102320775 12:111932197-111932219 TTCTTGGTGAATGGTGAGGAGGG - Intronic
1103038190 12:117673282-117673304 TTGATGAAGGACAGAGAGGATGG + Intronic
1104264548 12:127219485-127219507 TTGTTGGAGGGCAGAGGGGAGGG - Intergenic
1105418765 13:20234694-20234716 GTGGGGGTGGAGAGAGAGGAAGG + Intergenic
1105548498 13:21369742-21369764 TGGTTGGAGGATAGGGAGAAGGG - Intergenic
1105846277 13:24297043-24297065 TTGTTGTTGTTTAGAGAGAAGGG + Intronic
1105965656 13:25382090-25382112 TTGCCGGAGGTTAGAGAGGAAGG - Intronic
1106062777 13:26310943-26310965 TTGTGGGTGGGTAGGGAGGAGGG - Intronic
1107950455 13:45456838-45456860 TTGGAGGTGGAGAGAGAAGATGG + Intergenic
1108264692 13:48694805-48694827 TTGTGGGGGAATGGAGAGGAAGG + Intronic
1108439740 13:50438765-50438787 TTGATGAAGGTTAGAGAGGAGGG + Intronic
1108635070 13:52325274-52325296 TAGTTGGTGGATAGAGTGAGTGG + Intergenic
1108652733 13:52497918-52497940 TAGTTGGTGGATAGAGTGAGTGG - Intergenic
1113077609 13:106483017-106483039 TGGTTTGTGGAGAGACAGGAGGG - Intergenic
1113505917 13:110815757-110815779 TTGTTGGTGAAAAGAGAGGGTGG + Intergenic
1113721825 13:112563171-112563193 TTGTTGGTAGACCTAGAGGAAGG - Intronic
1115063254 14:29220704-29220726 CTGTCTGTGCATAGAGAGGAGGG + Intergenic
1115458756 14:33635483-33635505 TTGTTTATGGATTGAAAGGAAGG + Intronic
1116705433 14:48291530-48291552 TTGTGGTTGGATGGAAAGGAGGG + Intergenic
1118888518 14:69887412-69887434 TTTTTGGGGGAGAGGGAGGATGG + Intronic
1120228597 14:81818500-81818522 TGGTGGGTGGAGAGAGAAGAAGG + Intergenic
1120846792 14:89133381-89133403 TTGTTGCCATATAGAGAGGAGGG + Intronic
1121156161 14:91686590-91686612 TTGATGGTTGATAGTGATGAGGG - Intronic
1123633001 15:22275032-22275054 TGGATGGTGGATAGACAGGTGGG - Intergenic
1125027923 15:35049350-35049372 TTTGTTGTGGATAGAGAGGAGGG + Intergenic
1125290867 15:38145336-38145358 TGGTTGGTGGGGAGAGAGAAGGG - Intergenic
1126031450 15:44503568-44503590 TTCTTGATGGAGACAGAGGAAGG - Intronic
1128418131 15:67465844-67465866 ATCTTTGTGGAGAGAGAGGAGGG - Intronic
1128697602 15:69780349-69780371 TTGCTGGTGGAGAGATAGTAGGG - Intergenic
1128731713 15:70025797-70025819 TTTCTGGTGCTTAGAGAGGAAGG - Intergenic
1129502140 15:76049500-76049522 TTGTTGATGAATAGGGAAGAAGG - Intronic
1129825653 15:78633485-78633507 CTGTTGGTGGGAAGGGAGGAGGG + Intronic
1130553866 15:84909354-84909376 TTGTTGGAAGAAAGAAAGGAAGG - Intronic
1130736387 15:86554559-86554581 TTGTTGCTGGACAGAAAGTATGG - Intronic
1131772753 15:95758041-95758063 CTGTTGGTGGGTAGGGAGAAAGG + Intergenic
1131776703 15:95809592-95809614 TTGTTTGTGGTTAGAGAGTAGGG - Intergenic
1133670071 16:8009910-8009932 ATGTTGGTGAGCAGAGAGGAGGG - Intergenic
