ID: 919944874

View in Genome Browser
Species Human (GRCh38)
Location 1:202311831-202311853
Sequence CACAGTGTATGGAGGGCAAA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 229
Summary {0: 1, 1: 0, 2: 0, 3: 18, 4: 210}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
919944864_919944874 24 Left 919944864 1:202311784-202311806 CCTTCTGGTGTACATGTATAGGG 0: 1
1: 0
2: 0
3: 1
4: 71
Right 919944874 1:202311831-202311853 CACAGTGTATGGAGGGCAAATGG 0: 1
1: 0
2: 0
3: 18
4: 210

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
919944874 Original CRISPR CACAGTGTATGGAGGGCAAA TGG Intronic
901266498 1:7914383-7914405 CACCATGGATGGACGGCAAAAGG - Intergenic
901499212 1:9641263-9641285 TCCAGTGTATGGAGGGCATGAGG + Intergenic
901679376 1:10904273-10904295 CCCAGTGTCTGGAGGCCAAACGG + Intergenic
902191824 1:14769101-14769123 CACTGTGAATGGACAGCAAAGGG - Intronic
903756360 1:25664133-25664155 CAGAGCGTGTGGAGGGCAGATGG - Intronic
904356344 1:29942565-29942587 CACAGGGTCTGGGGGGCAGAGGG + Intergenic
906886151 1:49650996-49651018 CTCTGTGTACGGAGGGCAGATGG - Intronic
909275869 1:73686142-73686164 GTCAGTGGATGGGGGGCAAAGGG - Intergenic
909490452 1:76220581-76220603 GACAGTGTTTTGAGGGCACATGG + Intronic
909775125 1:79474878-79474900 CTCAGGGTATGAAGGTCAAACGG + Intergenic
911616694 1:100020646-100020668 CACAGTGAATGAAGAGCATATGG + Intronic
912673433 1:111653242-111653264 GAGACTGTAGGGAGGGCAAATGG + Intronic
918586766 1:186197169-186197191 CAGAGAGTAAGGAGGACAAAAGG + Intergenic
919944874 1:202311831-202311853 CACAGTGTATGGAGGGCAAATGG + Intronic
920693521 1:208164535-208164557 CACAGAATTTGGAGGGAAAAGGG + Intronic
923132556 1:231089951-231089973 CACAGTGGATTGAAGACAAATGG + Intergenic
1066189678 10:33044909-33044931 GACAGGGTATGGAGGGGAGATGG + Intergenic
1066677813 10:37906643-37906665 CACTGTGCATGGAGATCAAATGG - Intergenic
1068280989 10:54869486-54869508 CACAGTGTATGTAGAGAATAGGG + Intronic
1069592743 10:69652192-69652214 CACAGGGGATGCAGGGCACAGGG - Intergenic
1070644004 10:78188896-78188918 CACACTGTGGGGAGGGAAAAAGG + Intergenic
1074815039 10:117136809-117136831 GACACTGTGTGGAGGGCAAGGGG + Intronic
1074822075 10:117187282-117187304 AACACTGGGTGGAGGGCAAAGGG - Intergenic
1075617382 10:123901080-123901102 CAAAGTCCCTGGAGGGCAAAAGG - Intronic
1075747135 10:124735856-124735878 CACATGGCATGGCGGGCAAAGGG + Intronic
1077245021 11:1532566-1532588 CACCATGTCTGGAGGGGAAAAGG + Intergenic
1077601694 11:3579287-3579309 CATAGTGTATGGTGGATAAATGG - Intergenic
1078171481 11:8932169-8932191 CAGGGTGCTTGGAGGGCAAAGGG + Exonic
1078431337 11:11290830-11290852 CAGAGTCTATGGAGGTCACAAGG - Intronic
1078882959 11:15471342-15471364 CACAGCGTGTTGAGAGCAAAAGG - Intergenic
1084212953 11:67632254-67632276 CACAGTGGGCGGAAGGCAAAGGG - Intronic
