ID: 919945331

View in Genome Browser
Species Human (GRCh38)
Location 1:202315058-202315080
Sequence CCCTTGGGTGGCTGCTTGAG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 203
Summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 186}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
919945320_919945331 17 Left 919945320 1:202315018-202315040 CCTCCTTTCGTAATTCCTGGGGA 0: 1
1: 0
2: 0
3: 6
4: 88
Right 919945331 1:202315058-202315080 CCCTTGGGTGGCTGCTTGAGGGG 0: 1
1: 0
2: 0
3: 16
4: 186
919945321_919945331 14 Left 919945321 1:202315021-202315043 CCTTTCGTAATTCCTGGGGAAGG 0: 1
1: 0
2: 0
3: 6
4: 124
Right 919945331 1:202315058-202315080 CCCTTGGGTGGCTGCTTGAGGGG 0: 1
1: 0
2: 0
3: 16
4: 186
919945318_919945331 18 Left 919945318 1:202315017-202315039 CCCTCCTTTCGTAATTCCTGGGG 0: 1
1: 0
2: 1
3: 13
4: 111
Right 919945331 1:202315058-202315080 CCCTTGGGTGGCTGCTTGAGGGG 0: 1
1: 0
2: 0
3: 16
4: 186
919945324_919945331 2 Left 919945324 1:202315033-202315055 CCTGGGGAAGGAACTGGAGTTCT 0: 1
1: 0
2: 2
3: 28
4: 271
Right 919945331 1:202315058-202315080 CCCTTGGGTGGCTGCTTGAGGGG 0: 1
1: 0
2: 0
3: 16
4: 186

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
919945331 Original CRISPR CCCTTGGGTGGCTGCTTGAG GGG Intronic
904279024 1:29405415-29405437 AGCTTGGGTTGCTGCTTCAGAGG + Intergenic
904313910 1:29647409-29647431 CCCTTGGGTTGTTGTTTGAAGGG + Intergenic
905576128 1:39046121-39046143 CACTTGGGAGGCTGCTGAAGTGG - Intergenic
907246049 1:53109817-53109839 CCCTGGGGTGGGGGCGTGAGGGG + Intronic
909984563 1:82144670-82144692 CCCCTGGGTGGCTGCCTGGATGG - Intergenic
911727564 1:101258081-101258103 CCCTGGGGTGATTGCTTGAGTGG + Intergenic
912471835 1:109911622-109911644 GACTTGGGTGGCTGTTTGGGGGG + Intronic
915557746 1:156669764-156669786 CCCTGGGATGACAGCTTGAGGGG - Exonic
917432973 1:174989969-174989991 TCCTTGGGTGGCTGGGTGACCGG - Intronic
919338058 1:196265632-196265654 CCATTGGGTGGTTGCTTGTATGG + Intronic
919945331 1:202315058-202315080 CCCTTGGGTGGCTGCTTGAGGGG + Intronic
920420839 1:205832295-205832317 CCCTTCTGTGGCTCCTAGAGAGG + Intronic
1067026801 10:42849395-42849417 CTCTTGTCTGACTGCTTGAGAGG - Intergenic
1069864037 10:71490004-71490026 CTTTGGGGTGCCTGCTTGAGGGG + Intronic
1072067382 10:91884167-91884189 TCCCTGGGGCGCTGCTTGAGTGG + Intergenic
1072395699 10:95038361-95038383 CCCTTGGGTAGCGGCTAGAGGGG - Intronic
1073107326 10:101039616-101039638 TCCTTGGGCTGCTGCTTTAGTGG + Exonic
1073556414 10:104456477-104456499 TCCTTGGGTGGCTTCATAAGAGG + Intergenic
1076219608 10:128722660-128722682 CCTTCGGATGGCTGCTCGAGGGG + Intergenic