1134311952 16:13083088-13083110 GTGCTGGTGGATAGAGGGGAGGG + Intronic
1134569647 16:15280337-15280359 TTGGAGGTGAATAGAGAGAATGG + Intergenic
1134732732 16:16475712-16475734 TTGGAGGTGAATAGAGAGAATGG - Intergenic
1134934710 16:18236256-18236278 TTGGAGGTGAATAGAGAGAATGG + Intergenic
1135354432 16:21757588-21757610 TTATTATTGGATAGTGAGGAGGG - Intronic
1135452923 16:22573728-22573750 TTATTATTGGATAGTGAGGAGGG - Intergenic
1136113443 16:28079461-28079483 TTCTTGGTTGATAGAGAAGTGGG - Intergenic
1136252012 16:29011577-29011599 GTGCTGGTGAACAGAGAGGAAGG - Intergenic
1138124374 16:54426767-54426789 GTGTTGGTGGAGAGAGAAGTGGG + Intergenic
1139111520 16:63897196-63897218 ATGTTGATGGATCGAGATGAAGG + Intergenic
1139560345 16:67737828-67737850 TTACTGCTGGAGAGAGAGGAAGG + Intronic
1141331371 16:83114454-83114476 TGGTTGGTGGATTCATAGGATGG - Intronic
1142693924 17:1623105-1623127 TTCTTGGGGGATGGGGAGGAGGG - Intronic
1143649911 17:8256973-8256995 GGGAAGGTGGATAGAGAGGAAGG - Intronic
1144583748 17:16475314-16475336 GTGTGTGTGGAGAGAGAGGAAGG + Intronic
1144652954 17:17018624-17018646 TTGTTGGAGGATGGTGAGGTGGG + Intergenic
1146423790 17:32716090-32716112 TGATTGATGGATAGTGAGGAAGG - Intronic
1146508349 17:33424713-33424735 GTGTTTGTTGAAAGAGAGGAAGG - Intronic
1146636811 17:34512550-34512572 TTGTTAGGGGATAAAGAAGAGGG - Intergenic
1147283255 17:39380304-39380326 GTGGTGGTGGTTAGAGAGCAGGG - Intronic
1148235324 17:45964839-45964861 GTGTTGTGGGATGGAGAGGAGGG - Intronic
1148439267 17:47703210-47703232 TTGTGGGTGGAGAGAGGGGTGGG - Intronic
1148468318 17:47878008-47878030 TTGTTGGGGGAGAGAGAGAGAGG - Intergenic
1148645430 17:49217509-49217531 TTCCTGGTGGAAAGAGAGTATGG - Intronic
1148808816 17:50277904-50277926 TTGTTGGTGGAGGTAGAGGGTGG - Intronic
1149040071 17:52177377-52177399 TTGTTGATGGCTATAGGGGATGG + Intergenic
1150992513 17:70276113-70276135 TTGTTGCTGGATAATGGGGAGGG + Intergenic
1151247033 17:72803026-72803048 TTTTTGTTTGATAGAAAGGACGG - Intronic
1151390034 17:73780580-73780602 TTGATGGTGGATGGAATGGATGG - Intergenic
1151415312 17:73958235-73958257 TTGCTGGGGGGTGGAGAGGAAGG + Intergenic
1152471724 17:80493231-80493253 TTGGGGGAGGAGAGAGAGGAAGG + Intergenic
1152728095 17:81957540-81957562 TGGTTGTTGGATATAGGGGAAGG - Intronic
1153169147 18:2294788-2294810 TTGTTGGTGTATAGAAATGCTGG + Intergenic
1154316846 18:13311076-13311098 TTGTTGGGGAAGACAGAGGATGG + Intronic
1154490983 18:14922135-14922157 TTGTTGGAGGAGAGAGAGAGTGG + Intergenic
1155484323 18:26325551-26325573 GAGTTGGGGGAGAGAGAGGAAGG + Intronic
1155842688 18:30665794-30665816 TTGCTGGTGGGTAGAGAGTAGGG + Intergenic