1084257601 11:67953834-67953856 CATAGTGTATGGTGGATAAATGG - Intergenic
1084815166 11:71641403-71641425 CATAGTGTATGGTGGATAAATGG + Intergenic
1085324388 11:75595433-75595455 CACATTGTAAGGAGGGCAGTTGG - Intronic
1086517819 11:87634029-87634051 GACAGTGTATGGAAAGTAAATGG + Intergenic
1088367288 11:109052971-109052993 AACAGTGTGGGGAGGGTAAAGGG + Intergenic
1088650500 11:111953739-111953761 CACAGTGGAAGGAGTGGAAAAGG + Intronic
1091971001 12:4786941-4786963 CACAGTGGATTGAGAGCAAAAGG - Intronic
1092427835 12:8388656-8388678 CATAGTGTATGGTGGATAAATGG - Intergenic
1092429107 12:8395643-8395665 CATAGTGTATGGTGGATAAATGG - Intergenic
1092625290 12:10320304-10320326 GGCAGTGGATGGAGGCCAAAAGG + Intergenic
1092694681 12:11157365-11157387 AACAGTGTAAGGAGAGTAAAAGG - Intronic
1098375634 12:69810630-69810652 GTCAGTGTATGGAGAGGAAAGGG + Intronic
1100021237 12:90071806-90071828 CACAGTGTTTTTAAGGCAAAAGG + Intergenic
1100220972 12:92504355-92504377 CCCTGTGTATGGAGCTCAAAGGG - Intergenic
1100543374 12:95578892-95578914 CACAGTGTCTGGAGTACAAAAGG + Intergenic
1101546136 12:105714841-105714863 CACAGAGTTGGGAGGGCAAAGGG - Intergenic
1108692362 13:52870948-52870970 CAGAGTGTAGGGAGTGCAAGAGG + Intergenic
1109947698 13:69459442-69459464 CACAGAGTATTGAAGGAAAAAGG + Intergenic
1110077800 13:71271422-71271444 CACAGTGAATGAAGGACAAAAGG - Intergenic
1110884007 13:80609757-80609779 TATAGAGTATTGAGGGCAAAGGG + Intergenic
1112043409 13:95571238-95571260 CACAGTGCATGGAAGGATAATGG + Intronic
1115736059 14:36331338-36331360 CACAGGGAGTGGAGGGCAAGGGG - Intergenic
1118877483 14:69797458-69797480 CACACTCAGTGGAGGGCAAAGGG - Intergenic
1119192002 14:72689284-72689306 CACAGGGTTTGCAGGGCCAAGGG - Intronic
1119881873 14:78106101-78106123 CACAGTGCATGGATACCAAAGGG + Intergenic
1120157193 14:81106588-81106610 GAGAGTGTATGGAGGCAAAATGG + Intronic
1120815572 14:88854253-88854275 CATCGTATATGGATGGCAAAAGG - Intronic
1125371500 15:38983227-38983249 CACAGAGTAAGGAGGCCAGAGGG + Intergenic
1126686478 15:51252691-51252713 TCCAGTGCATGGAGGGCACACGG + Intronic
1128908741 15:71492872-71492894 GACATTTCATGGAGGGCAAAGGG - Intronic
1131647708 15:94363205-94363227 CACATTGTATGCTGGGCAGAAGG + Intronic
1131998074 15:98152177-98152199 GACAATGTCAGGAGGGCAAATGG - Intergenic
1132428089 15:101737472-101737494 CAAAATGTATGGGGGGGAAAAGG + Intronic
1133370407 16:5241715-5241737 CATAGTGTATGGTGGATAAATGG + Intergenic
1133856798 16:9557144-9557166 CACAGTGTAGGAAGGTCACAAGG + Intergenic
1134189649 16:12111367-12111389 CACAGGTCATGGAAGGCAAAGGG - Intronic
1137601767 16:49761092-49761114 CACTGTGTTTGGGAGGCAAAGGG - Intronic
1137695899 16:50461886-50461908 CACACTCTATGGAGAGAAAACGG - Intergenic
1141474884 16:84266176-84266198 CACAGAACATGGAGGGCACATGG + Intergenic