1076912576 10:133399134-133399156 ACCTGGGGTGGCTCCATGAGTGG + Intronic
1077096322 11:800634-800656 CCCTTCGGCGGCTGCTGGAGCGG - Exonic
1077200249 11:1303301-1303323 CCCTTGGCCTGCTGCTTGACTGG - Intronic
1077284354 11:1759183-1759205 CCCTGGGGAGGCAGCTTGGGGGG - Intronic
1078017108 11:7624335-7624357 TCCTCGGGTGGTTGCTTGTGAGG + Intronic
1079999884 11:27335099-27335121 TCCTTGGGAGGCTACTTGGGAGG - Intronic
1080258575 11:30321473-30321495 CCAATGGGTGGCTGATTTAGAGG - Intergenic
1084414650 11:69024554-69024576 CCATGGGGTGGCTCCTTGACTGG - Intergenic
1088570533 11:111219314-111219336 CTCTTTGGAGGCTGCTTGTGGGG + Intergenic
1089331120 11:117689673-117689695 CCCTTGGGTTCCTCCTTGGGAGG - Intronic
1089494735 11:118902373-118902395 GCCGTGGGTGGCTGCTGGGGGGG + Exonic
1089498129 11:118918051-118918073 CCCTTGGGGGGTGGCTTCAGTGG + Intronic
1091056159 11:132420938-132420960 CCCTTGGGTGGAATCTTCAGGGG - Intronic
1094807402 12:34106835-34106857 CCCTTGGGCTGCTGCATCAGTGG - Intergenic
1095362319 12:41357749-41357771 GCCTTCGCTGGCTGTTTGAGTGG + Intronic
1096037610 12:48486329-48486351 CCCTTGACTGGCTGGTGGAGTGG + Intronic
1096148724 12:49295830-49295852 CCCTTGGGCTGCTGATGGAGAGG - Intronic
1096505066 12:52087498-52087520 CCCCTGGGTGGTTGCTCCAGCGG + Intergenic
1101083085 12:101208984-101209006 CACTTGGGTGCCTGTTTCAGTGG + Intronic
1103206260 12:119131359-119131381 ACCTTGTGTGGCTACATGAGAGG - Intronic
1106330481 13:28734780-28734802 CCCTGGGGTGGACGCCTGAGAGG - Intergenic
1106558760 13:30831634-30831656 TCCTTGGGAGGCTACTTGGGAGG + Intergenic
1107602488 13:42028112-42028134 CCCATTAGTGGCTGCTGGAGAGG - Intergenic
1108517076 13:51213522-51213544 CACTTGGGTTGCTTCTTGAGGGG + Intergenic
1113467520 13:110522745-110522767 CCGTGGGGTGGCTGCTTTATTGG - Intergenic
1113640795 13:111955438-111955460 CCCTGCGGTGCCTGCTGGAGGGG + Intergenic
1113994258 14:16053502-16053524 CATTTGGGAGGCTGCGTGAGCGG + Intergenic
1115218125 14:31032643-31032665 TACTTGGGAGGCTGCTTGGGAGG - Intronic
1118835098 14:69472202-69472224 TCCCTGGGTTGCTGCTTGAAGGG - Intergenic
1119854038 14:77886138-77886160 CCCTGGGGTCTCTGCTGGAGTGG + Intronic
1120758363 14:88265039-88265061 CCCTTGGGAGGCTGCTGGGCTGG - Intronic
1121718891 14:96095718-96095740 CCCTTCGGTGCCTGCTGGAATGG + Intergenic
1125987269 15:44066264-44066286 GCTCTGGGTGGCTGCTGGAGAGG + Intronic
1126840740 15:52715252-52715274 GCCTGGGGTGGCTGTTTGAAGGG - Intergenic
1128079095 15:64845556-64845578 CCCCTGGGTGGCTGTTTCTGTGG + Intronic
1131076643 15:89499387-89499409 CCCTTGGGGGACTCCTTGATGGG + Intergenic