1157098340 18:44707712-44707734 TTGTTGATGGGAAGAGAGGTTGG + Intronic
1157188652 18:45561684-45561706 TTGTTGCTGGAGAGGGAGGGAGG - Intronic
1157286015 18:46377974-46377996 GTGGTGCAGGATAGAGAGGAGGG + Intronic
1157472084 18:47997355-47997377 TAGTTGGTGGCTAGGGAGGGAGG + Intergenic
1157595393 18:48860892-48860914 CTGTTGTTGGCTGGAGAGGAAGG + Exonic
1158085822 18:53650754-53650776 TTGTTGTTGTTTAGACAGGAGGG + Intergenic
1158267596 18:55677340-55677362 TTGAAGGTGGGCAGAGAGGAAGG + Intergenic
1158426783 18:57347510-57347532 ATGGAGGTGGAAAGAGAGGACGG - Intergenic
1159183132 18:64935885-64935907 TTGTTAGAGTATAGAGAGGAAGG - Intergenic
1163156599 19:15442974-15442996 GGGTTGGGGGAAAGAGAGGAGGG - Intronic
1164831953 19:31329727-31329749 GTGTTTGTGGAGAGAGAGGCAGG + Intronic
1166275315 19:41749605-41749627 TTGGTGGAGGGCAGAGAGGAGGG - Intronic
1166280339 19:41788402-41788424 TTGGTGGAGGGCAGAGAGGAGGG - Intergenic
1166396403 19:42444342-42444364 TTGGTGGAGGGCAGAGAGGAGGG + Intergenic
1167232208 19:48291936-48291958 TTGTTGTTGGCTATAGAGGGTGG - Intergenic
925192390 2:1895041-1895063 TTATTGGTGTATAGAGATGCTGG - Intronic
926514922 2:13831363-13831385 TTGTTGGTGTATAGAAATGCTGG - Intergenic
927199477 2:20569605-20569627 TTGTTGGTGGACTTAGGGGAAGG - Intronic
927605266 2:24481199-24481221 CTGTTGGTGGGGAGAGAGGATGG - Intergenic
929609160 2:43257091-43257113 CTGTTGGTGGGTGGAGAGGGGGG + Intronic
930794595 2:55375195-55375217 TTGTTTGTGTGTAGAGATGAAGG - Intronic
931854435 2:66287242-66287264 TTGCTGGGGGATAGGGAGAAAGG - Intergenic
932164512 2:69493889-69493911 TTGTTGGAGGAAAGACAAGATGG + Intronic
932426160 2:71636751-71636773 GTGAGAGTGGATAGAGAGGATGG + Intronic
933235928 2:79864348-79864370 TTGTTGGTGCATAGTGGGCAAGG + Intronic
933831268 2:86211185-86211207 AAGTTGGTGAATAGAGAGAATGG - Exonic
935319738 2:101874333-101874355 TAGTTTGTGGATAGACAGGATGG + Intronic
935821030 2:106892890-106892912 TTCTTGGTGGAAAGAGGGGAGGG - Intergenic
936374553 2:111929442-111929464 TTCTTGGTGGAAAGATGGGAAGG + Exonic
936997306 2:118428836-118428858 GTGATGGTGGAGGGAGAGGATGG + Intergenic
938262786 2:129907234-129907256 GTGTTGGTGGACACAGAGCAAGG + Intergenic
940085868 2:149858035-149858057 TTGTTAGTGTTTAGAGAGAAAGG + Intergenic
940620383 2:156105440-156105462 TTGTGAGGGGATAGAGGGGAGGG + Intergenic
941469881 2:165871323-165871345 TGGTTGGTGGGTAGAGAGAGAGG + Intronic
942112688 2:172698274-172698296 TTCTTGGTGGAGAGAAAGGAAGG - Intergenic
943520153 2:188939175-188939197 GGGTTGGTGGATAGAGATGAGGG - Intergenic
944230793 2:197390165-197390187 TAATTTGAGGATAGAGAGGAGGG - Exonic