1141583967 16:85020655-85020677 GTCAGTGTGTGGAGGGCAAGGGG + Intergenic
1144077517 17:11732792-11732814 CACAGGGCATGGAGGGGAACAGG - Intronic
1144669312 17:17123869-17123891 CACAGAGAAAGGAGAGCAAATGG - Intronic
1146031444 17:29369598-29369620 CACAGAGGCTGTAGGGCAAATGG + Intergenic
1148238314 17:45983663-45983685 CCCAGTGTAGGGCGGGCCAAAGG + Exonic
1151965221 17:77427678-77427700 CACAGAGTGTGGATGGCAAAAGG - Intronic
1153307887 18:3649533-3649555 CACAGTGTACGGAAGGCAGTAGG - Intronic
1153537408 18:6116861-6116883 CACAGGGTTTGGAAGGCACATGG - Intronic
1155876214 18:31091945-31091967 CACAGTGTTTAGAAGGAAAAGGG - Intronic
1156852835 18:41747937-41747959 CACAGTGTCTGGAAGGAAAAAGG + Intergenic
1157020369 18:43774108-43774130 GACAGTGTATGGAAAGCACATGG - Intergenic
1158539235 18:58337743-58337765 CACAGCGTATGGAGTTGAAAGGG - Intronic
1158962955 18:62601585-62601607 CACAAAGCATGGAGGGAAAACGG + Intergenic
1162378394 19:10318059-10318081 CAGAGTGGATGGAGGACAATAGG + Intronic
1164479085 19:28597798-28597820 CACAGTGTGTGGCTGGCAAGTGG + Intergenic
1168008343 19:53509212-53509234 CACAGAGGAAGGAGGGCAGATGG - Intergenic
1168113819 19:54209683-54209705 CACAGAGCCTGGAGGGCAGATGG + Intronic
926677687 2:15639954-15639976 CACACTGTAGGGAGAGAAAAAGG - Intergenic
927152876 2:20205779-20205801 CACAGTGTAGGGTGGGCTGATGG - Intronic
927449576 2:23195935-23195957 CAAAGTGTAGGAAGGGTAAATGG + Intergenic
927964223 2:27259122-27259144 CTCTGTGTATGGAAGGAAAAGGG - Intronic
928296763 2:30090473-30090495 CACAGTGTCAGGAAGGCCAAAGG + Intergenic
929564993 2:42978640-42978662 CCCAGTGGATGGAGGGCACATGG + Intergenic
929961674 2:46501476-46501498 CACAATGTATGCAGAGGAAAAGG + Intronic
930279515 2:49353745-49353767 CACAGTGTGATGAGGGCTAAGGG + Intergenic
930914620 2:56672036-56672058 CACAATCTATGGAGGGGAAAAGG - Intergenic
932432929 2:71686262-71686284 CACATGGTATGGATGGCAAGTGG + Intronic
932760360 2:74435750-74435772 CACAGTGTATGGAGGAGAGCTGG - Intronic
940846465 2:158647864-158647886 CACAAAGTATGGAGGACAGATGG + Intronic
942927089 2:181446833-181446855 AACAGTTTATTGTGGGCAAAGGG + Intergenic
944063968 2:195599862-195599884 GTCAGTGGGTGGAGGGCAAAGGG - Intronic
944637607 2:201689924-201689946 CCCTGTTTATGAAGGGCAAATGG + Intronic
944796067 2:203186689-203186711 CACAGTGAATTGAAGGCCAAAGG + Intronic
945093487 2:206197898-206197920 AACAGTGTATTGAGAGAAAATGG - Intronic
945425353 2:209694162-209694184 AAAAGTGTATGGAGAGAAAAGGG + Exonic
946573649 2:221051103-221051125 CACAATTTATGGATGGAAAATGG + Intergenic
946748107 2:222865659-222865681 CACAGAGTAGGGAAGGAAAAGGG + Intronic
947866341 2:233400411-233400433 CACTGGGTGTGAAGGGCAAAGGG - Intronic
948820001 2:240537951-240537973 GACAATGTATGGACAGCAAAAGG - Intronic
1169100017 20:2939466-2939488 CACAGTGTCTGGTGAGGAAAAGG + Intronic