1136549766 16:30976703-30976725 CAGGTGTGTGGCTGCTTGAGGGG + Intronic
1139642614 16:68303459-68303481 CTCCTGGCTGGCTGCTTGGGAGG + Intronic
1140034747 16:71363672-71363694 GCCCTGGGCGGCTGCATGAGAGG + Intronic
1140404074 16:74696098-74696120 CCCTTGGTTGGCTGGATGCGTGG + Intronic
1141614890 16:85204818-85204840 CCCTTGGCTGGCTGGGTGTGGGG - Intergenic
1141630875 16:85287335-85287357 CCCTGGGGTGGCTGGTGCAGGGG - Intergenic
1142115619 16:88354712-88354734 CGCTTGGGAGACTGCTTGGGCGG - Intergenic
1143877647 17:10004228-10004250 CACTTGGATGGCTTCTTGCGGGG - Intronic
1144358552 17:14469437-14469459 CCCTGGGCTGCCTGCTTGACAGG + Intergenic
1144737129 17:17561476-17561498 CCCTGGGGTGGCTGCCCGAGGGG + Intronic
1145774684 17:27519621-27519643 GCCTTGGGTGCTTGCTTGTGGGG + Intronic
1145874563 17:28307155-28307177 CCTTTGGGTGGCAGCGGGAGTGG + Intergenic
1145991044 17:29079638-29079660 CCCTAAGGTGGCGGCCTGAGGGG + Intronic
1146108822 17:30068600-30068622 CCCTTGTGGGGCTGCCTGTGCGG + Intronic
1147170583 17:38616576-38616598 CCCTTGCATGGCAGCTTAAGTGG - Intergenic
1147561427 17:41511688-41511710 CCCTTTGCTGGCTGTTTGGGAGG + Intergenic
1149360242 17:55887705-55887727 CCTGTGGGTGGCCTCTTGAGAGG + Intergenic
1151207109 17:72515810-72515832 CCCTGGGGTGGGTGGTTTAGGGG + Intergenic
1151871804 17:76841681-76841703 CCCTTGCGTGGCTGCATCAGAGG - Intergenic
1151887796 17:76933346-76933368 CCCTGGAGTGGCTGCTGGAGAGG - Intronic
1152887381 17:82860380-82860402 CCCTGTGGTGGCTGCTCGGGTGG + Intronic
1153514558 18:5891709-5891731 CCCTAGGGTGGCTCCTGGACCGG + Exonic
1153651151 18:7241370-7241392 CCCTTTGGTGGCTTCTTGGCTGG + Intergenic
1154441267 18:14392328-14392350 CCCTTGGGTGCGCACTTGAGCGG + Intergenic
1155070731 18:22313711-22313733 CCCATGGGTGCCAACTTGAGAGG - Intergenic
1158373934 18:56841432-56841454 TACTTGGGAGGCTGCTTGGGAGG + Intronic
1159889460 18:73940279-73940301 CCCTTGGGTGTCTGAGTGTGGGG - Intergenic
1160307297 18:77751772-77751794 CCCTGGGGTGGCTGCTGCAAAGG - Intergenic
1160970419 19:1765432-1765454 CCTTTGGGTGGGTACTGGAGGGG - Intronic
1161522194 19:4730873-4730895 CCCTCTGGTGGCTGCTGGTGGGG - Intergenic
1162520856 19:11178575-11178597 CTCTTGGGAGGCTGCTTGCCTGG + Exonic
1163452132 19:17384534-17384556 CCCTTGGGAGTCTACTTGGGAGG + Intergenic
1164139748 19:22448490-22448512 CCTTTGGGTGTCTGTTTCAGGGG + Intronic
1164736197 19:30543323-30543345 ACCTTGGGAGGCAGCCTGAGTGG + Intronic
1166257447 19:41616683-41616705 CCCTTGAGGAGATGCTTGAGAGG - Intronic
1167409522 19:49336825-49336847 CACTTGGGTGGCTGCCTAGGTGG + Intronic
1167485131 19:49758311-49758333 CCTTGGGGTGCCTGCTGGAGAGG - Intronic