946386161 2:219385724-219385746 TTGTGGGGGGATTGCGAGGAGGG + Intronic
946553368 2:220827422-220827444 TTGATGGTGGACAGTAAGGAAGG - Intergenic
947387728 2:229608702-229608724 TTGTTTCTGGGTAGAGAGGGAGG + Intronic
948000041 2:234560298-234560320 GTGATGGTGGAGAGAGAGAAGGG + Intergenic
948101878 2:235381637-235381659 TTGTTGGTTGTTGGAGGGGAGGG + Intergenic
948303000 2:236922374-236922396 TTGCCAGTGGATGGAGAGGAAGG + Intergenic
1169815315 20:9650422-9650444 TTGTAGGTGGAGAAAGAGGTTGG + Intronic
1170099011 20:12678246-12678268 TTGCTGATAGATAGAGAGGGAGG - Intergenic
1170412191 20:16103896-16103918 ATGTTGAAGGATAGAGAAGAGGG + Intergenic
1171228641 20:23463618-23463640 TTGTTGGTGTATAGAAATGTTGG + Intergenic
1171354183 20:24531295-24531317 TTGTTACTGTATAGAGTGGAAGG - Intronic
1173581768 20:44152030-44152052 TTGGTGGTGGAGAGGGAGGAAGG - Intronic
1174068434 20:47882949-47882971 TTGTTGGTGCATTTGGAGGATGG + Intergenic
1174330554 20:49813836-49813858 TGGCTGGTGTGTAGAGAGGAAGG + Intronic
1174781515 20:53393304-53393326 ATGTTGGTGGGTAGAGCTGAAGG - Intronic
1175822135 20:61915726-61915748 TTGCTGGTGGGTGGAGAGGAAGG + Intronic
1175969922 20:62680180-62680202 CTGCTGGTGTATAGAGATGACGG + Intronic
1177496113 21:21894567-21894589 CTGTAGGTGGATATGGAGGATGG + Intergenic
1178429872 21:32509653-32509675 TTCTAGGTGGAGAGAAAGGATGG + Intronic
1179119464 21:38529415-38529437 TTGTTGGTGGATGGCTATGAGGG + Intronic
1181442315 22:22943100-22943122 TTGGTGGTGGGTGGAGGGGAGGG - Intergenic
1181734905 22:24874008-24874030 TTGTTAGTGGAAAGAGGAGAGGG + Intronic
1181861885 22:25825288-25825310 TTGGGGGTGGATTCAGAGGAGGG + Intronic
1182109252 22:27711277-27711299 TTGTTGGGGGAGGGAGAGGCAGG - Intergenic
1184663489 22:45976172-45976194 TGGGTGATGGATAGAGACGAAGG + Intronic
950156743 3:10726692-10726714 TTGTTGCTGGATAGACAGATGGG + Intergenic
950167856 3:10815190-10815212 ATGTTTGTGGCTAGAGAGGAAGG - Intergenic
950210928 3:11122568-11122590 ATGGTGGAGGGTAGAGAGGAGGG - Intergenic
950755657 3:15169851-15169873 TTGTTGGAGGATAGACGAGATGG + Intergenic
951583900 3:24195709-24195731 TGGCTGGAGGATAGAGAGAAGGG - Intronic
951685231 3:25336614-25336636 ATGTTGTTGGGCAGAGAGGAAGG - Intronic
952891956 3:38049026-38049048 TTGTTGTTGGCTAGAGATTAGGG + Intronic
953037560 3:39226581-39226603 TTGTTGGGGGCTAGGGAGGGGGG - Intergenic
953434706 3:42869179-42869201 TTTTTGGTGGATGGAATGGAGGG + Intronic
953451594 3:43010982-43011004 TTGTTGGTGGGTGGAGAGGGGGG - Intronic
953665772 3:44925456-44925478 GTGATGGTGGATAGAGGTGAAGG - Exonic
954425526 3:50440951-50440973 TTGTGGGTGGACAGGGACGAGGG + Intronic
955498884 3:59564428-59564450 TTGTTGGTAGGTAGATAGGCAGG + Intergenic