1169450959 20:5710572-5710594 CACAGCGTATGGTGGGAAAGTGG - Intergenic
1172587463 20:36094584-36094606 CACAGGATTTGGAGTGCAAAGGG + Intronic
1172728538 20:37066892-37066914 GACAGTGTAGGAAGGGCAGAGGG + Intronic
1173910632 20:46667195-46667217 AACAGTGTATGGAGGGACAAAGG + Intronic
1174716293 20:52762370-52762392 CACAGTGTATGAAATGCACAGGG + Intergenic
1177206569 21:18017429-18017451 CAGAGTGGCTGGAAGGCAAAGGG - Intronic
1177692050 21:24523121-24523143 AAGAGTGAAAGGAGGGCAAAGGG + Intergenic
1177953248 21:27565596-27565618 CACAGTGTATTAAGGGCCACTGG + Intergenic
1180033194 21:45226260-45226282 CACAGTCTATGGAACGCTAATGG + Exonic
1181928969 22:26383985-26384007 CACAGTGGAGGGAAGGGAAAAGG + Intergenic
1182997418 22:34826835-34826857 CAGAGCATATGGAGGGCATAGGG + Intergenic
1183150865 22:36036435-36036457 CACATTATGTGAAGGGCAAAAGG - Intergenic
1184615959 22:45639066-45639088 CGCAGTGTGGGGACGGCAAAAGG + Intergenic
1185285074 22:49996455-49996477 CTCAGTGGCTGGTGGGCAAAGGG + Exonic
1185419971 22:50729732-50729754 CACAGCGTGTGGACGGCAAGAGG - Intergenic
952345580 3:32481143-32481165 GACAGTTTATGGATGGGAAATGG + Intronic
952471872 3:33663116-33663138 CACATTGTATGCATGGAAAATGG + Intronic
953366699 3:42351533-42351555 CACAGTGTTTTAAGGGCAGAAGG + Intergenic
954057289 3:48037841-48037863 CACAGTTTATAGAGGGTAATAGG - Intronic
954601677 3:51875265-51875287 CAGAGTGTATGGGGGGAAATAGG + Intronic
955387175 3:58489132-58489154 CACGGTGCTGGGAGGGCAAAGGG - Intergenic
955998513 3:64703524-64703546 TACAGTGTATGAATGGCAATAGG + Intergenic
956284568 3:67595205-67595227 CACAGTGTTTGGAGTTTAAAGGG - Intronic
956455655 3:69418360-69418382 CACAGGGTGTGGAGGTCATAGGG - Intronic
956760465 3:72438909-72438931 CGCTGTGTATGGAGGGCAGACGG + Intronic
957072533 3:75578322-75578344 CATAGTGTATGGTGGATAAATGG - Intergenic
957426800 3:80050884-80050906 CACAGGGGATGCAGGGCACAGGG - Intergenic
960306342 3:116066176-116066198 CACAGAGTATGGAAGGGGAAAGG + Intronic
961281545 3:125768430-125768452 CATAGTGTATGGTGGATAAATGG + Intergenic
961535821 3:127569899-127569921 CACAGTGTCAGGAGGTCAGAGGG + Intergenic
961872825 3:130001150-130001172 CATAGTGTATGGTGGATAAATGG - Intergenic
963731035 3:148972829-148972851 CACAGTATATTGAGGGAGAAGGG + Intergenic
963908179 3:150791503-150791525 CTCTGTGTGTGGAGGGCACATGG - Intergenic
964439056 3:156685904-156685926 CAAGGTGTAGAGAGGGCAAATGG + Intronic
964545091 3:157825822-157825844 AACAGTGTTGGGAGGGAAAATGG - Intergenic
969016136 4:4105657-4105679 CATAGTGTATGGTGGATAAATGG - Intergenic
969737817 4:9002691-9002713 CATAGTGTATGGTGGATAAATGG + Intergenic
971110348 4:23578111-23578133 CACAGTGTAGGGATGGAAAGGGG - Intergenic
971184061 4:24356885-24356907 CCCAGGGTATGGAGGGGAATTGG - Intergenic
971388194 4:26160873-26160895 CACAGTCTATTGAGGGGAAAGGG + Intergenic
