ID: 919956658

View in Genome Browser
Species Human (GRCh38)
Location 1:202424028-202424050
Sequence GAGATAAAACTGATTGAGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 233
Summary {0: 1, 1: 1, 2: 2, 3: 18, 4: 211}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
919956658 Original CRISPR GAGATAAAACTGATTGAGGC TGG (reversed) Intronic
903594038 1:24480350-24480372 GAGACTAAAATGACTGAGGCCGG + Intergenic
904278107 1:29397273-29397295 GAGATGAAACTGAGAGGGGCAGG + Intergenic
904432075 1:30470756-30470778 GAGATAAACCTGCTTCAGGCGGG + Intergenic
904885939 1:33738463-33738485 CAGATAAAGCTTCTTGAGGCAGG - Intronic
906116676 1:43361566-43361588 GAGGTAAAACTGATAGATCCTGG - Intronic
907266617 1:53265574-53265596 GAGATGTAACTGAAAGAGGCAGG - Intronic
907735305 1:57106258-57106280 GAGATAATACTGATGGGGGGGGG - Intronic
909940086 1:81601559-81601581 GAAATAAAATTGCTTGAGTCAGG - Intronic
910580413 1:88818349-88818371 TAGAAAAAACTGCTTTAGGCTGG + Intronic
910723602 1:90314597-90314619 GAGACAAAACTGAGGAAGGCTGG - Intergenic
911215240 1:95185930-95185952 GAGACAAAAGTGAATGAGGAAGG + Intronic
911864662 1:103002566-103002588 GAGGGAAAACTGTTTGAGGGTGG - Intronic
912374103 1:109196410-109196432 GAAATAAGACTGATTAAAGCAGG + Intronic
913023455 1:114810305-114810327 GTGAGAAAACTGCATGAGGCTGG + Intergenic
916353726 1:163881127-163881149 GAGATAAAAATGACCTAGGCTGG + Intergenic
917322172 1:173794426-173794448 GAGCTAAAACTTCTTGAGGAAGG - Intergenic
918765979 1:188483892-188483914 GAGACAAAACTGATATTGGCAGG - Intergenic
919956658 1:202424028-202424050 GAGATAAAACTGATTGAGGCTGG - Intronic
921014503 1:211176118-211176140 GAGATAAAACTTACTGATGCAGG + Intergenic
923488962 1:234466214-234466236 TAGAAAAAACTGACTTAGGCTGG + Intronic
923584059 1:235249497-235249519 GAATTTAAACTGACTGAGGCTGG + Intronic
1063310746 10:4949574-4949596 GAGCTAAAACTGGTTGGGGGGGG + Intronic
1064054033 10:12082330-12082352 GAAAGAAAACAGAATGAGGCGGG - Intronic
1065223174 10:23516771-23516793 GAGAGAAAATTGAATGAAGCTGG - Intergenic
1066414987 10:35213563-35213585 GAGATAAAAGAAATTTAGGCCGG - Intergenic
1068487995 10:57683958-57683980 GAGAGCAAACTTATTGATGCAGG - Intergenic
1068691249 10:59917176-59917198 AAGAAATTACTGATTGAGGCCGG - Intergenic
1069259045 10:66371015-66371037 AAGATCATACTGTTTGAGGCTGG - Intronic
1071613634 10:87054954-87054976 CAGATAAAACTGATGCAGCCTGG - Intronic
1071771347 10:88732206-88732228 ATGATAAAATTGATTGTGGCTGG - Exonic
1072234691 10:93443340-93443362 GTGAGGAAACTGCTTGAGGCAGG - Intronic
1073407933 10:103314651-103314673 GTGATAAAAATCATTAAGGCCGG + Intronic
1073549344 10:104382938-104382960 GAGATGAAGCTGTTTGGGGCTGG + Intronic
1075448378 10:122529746-122529768 TAGATGAAACTGATGGAAGCAGG - Intergenic
1076458805 10:130624010-130624032 GAGAGAAAGCTGGTTCAGGCTGG - Intergenic
1076523694 10:131096901-131096923 AAGAAAAAACTGATTCTGGCTGG + Intronic
1077664950 11:4099477-4099499 GAGTTAAAAGTGGTTGAGGCAGG + Intronic
1080158317 11:29139762-29139784 TATACAAAACTGATGGAGGCAGG - Intergenic
1082950078 11:58805326-58805348 GAGGTAAAACTGCATGAGGAGGG - Intergenic
1083601523 11:63951639-63951661 CTGATCAAACAGATTGAGGCAGG - Intronic
1085874503 11:80389573-80389595 GATACAAAACTGAATGAGGCAGG - Intergenic
1087180134 11:95133890-95133912 GAGATAAAACTGAATAGTGCTGG - Intergenic