927574578 2:24190650-24190672 CCCTTGGGTGCCTGTCTGACAGG - Exonic
929053730 2:37858568-37858590 GCCTTGGGAGGCTGGTGGAGGGG - Intergenic
929861636 2:45683324-45683346 CACTTGGCTGACTGCTTGAGGGG - Intronic
931645790 2:64420512-64420534 CCCTTGGGAGGCTCTTTCAGAGG - Intergenic
933129604 2:78655794-78655816 CCCTTGGATGGCTTTTTGTGGGG - Intergenic
933903072 2:86862704-86862726 CCCTTGGAGGGCTGCGGGAGAGG + Intergenic
935777474 2:106486566-106486588 CCCTTGGAGGGCTGCGGGAGAGG - Intergenic
937986768 2:127641518-127641540 GCCTTGGGTGGCGGCTTGGGTGG - Intronic
938537401 2:132257373-132257395 CGGTTGGGAGGCTGCGTGAGCGG - Intronic
938581642 2:132651875-132651897 CCCTTGGGTGGTAGTTTGACGGG + Intronic
945102434 2:206274693-206274715 GCCTTGGATGCCTGCGTGAGTGG + Exonic
948304393 2:236935867-236935889 TCCTTGGGTGAGTGTTTGAGAGG + Intergenic
948358487 2:237399739-237399761 GCCTTTGGTTGCTGCTTCAGAGG - Intronic
948473174 2:238199155-238199177 CCCATGTGTGGCTGTTGGAGAGG - Intronic
1170747211 20:19110954-19110976 TGCTTTGCTGGCTGCTTGAGTGG + Intergenic
1173423736 20:42925698-42925720 CCCTTGGGTTTCTGATTCAGTGG + Intronic
1173954663 20:47021731-47021753 CTCCTGAGTGGCTGCTGGAGGGG - Intronic
1174507508 20:51026036-51026058 CCCTGGAGTGGCTGATTCAGTGG + Intergenic
1175247190 20:57589324-57589346 CCTTTGGGCGCCTGCTTCAGGGG - Intergenic
1175486268 20:59348824-59348846 CCCTTGGGCAGCTCCTGGAGAGG + Intergenic
1175915390 20:62423573-62423595 CCCTTGGGCGGCTCCTTTATGGG - Intronic
1176257888 20:64162098-64162120 CCCCTGGGAGGCGGCCTGAGCGG - Intronic
1177674986 21:24285211-24285233 CCCTTGGTTGATTGCTTCAGAGG + Intergenic
1180313011 22:11254013-11254035 CATTTGGGAGGCTGCGTGAGCGG - Intergenic
1180616500 22:17131730-17131752 CCCTTGGGTGGCAGCTTCTGTGG - Exonic
1181172263 22:21016295-21016317 CCCTGGCCTGGCTTCTTGAGTGG - Intronic
1182067172 22:27438853-27438875 CCCTGAGGTGTCTGCTTGGGAGG + Intergenic
1182420444 22:30246124-30246146 CCCCGGGGTGGCTGCGGGAGGGG + Intronic
1182624264 22:31634475-31634497 CCCTTGGGGAGCTGCTGGTGGGG - Intronic
1183430640 22:37763476-37763498 CCCAGGTGTGGCTGCTGGAGAGG + Intronic
1183585842 22:38752492-38752514 CCCTTGGGTCCCTACCTGAGAGG + Exonic
1184503514 22:44887994-44888016 CCCTTGGGCGCCGTCTTGAGGGG + Exonic
1185018487 22:48359400-48359422 CCCTGGGGTGCCAGGTTGAGTGG - Intergenic
1185070290 22:48652327-48652349 CCCCAGGGTGGCAGCTGGAGAGG + Intronic
1185176997 22:49333567-49333589 CCCTTAGGAGGCTGCTAGGGAGG - Intergenic
1185270444 22:49927117-49927139 CCCTTGGATGGCTGCGTCCGGGG + Intronic
950117651 3:10461866-10461888 CCCTTGGGTGGCTTCTGGTGAGG + Intronic