971807874 4:31384020-31384042 CACACTGCAGGGTGGGCAAAAGG + Intergenic
972798715 4:42449411-42449433 CACTGTTTGTGGATGGCAAAAGG + Intronic
975019749 4:69471607-69471629 CACAGTTTTTGGATGGCAAATGG + Intergenic
975028744 4:69585992-69586014 CACAGTTTCTGGATGACAAATGG + Intergenic
977628331 4:99213744-99213766 CAACCTGTATGGAAGGCAAAGGG + Exonic
977882834 4:102225505-102225527 AACAGTGTATTGAAGGGAAAAGG - Intergenic
978664001 4:111161739-111161761 CAGAGTGTAGGGAGGGTAAATGG + Intergenic
980381730 4:132029639-132029661 CACAATGTATGCTGGGCAACTGG + Intergenic
985525513 5:399487-399509 CTCTGTGACTGGAGGGCAAATGG - Intronic
985730315 5:1543852-1543874 CAAAGGGAAGGGAGGGCAAAGGG - Intergenic
986062885 5:4208289-4208311 CAAAGTGAATGGAAGCCAAAGGG + Intergenic
986834321 5:11617904-11617926 CACATTTTATGGATGGAAAAGGG + Intronic
986871853 5:12058005-12058027 TACAATGTATGGAGGGTGAATGG + Intergenic
989628549 5:43457255-43457277 GAAAATGTATGCAGGGCAAAGGG + Intronic
991660651 5:68947486-68947508 CACAGGGTATGGCAGGGAAAGGG - Intergenic
992786811 5:80177796-80177818 CACAGTGTCTGGTGGGCAGATGG + Intronic
993001435 5:82385157-82385179 GACAGTGAATGGAGGGCACTTGG + Intronic
996082437 5:119270608-119270630 TAATGTGTATGGAGGACAAAAGG - Intronic
997305948 5:132836575-132836597 CACAGAGACTGGTGGGCAAAGGG - Intergenic
997307488 5:132849632-132849654 CACAGTTTATTGAAGTCAAAAGG - Intergenic
997728214 5:136140437-136140459 CACAGTGTACGAGGGGGAAAAGG - Intronic
997762547 5:136463476-136463498 CACAGTGATTGGAGGTCAGAGGG - Intergenic
1002130747 5:177080051-177080073 CAAAGTGGATGGAGGGGAACTGG - Intronic
1003474561 6:6469558-6469580 ACAAGTGTTTGGAGGGCAAAAGG + Intergenic
1004094419 6:12538625-12538647 TTAAGGGTATGGAGGGCAAAGGG + Intergenic
1004562852 6:16767391-16767413 CACAGTGTAAGGGGGGAACATGG - Intergenic
1005382389 6:25250041-25250063 CACAGTATATTAAGGGGAAATGG + Intergenic
1007777710 6:44233070-44233092 CTCAGTAGAGGGAGGGCAAAAGG + Intronic
1008842125 6:55915445-55915467 CAAAATGTGTGGAGGGCTAAAGG - Intergenic
1010850296 6:80767452-80767474 CACAGTGTCTGGAGGACAGTAGG - Intergenic
1010898975 6:81402275-81402297 CAAAGTGTATCAAGTGCAAAGGG - Intergenic
1011118253 6:83920486-83920508 CACAGAGGATGGATGGCTAAGGG + Intronic
1011210529 6:84951310-84951332 CTAATTGTATAGAGGGCAAAAGG + Intergenic
1012819337 6:104065483-104065505 AAGAGTGTATGGAGAGCAATAGG + Intergenic
1017537750 6:155366565-155366587 CCCAGAGAATGAAGGGCAAAGGG - Intergenic
1018966363 6:168492942-168492964 CACAATGTATGGAGAGCTCAAGG - Intronic
1019621258 7:1993282-1993304 CACAGTGCAGGGAGGGCACAGGG + Intronic
1021054481 7:16029987-16030009 CACTATGTAAGGAGGACAAATGG - Intergenic
1022205190 7:28157136-28157158 CAGAGTGTCTGCTGGGCAAATGG + Intronic