1087768338 11:102180385-102180407 GAAATAATACTGAATGAGCCAGG + Intronic
1088181648 11:107120127-107120149 GAGAGGAAACAGATTGAGGAAGG + Intergenic
1089799408 11:121013019-121013041 GCCTTAAAACTGAATGAGGCTGG + Intergenic
1090819996 11:130333280-130333302 TAGATAAAACTGAATGAGGCTGG - Intergenic
1095354967 12:41261783-41261805 GAAATAGAACTATTTGAGGCCGG - Intronic
1097818768 12:64105485-64105507 AAGATTAAACTTCTTGAGGCCGG + Intronic
1097914787 12:65009339-65009361 GAGATAATATTGAATGAGGATGG - Intergenic
1098758541 12:74394506-74394528 GACAAAAATCTGTTTGAGGCAGG - Intergenic
1099160663 12:79237670-79237692 GAAATAAAAATGATTAAAGCAGG + Intronic
1099389166 12:82057714-82057736 GAGTTAAAAATGATGGAGGAGGG + Intergenic
1099642210 12:85304957-85304979 TACATAAAACAGATGGAGGCTGG - Intergenic
1102782825 12:115580183-115580205 GGGGTAAAACTGCGTGAGGCTGG - Intergenic
1103493354 12:121340854-121340876 TAGACAAAAGTGATGGAGGCTGG - Intronic
1104697546 12:130874914-130874936 GAGACAAAACTGCTTGAACCCGG - Intronic
1106870693 13:34016061-34016083 TTGTTAAAACTGATTGAGACAGG - Intergenic
1107274046 13:38656864-38656886 GAGATAAGACTGCCAGAGGCTGG - Intergenic
1108938011 13:55910418-55910440 GAGATAAAACTAGTTGAATCCGG + Intergenic
1109136193 13:58654490-58654512 GAGATAAAAGTGATTGGGAAAGG - Intergenic
1109190446 13:59316466-59316488 GAGATAAGATTGATGAAGGCAGG + Intergenic
1109259829 13:60131131-60131153 GCAATAAAAGTGAATGAGGCTGG + Intronic
1109882978 13:68506564-68506586 GAAGTAAAACTGATAGAGACAGG + Intergenic
1110505711 13:76283888-76283910 AAGGTATAACAGATTGAGGCAGG - Intergenic
1111090962 13:83446419-83446441 AAGATAAAACTTCATGAGGCAGG + Intergenic
1112714546 13:102168739-102168761 GACATAAAACTGATTTGGGCAGG + Intronic
1112740234 13:102464778-102464800 AAGATAAAACTTATGGGGGCAGG + Intergenic
1112985248 13:105441165-105441187 GATATAAAAGTGATCGAGGACGG + Intergenic
1113136473 13:107095817-107095839 GAGTTAACACTGAGTGAGACAGG + Intergenic
1114810072 14:25888453-25888475 GTAATAAAACTAATTCAGGCAGG - Intergenic
1115218159 14:31032828-31032850 GATATAAAACTGTACGAGGCTGG - Intronic
1116397264 14:44461795-44461817 TAGATAAGACATATTGAGGCAGG + Intergenic
1116492794 14:45526426-45526448 GAGATAACACTGAATGTGGATGG + Intergenic
1120664979 14:87295057-87295079 GAGAGCAAACTGATTGAGGAAGG + Intergenic
1123008484 14:105335785-105335807 CAGAGAAAGCTGAGTGAGGCTGG + Intronic
1124578979 15:30935212-30935234 GTGAGAGAACTGCTTGAGGCTGG + Intronic
1124941882 15:34225759-34225781 GAAACTAAACTGCTTGAGGCTGG + Intronic
1126631247 15:50738250-50738272 GAACAAAAACTGAATGAGGCTGG + Intronic
1131591800 15:93757476-93757498 GAGATAAACATCAGTGAGGCTGG + Intergenic
1135191133 16:20355694-20355716 GAGAGAAAAGTGTTTCAGGCTGG - Intronic
1136617057 16:31404616-31404638 GGGAAAAAAATGAATGAGGCAGG + Intronic
1138086067 16:54134896-54134918 GAGATAACTCTGATAGAGCCAGG + Intergenic
1140226179 16:73079195-73079217 GATATGAAAGTGATGGAGGCAGG - Intergenic
1140404321 16:74698109-74698131 GAGGGAGAATTGATTGAGGCTGG + Intronic
1140587843 16:76315313-76315335 AAGACAAAACTCCTTGAGGCTGG + Intronic
1141486927 16:84346625-84346647 AAGAATAAACTGATTGAGGCCGG - Intergenic
1147502836 17:40982176-40982198 GGAATAAAACTACTTGAGGCAGG - Intronic