950425145 3:12921137-12921159 CCCTGGGGTGGCAGCGGGAGTGG - Intronic
950557732 3:13705457-13705479 CCATTGGGTGGGCACTTGAGAGG + Intergenic
951455957 3:22892429-22892451 CCCTGGGGTGTCTGATTCAGTGG + Intergenic
953412446 3:42697947-42697969 CCCTGGGGTCCCTGCTGGAGGGG + Intronic
955739334 3:62073598-62073620 CACTTGGGAGGCTACTTGGGAGG - Intronic
959459740 3:106610613-106610635 TCCCTGGGTGGGTGCTGGAGAGG - Intergenic
961536269 3:127572920-127572942 CCCTGGGCTGGCTGCTGGGGAGG - Intergenic
961791674 3:129380897-129380919 CCCTGGGGTGGGGGCTTGAGGGG + Intergenic
961805697 3:129487848-129487870 CCCTGGGGTGGGGGCTTGAGGGG + Intronic
962314231 3:134349038-134349060 CCCATGTGTGCCTGCCTGAGGGG + Intergenic
962751990 3:138440309-138440331 CCCTTGGCTGTCTGCCTGAGTGG - Intronic
962811398 3:138961877-138961899 GCCTAGGGTGCCTCCTTGAGGGG + Intergenic
967252208 3:187551908-187551930 CCCTTGGGTTGATGCTGGAATGG + Intergenic
968678007 4:1895895-1895917 CCCTGGGCTGGCTGGTAGAGGGG + Intronic
969577527 4:8045316-8045338 CGCTGGCGTGGCTGCTGGAGTGG - Intronic
972539091 4:40023460-40023482 CCCTTGGGAGGCTACTTGGGAGG + Intergenic
976233130 4:82866839-82866861 CACTTGGGCGGCTTCTTCAGAGG + Exonic
979799553 4:124891845-124891867 CCAATGGGTGGCTGATTTAGAGG - Intergenic
980397691 4:132236132-132236154 CCCTTGGGTGGATACTTGGTAGG - Intergenic
980841171 4:138263277-138263299 CATTTGAGTGGCTGCTTTAGAGG - Intergenic
981702793 4:147625751-147625773 CCCTTGGGCGGTTGCATTAGTGG - Intronic
982148379 4:152424243-152424265 GTCGTGGGTGGCTGCTTGTGGGG - Intronic
985479052 5:95820-95842 CCCTCTGGTGTCTGCTGGAGGGG + Intergenic
985681273 5:1257124-1257146 CCCTTGGGTAGTCGCTTGATTGG - Intronic
986711330 5:10489970-10489992 TCCTTTGGTGGCTCCTTCAGGGG + Intergenic
988456140 5:31388805-31388827 GCCTTGGGCTGCTGCTTCAGAGG - Intergenic
991457355 5:66818703-66818725 CCCTTGGATTGCTGCTGCAGTGG + Intronic
993044749 5:82854431-82854453 CCCCAGGGTTGCTGCTTTAGAGG + Intergenic
995777103 5:115735357-115735379 ACCATGAGTGGCTGCTTGAAGGG - Intergenic
997234571 5:132265406-132265428 CACTTGGGAGCCTGGTTGAGGGG + Intronic
999303773 5:150507102-150507124 GCCTTAGGTGACTTCTTGAGAGG + Intronic
1000261781 5:159595323-159595345 CTGTTGGGTAGCTGCCTGAGGGG + Intergenic
1011431711 6:87294340-87294362 CCCTTGTGTGGTTCATTGAGGGG - Intronic
1018747602 6:166774568-166774590 ACCCTGGCTGGCTGCTTGGGAGG - Intronic
1018923114 6:168189434-168189456 CCCTTGGCTTGCTGCTTGCCAGG + Intergenic
1019564590 7:1673159-1673181 GCCTTGGGTGGGTGTTTGTGGGG + Intergenic
1020433069 7:8132994-8133016 CCCTAGTGCGGCAGCTTGAGAGG + Intronic