1023266984 7:38417027-38417049 TACAGTCTATGAAGGGTAAATGG + Intronic
1023385704 7:39655400-39655422 ATCAGTGTATGGAGGGGAGATGG + Intronic
1023837649 7:44077732-44077754 AGCAGTGTGTGCAGGGCAAATGG - Intronic
1026557830 7:71423132-71423154 GACAGGGTATGGTGGGCCAAAGG + Intronic
1029074803 7:97927302-97927324 CATAGTGTATGGTGGATAAATGG - Intergenic
1030542226 7:110845139-110845161 CACAGTGAATGAAGGTGAAAGGG - Intronic
1032383579 7:131506560-131506582 CACAGTGAGTGGAGGGCAAGGGG - Exonic
1032499801 7:132391791-132391813 CACAATCTTTGGAGGGCACAAGG + Intronic
1033781412 7:144674045-144674067 CACAGTGCAGGAAGGGAAAAGGG + Intronic
1034975197 7:155444850-155444872 CAGAGTGTGTGGAGGACACAAGG + Intergenic
1036242911 8:7093952-7093974 CATAGTGTATGGCGGATAAATGG + Intergenic
1036898912 8:12657484-12657506 CATAGTGTATGGCGGATAAATGG - Intergenic
1037896253 8:22658285-22658307 CTGTGTGTACGGAGGGCAAAGGG + Intronic
1038003855 8:23413467-23413489 CACTGTGTATGAGGGGCATATGG - Intronic
1039728382 8:40247967-40247989 CACAGTGTATGGAGAAAAATTGG - Intergenic
1041923897 8:63215656-63215678 CAAAGGGTATGAAGGACAAATGG - Intergenic
1043072499 8:75656577-75656599 CACAGTATATGCAAGGTAAATGG + Intergenic
1044132478 8:88542320-88542342 AAAAATGTATGGAGGACAAAAGG + Intergenic
1044637709 8:94343002-94343024 CACAGGGTCTGGATGGAAAAAGG + Intergenic
1044875853 8:96665782-96665804 CTCAGTATATGGTAGGCAAATGG + Intronic
1045548179 8:103146897-103146919 CAAAGTGTCTGGAGAGCCAATGG - Intronic
1047209614 8:122830849-122830871 CACAGTTTCATGAGGGCAAAAGG + Intronic
1047457140 8:125025336-125025358 TACAGTGGGTGGAGGGCAAGGGG + Intronic
1048356126 8:133655219-133655241 CACAGTCTGTGCAGGGCAGAGGG + Intergenic
1048455033 8:134570009-134570031 CACAGTGGCTGCAGGGCACAGGG + Intronic
1049707012 8:144047683-144047705 CACAGTGCACTGAGGGCAGATGG + Intergenic
1050297177 9:4217298-4217320 CACAGTGCTTTTAGGGCAAATGG - Intronic
1052549079 9:29924430-29924452 CACAGTTTACGGAGGACGAAAGG - Intergenic
1052763159 9:32613156-32613178 CACAGTGTATTGAGTGGAAAGGG - Intergenic
1055858122 9:80716696-80716718 CACAGTGTTTAAAGGGCAATGGG + Intergenic
1056487028 9:87069410-87069432 CACAGTGTCTGGAAGACAGAAGG + Intergenic
1057399141 9:94707158-94707180 CACAATGTCTTCAGGGCAAAGGG + Intergenic
1058954382 9:109931873-109931895 CACAGTGTTGGGAGGCCCAATGG - Intronic
1060015370 9:120081987-120082009 CACAGGGTGTTGAGGGCTAAGGG + Intergenic
1060868159 9:127016232-127016254 TTCAGTGTTTCGAGGGCAAATGG - Intronic
1061872470 9:133528209-133528231 CCCAGAGTCTGGAGGGCATATGG - Intronic
1062396471 9:136354849-136354871 CACAGGGTGTGGTGGGCACAGGG + Intronic
1189338681 X:40187487-40187509 CAGAGTGGATGGAGGGAAATGGG + Intergenic
1190158026 X:48009294-48009316 AACAGTGAATGGAGGGCCCAAGG - Intronic
1190173797 X:48132178-48132200 AACAGTGAATGGAGGGCCCAAGG - Intronic