956040504 3:65140234-65140256 TTGTTTGTGGAGAGGGAGGAAGG + Intergenic
956161779 3:66362499-66362521 TGCTTGGGGGATAGTGAGGAAGG + Intronic
956643862 3:71437648-71437670 TGCTGGGTGGAGAGAGAGGATGG - Intronic
956666715 3:71649227-71649249 TTCTTGTTGGATAGACTGGAGGG + Intergenic
957046368 3:75378249-75378271 TTCTAGGTGGAGAGAAAGGATGG - Intergenic
958715722 3:97777693-97777715 TTGTTCTTGGATAGAGCAGAGGG + Intronic
959351449 3:105269841-105269863 GAGTTGGTGAAAAGAGAGGAAGG + Intergenic
960451420 3:117813533-117813555 TTGTTGGGGGATAGAGAATTAGG - Intergenic
961878434 3:130042487-130042509 TTCTAGGTGGAGAGAAAGGATGG - Intergenic
962672081 3:137718628-137718650 TTGTTGGTGTATAGGAATGATGG + Intergenic
963480977 3:145874343-145874365 CTGTTGGGGGATAGGGAGAAAGG - Intergenic
963845828 3:150157016-150157038 TTGCTAGTGGTTAGGGAGGAGGG + Intergenic
964308871 3:155371015-155371037 TTTGTGGTGTCTAGAGAGGAAGG + Intergenic
964436415 3:156658534-156658556 GTGTGGGTGGACAGAGAGCAAGG - Intergenic
964719054 3:159753757-159753779 CTGATGGTGGAGAGTGAGGAGGG - Intronic
964825125 3:160817407-160817429 GTATTGGTGAGTAGAGAGGAAGG + Intronic
964858146 3:161170053-161170075 TTGTTGGTGGGGTGAGGGGAGGG - Intronic
967237657 3:187402713-187402735 ATGATGGTGCATAGGGAGGATGG - Intergenic
967253159 3:187563821-187563843 ATGATGGTGGCTAGAGATGACGG + Intergenic
967557862 3:190878987-190879009 AGGTTGGAGGAGAGAGAGGATGG - Intronic
968527965 4:1074109-1074131 TGGTTGCTGGATAGAGTGAAGGG - Intronic
968990656 4:3909362-3909384 TTCTAGGTGGAGAGAAAGGATGG - Intergenic
969161935 4:5267906-5267928 TCTTTGGGGGATAGAGAGTAGGG + Intronic
970633741 4:17983571-17983593 TTGTTGGTGTATAGGAATGAGGG + Intronic
972181326 4:36470353-36470375 TTGTTTGTATAAAGAGAGGAAGG - Intergenic
974320156 4:60337114-60337136 TTCTTTCTGGCTAGAGAGGATGG + Intergenic
974388514 4:61233934-61233956 TACTTGGGGGATAGAGAGGATGG + Intronic
974476634 4:62389778-62389800 TTGTTTTTGTATAGTGAGGAAGG + Intergenic
974664469 4:64939771-64939793 TTGTTAGGAGATAGGGAGGAAGG + Intergenic
974841307 4:67302680-67302702 ATGGAGGTGGAGAGAGAGGAAGG + Intergenic
974888373 4:67849220-67849242 TTGTTGGTGGAAAGCTAGGATGG + Intronic
980894188 4:138845605-138845627 GTGTAGTTGGAAAGAGAGGAAGG + Intergenic
981106547 4:140888186-140888208 ATGTTGGGGGATGGGGAGGAGGG + Intronic
983213810 4:164984026-164984048 TTGTTGGAAGATAGAGAAGTAGG - Intergenic
983259542 4:165440836-165440858 TTGTTGGTTGCCAGAGAGGCTGG + Intronic
984809172 4:183779029-183779051 TTGTTTGTGGAAATGGAGGATGG - Intergenic
986222058 5:5776706-5776728 ATGATGGTGGGGAGAGAGGAGGG - Intergenic