1022024206 7:26430644-26430666 GCCCTGGGTGGCTGCATGGGAGG + Intergenic
1023697109 7:42858883-42858905 CCCTGGAGTGGGTGCTTGGGAGG - Intergenic
1024465962 7:49711608-49711630 CCCTTGGGTGGGTGGTCGATGGG - Intergenic
1026685429 7:72505423-72505445 CCCCAGAGTGGCTGATTGAGGGG - Intergenic
1035796544 8:2362573-2362595 CCCCTGGGGAGCTGCTTGTGGGG - Intergenic
1040640098 8:49323303-49323325 CCCTGGGCTGGCTGCTGCAGAGG - Intergenic
1042435013 8:68753935-68753957 CCTTTCAGTGGCTGCTGGAGAGG + Intronic
1043866707 8:85383112-85383134 CTCTTGGGTAGCTCCTTGTGGGG - Intronic
1044265452 8:90176301-90176323 CCCAATGGTGACTGCTTGAGGGG + Intergenic
1045775930 8:105802397-105802419 CCCTTCTGTGGGTTCTTGAGTGG - Exonic
1047003144 8:120593244-120593266 CCTTTCGGTGCCTGCTTCAGTGG - Intronic
1047186461 8:122637547-122637569 CCCTTGGGTGGCTGACAGTGTGG - Intergenic
1047417470 8:124676837-124676859 CCCGTGGCTGGCTGATTGATGGG - Intronic
1047922746 8:129652164-129652186 CCCTGGGCTGGCTGCTTTCGGGG - Intergenic
1048216973 8:132505236-132505258 CCCTTGTATGGATGCTTCAGAGG - Intergenic
1049308943 8:141923267-141923289 CCCTTGGGCGCCTGCTGGAAGGG - Intergenic
1049737557 8:144217889-144217911 CCCTCGGGTGGCTGCGTTAGAGG + Intronic
1049737576 8:144217953-144217975 CCTCTGGGTGGCTGCGTTAGCGG + Intronic
1049737585 8:144217985-144218007 CCTCTGGGTGGCTGCGTTAGTGG + Intronic
1049737594 8:144218017-144218039 CCTCTGGGTGGCTGCGTTAGTGG + Intronic
1052271953 9:26636409-26636431 CCCTTGGGTGTCTGGTTATGTGG + Intergenic
1052300127 9:26944654-26944676 CCCATGGGTGGCTGTAAGAGTGG - Intronic
1053663917 9:40304208-40304230 ATCTTGGGTCGCTGCTTCAGAGG + Intronic
1056756952 9:89387668-89387690 CCCTGCGTTGGCTGCTTGTGTGG - Intronic
1060661891 9:125409346-125409368 CCCTGGGGTGGCTGGTTTGGGGG - Intergenic
1060994959 9:127870713-127870735 CCTCTGAGTGGCTGCATGAGTGG - Intronic
1061195793 9:129106492-129106514 CCCTTCGGTGGCCCCGTGAGTGG + Intronic
1061277227 9:129576571-129576593 GCCTCGGGTGGCTGCTGGAAAGG - Intergenic
1062526375 9:136979564-136979586 GCCTTGGGGGGCTGCTTATGTGG - Intronic
1186542986 X:10420001-10420023 TCCTTGTGTGGCTGCTTGGAAGG - Intergenic
1189804412 X:44720775-44720797 CCCTTGGGTGTCTGCTCTGGAGG + Intergenic
1190401210 X:50036943-50036965 ACCTTGAGTGCCTGCTTGCGAGG + Intronic
1193397592 X:81003872-81003894 CCTTTGGGCGGCTGCAGGAGTGG - Intergenic
1194660043 X:96620872-96620894 TCCTTGGGTGGCTGTGTGATTGG - Intergenic
1195302630 X:103545834-103545856 CCCTTGAGAGACTACTTGAGAGG + Intergenic
1201063070 Y:10065660-10065682 CTCTGGGGTGGCTGCTTGCCAGG - Intergenic
1201564082 Y:15347799-15347821 CCCTTGGGTGCCTGCGTGTAAGG - Intergenic