986262858 5:6163559-6163581 TGGTCAGTGGATAGAGAAGAGGG + Intergenic
986796960 5:11222154-11222176 TTGTGGGTGGGTGGAGAGGCGGG + Intronic
987478497 5:18422426-18422448 TTGTTGGGGGAGGCAGAGGAAGG + Intergenic
987571368 5:19665636-19665658 TTATAGATGGATAGAGAGAATGG + Intronic
987608872 5:20176041-20176063 TTGTTGGGGGAAAAAGATGAAGG - Intronic
989260809 5:39417952-39417974 TTGTTGGTTGCTAGTAAGGAGGG - Intronic
989533824 5:42540678-42540700 GCGGTGGTGGATAGAGGGGATGG - Intronic
989772385 5:45160243-45160265 TTGTTGGTGTATAGAAATGCTGG + Intergenic
990728537 5:58783773-58783795 TTGTTTGTGGATAAAGGGGAAGG - Intronic
990839733 5:60063734-60063756 TTTTTGATGGATAAAGAGGTAGG + Intronic
993363088 5:87002115-87002137 TGGTTGGTGGATGAAGAAGATGG + Intergenic
994432469 5:99684856-99684878 AAGATGGTGGATAGAGAGGAAGG + Intergenic
995908739 5:117159613-117159635 TTCTTGGTGGATGGAGTGGGTGG + Intergenic
995990720 5:118235803-118235825 TTTTTGGTGTATAGCGAGGAAGG - Intergenic
996170138 5:120280455-120280477 TTGTTGGGGGGGAGAGGGGAGGG - Intergenic
996709655 5:126531782-126531804 TTGTTGGTGGACAGAGAGGATGG + Intergenic
997063733 5:130538467-130538489 TGGTTAGTGGAGAGAGAAGATGG + Intergenic
1001461390 5:171918043-171918065 TATTTGGTGAAGAGAGAGGAAGG - Intronic
1001559981 5:172662787-172662809 CTGTGGGTGGTTAGGGAGGAGGG - Intronic
1002573910 5:180161003-180161025 TTGTGGGTGCAAAGAGAGGCCGG + Intronic
1003609010 6:7591352-7591374 TTTTCGGTGGAATGAGAGGAAGG + Intronic
1004445050 6:15690406-15690428 TGGGTGGGGGATACAGAGGAAGG - Intergenic
1005148644 6:22722128-22722150 TTCTTGGTGGCTAGAGGGAATGG + Intergenic
1005990408 6:30898622-30898644 GTGGGGGTGGATGGAGAGGAAGG + Intronic
1006486823 6:34349664-34349686 TAGTGGGTGGATAGGGAGAAAGG - Intronic
1006885160 6:37375610-37375632 TTCTTGGAGGTTGGAGAGGAAGG - Intronic
1007340038 6:41185631-41185653 GTGATGGTGGATGGAGAGAAGGG + Intergenic
1008101860 6:47400459-47400481 TTTTTGGTGAATAGATATGAAGG - Intergenic
1008507159 6:52242320-52242342 TTGCTGGTGAGTATAGAGGATGG - Intronic
1008565422 6:52763381-52763403 TTCTAGGAGGCTAGAGAGGAGGG + Intronic
1008569616 6:52803722-52803744 TTCTAGGAGGCTAGAGAGGAGGG + Intronic
1010725433 6:79327395-79327417 TTGTTGGAGAAAGGAGAGGAAGG - Intergenic
1010828905 6:80507349-80507371 TTGTTGATGCCTAGGGAGGAAGG + Intergenic
1012047868 6:94301389-94301411 TAGTTGGTGGAGAGTGGGGATGG + Intergenic
1012789571 6:103676342-103676364 TTGTTTGTGGAAATAAAGGAGGG + Intergenic
1012949352 6:105501617-105501639 TGGTTGCTGGAGAGAGAAGAAGG + Intergenic
1013677657 6:112484065-112484087 ATGTTGCTGGAGAGAGATGAAGG - Intergenic
1014681189 6:124432721-124432743 TTGTTGGTGGCCATAGAGGCTGG - Intronic
1015161805 6:130160530-130160552 TTCTGGGTGGAGAGACAGGAAGG + Intronic
1015804102 6:137091400-137091422 TTGCCTGTGGACAGAGAGGAGGG + Intergenic
1016275975 6:142352964-142352986 TTTTTGGTGGAGAGAGAGAAAGG - Intronic
1016893975 6:149034541-149034563 TTCTTGGTGGAAAGAGGAGAGGG - Intronic
1017752982 6:157505701-157505723 TTGTTCATGGATAGGGAGGCAGG + Intronic
1018159878 6:161029070-161029092 CTATTGGGGGAAAGAGAGGAGGG - Intronic
1018256507 6:161925039-161925061 TTTTTGGTGAATCCAGAGGAAGG + Intronic
1018492425 6:164307694-164307716 TTGTCTGGGGAGAGAGAGGAGGG + Intergenic
1019423346 7:962072-962094 TAGATGGTGGATAGAGATGATGG - Intronic
1020278062 7:6636840-6636862 TTGTGGGTGGGGAGGGAGGAGGG - Intergenic
1020313488 7:6887482-6887504 TTCTAGGTGGAGAGAAAGGATGG - Intergenic
1020564481 7:9778400-9778422 TTGTTGCTAGATAGTGAGGTAGG + Intergenic
1021228373 7:18055392-18055414 TTGCTTGTGGATAGAGTTGAGGG + Intergenic
1021242782 7:18224909-18224931 AAGTTGGAGGATATAGAGGATGG + Intronic
1021543598 7:21788563-21788585 CTGCTGGTGGGGAGAGAGGAAGG - Intronic
1022169300 7:27808481-27808503 TTTTTGGTGGGTAGGGTGGAGGG + Intronic
1022501014 7:30882429-30882451 TTGGTGGTGGATAGGAAGGCTGG - Intronic
1023675576 7:42626482-42626504 TTGTTGGAGAAAAGAGAGAATGG + Intergenic
1024220836 7:47285196-47285218 TTTGCGGTGGATAGAAAGGATGG - Intronic
1027437170 7:78176249-78176271 TTCTTGGTGCTTTGAGAGGAGGG - Intronic
1027711963 7:81615463-81615485 TTGATGGTGGATATGGAGGATGG - Intergenic
1028614934 7:92755498-92755520 TTGTTGGTGAATAGAGCTGTGGG - Intronic
1031179444 7:118395381-118395403 TTGCTGGTGGATAGTAAGAAAGG + Intergenic
1031869398 7:127075732-127075754 TTATTGGGGGAGGGAGAGGAAGG + Intronic
1032158808 7:129494001-129494023 TTGCTGGGGGATTGAGAGGGAGG - Intergenic
1033061136 7:138109362-138109384 ATGTGGGTGGAGAGAAAGGAGGG - Intronic
1033803210 7:144925552-144925574 CTGTTGGGGGATAGAGGGAAAGG - Intergenic
1037694215 8:21209329-21209351 TTGTTGGGGTGTAGAGAGAAGGG + Intergenic
1037773087 8:21814501-21814523 GAGGTGGTGGAGAGAGAGGAGGG - Intergenic
1038321594 8:26532052-26532074 ATGTTTGTGTAGAGAGAGGAAGG + Intronic
1038988765 8:32843128-32843150 TTGTTGAGGGATATAGAAGACGG + Intergenic
1041486083 8:58377709-58377731 TTATTGGAGAATGGAGAGGAAGG + Intergenic
1041758876 8:61342282-61342304 TGGTGGGAGGATAGAGAGAAAGG + Intronic
1042282177 8:67066199-67066221 TTGCTGGGGGAAAGAGAGGGAGG - Intronic
1042287691 8:67132333-67132355 TTGCTGGTGTATACAGAGAATGG + Intronic
1042427741 8:68668735-68668757 CTGTTGATGGGCAGAGAGGAAGG + Intronic
1044099927 8:88122624-88122646 TGCTTAGTGGATAGATAGGATGG + Intronic
1046886269 8:119370889-119370911 TTGATGGTGGAAAAAGAGGATGG - Intergenic
1048648913 8:136453065-136453087 TTGTCAGTGGGTAGGGAGGATGG - Intergenic
1049652976 8:143783839-143783861 TTGATGGTGTAGAGTGAGGAGGG - Intergenic
1051428619 9:16959943-16959965 TTGGTGGTGGAGAGAAAGGGAGG - Intergenic
1051938942 9:22481068-22481090 TTGGTGGGGGATAGAGTGGACGG - Intergenic
1052394709 9:27924880-27924902 TTGTTGGTGAAGGGAGAGGAGGG - Intergenic
1052835488 9:33246924-33246946 CTGGTGGTGGATAGGGAGTAGGG + Intronic
1053239076 9:36481798-36481820 TTTTTCTTGGAGAGAGAGGAGGG - Intronic
1053466732 9:38313977-38313999 CTGTTGGGGGTTAGAGAGCAAGG - Intergenic
1054738678 9:68782112-68782134 TTGGTGGGAGATGGAGAGGAAGG - Exonic
1054748980 9:68885307-68885329 TAGTGGGTGGATAGAGAATAGGG + Intronic
1055074268 9:72197526-72197548 CGGTTGGAGGATGGAGAGGAGGG + Intronic
1055111357 9:72563184-72563206 TTGGTGGTGGATGGAGATGCAGG + Intronic
1056097362 9:83269007-83269029 TTGTTGGTGACTAGTGAGGGAGG - Intronic
1058024029 9:100120611-100120633 TTATTTGTGGAAAGAAAGGATGG - Intronic
1061234335 9:129333860-129333882 TTTCTGGAGGAGAGAGAGGAAGG - Intergenic
1061274613 9:129562218-129562240 TTGCTGGAGGACAGAGAGAATGG - Intergenic
1061277714 9:129579026-129579048 TTGTTGGGGGAGAGGGAGGATGG - Intergenic
1061375582 9:130222562-130222584 ATGTTGGGGTACAGAGAGGAGGG + Intronic
1203770963 EBV:49938-49960 GCGGCGGTGGATAGAGAGGAGGG + Intergenic
1186291880 X:8109135-8109157 TTGTTGGTGCATAGAGAATGAGG - Intergenic
1186726763 X:12366254-12366276 CTGTTGGTGGACATAGAGGATGG + Intronic
1187104441 X:16225696-16225718 TTGTTGGGGGCTGGAGATGATGG + Intergenic
1188758367 X:33993751-33993773 TTGAAGGTGGAGTGAGAGGAGGG - Intergenic
1189358284 X:40328023-40328045 TTGTGCATGGATAGAGTGGAGGG + Intergenic
1189624294 X:42879199-42879221 TTGGGAGGGGATAGAGAGGAGGG - Intergenic
1189732359 X:44034458-44034480 GTGTTGGTGGGGAGAGAAGAGGG - Intergenic
1189885540 X:45540772-45540794 ATGTGGGTGGATACATAGGAGGG + Intergenic
1190688482 X:52894614-52894636 TTGTTGGTGGTCATCGAGGAGGG + Intronic
1190697501 X:52961178-52961200 TTGTTGGTGGTCATCGAGGAGGG - Intronic
1191161907 X:57338596-57338618 TTGTTGGTGAATAGAAATGCTGG - Intronic
1191910673 X:66146171-66146193 TTGTAGATAGATAGATAGGAAGG + Intergenic
1195906360 X:109848522-109848544 TGGTTGGTGGATGGAGGGGGTGG - Intergenic
1196143900 X:112296150-112296172 ATGAGGTTGGATAGAGAGGAAGG - Intergenic
1196358834 X:114828652-114828674 TTGGTACTGGATAGAGATGACGG - Intronic
1198034033 X:132783524-132783546 GTGTGGGTGGGTAGAGATGAAGG - Intronic
1199929033 X:152499495-152499517 TTGTTGGTGGATGAAGTGCAGGG - Intergenic