1147840840 17:43370343-43370365 AAGATTAAAATAATTGAGGCTGG + Intergenic
1147850326 17:43437381-43437403 GAAATAAAACTGAAAGAGGCTGG - Intergenic
1148757702 17:49982672-49982694 GAGATAAAACTGTCTCCGGCTGG + Intergenic
1148771351 17:50068796-50068818 TAAAAAAGACTGATTGAGGCTGG - Intronic
1157853154 18:51077193-51077215 GAGAGAAAACTAAGTGAGGGTGG + Intronic
1159915992 18:74188275-74188297 GAAAGAAAACTGAATGGGGCCGG - Intergenic
1160966119 19:1747666-1747688 GAGATAAAACTGAATGAAGCTGG - Intergenic
1163655860 19:18544309-18544331 GAAATAAAACTGAGTGAAGGAGG - Intergenic
1163787757 19:19285161-19285183 AAAATAAACCTGTTTGAGGCTGG - Intronic
1163905206 19:20146463-20146485 GATAAAAAACTGATTCAGGTGGG + Intergenic
1164134978 19:22406291-22406313 GAGATAATACTCAAGGAGGCTGG - Intronic
1165024557 19:32950153-32950175 GAGATAAAAAAGCTTGAGGTCGG - Intronic
1166040096 19:40197095-40197117 GAGGGTAAACTGATGGAGGCTGG + Intronic
1167197494 19:48040625-48040647 GAGATGGAACTGATTGAGCTCGG - Exonic
926954419 2:18278957-18278979 AAAACAAAACTGATTGAGTCTGG - Intronic
927560143 2:24064985-24065007 GAAAGAAAAATGTTTGAGGCTGG - Intergenic
929453754 2:42052450-42052472 TAGAAAAAACAGATTGTGGCCGG + Intronic
931562844 2:63581708-63581730 AAGATAAAAATCATTCAGGCTGG + Intronic
934753904 2:96811929-96811951 GAGATAAAAGTGGCTGTGGCTGG + Intergenic
934914669 2:98291434-98291456 GAAATAAAATTGATTCTGGCTGG + Intronic
935933253 2:108152948-108152970 GAGATCAGACTGACAGAGGCTGG - Intergenic
936097228 2:109539737-109539759 GGGACAAAACTGGTTGCGGCCGG - Intergenic
940309994 2:152268489-152268511 GTGAGAAAACTGCTTGAGCCTGG - Intergenic
941983630 2:171487936-171487958 GAGATAAGACTGGGAGAGGCTGG - Intergenic
942645514 2:178106661-178106683 CAGAAAAATCAGATTGAGGCTGG + Intronic
943287110 2:186016215-186016237 GAGATAAAAGTGGGTGAGGGTGG - Intergenic
943293208 2:186102363-186102385 TAAATAAAAATGATTTAGGCAGG - Intergenic
943648060 2:190428967-190428989 GAAATAAAAAAGATTGAGGCTGG - Intronic
944155558 2:196603859-196603881 GAGAGAAAACTGAGAGTGGCCGG + Intergenic
945177544 2:207058431-207058453 GAGAGAAAACAGATTGGGGTAGG - Intergenic
946100941 2:217322019-217322041 AAGATAGAAATGATTGGGGCTGG - Intronic
946285108 2:218697013-218697035 GAGATAAAAGTGAAAGAGGGCGG - Intronic
946645896 2:221833456-221833478 GAGATAAAACTGATCGACTATGG + Intergenic
947016231 2:225622879-225622901 GAAATAAAACTGGTTGTGGCTGG - Intronic
947435762 2:230070613-230070635 GATTTAAAAATTATTGAGGCTGG + Intergenic
1169449364 20:5698239-5698261 GAGGGAAAACTGCTTGAGCCAGG - Intergenic
1170436075 20:16330704-16330726 CAGATGCAACTTATTGAGGCAGG - Intronic
1170842392 20:19934516-19934538 GAGAAAGGACTGAGTGAGGCTGG - Intronic
1172552539 20:35812865-35812887 GAGTAATAACTGATTCAGGCAGG - Intronic
1172741863 20:37175218-37175240 GAAAAAAAACTTATGGAGGCTGG + Intronic
1173099747 20:40074720-40074742 GAGATAAAACAGATTAAGGAGGG - Intergenic
1177095841 21:16831382-16831404 GAGATATAACTGATTCAGGGAGG - Intergenic
1178140335 21:29675756-29675778 GAGCTAAGACTGCTGGAGGCTGG + Intronic
1181870724 22:25896940-25896962 GAAAAAAAACTGAGTGTGGCTGG - Intronic
1182011485 22:27004465-27004487 GATATAAAACAGAGTTAGGCTGG + Intergenic
1183160484 22:36110025-36110047 CAGAAAACACTGACTGAGGCCGG - Intergenic
1184004499 22:41698338-41698360 AAGCTAATCCTGATTGAGGCAGG + Intergenic
1184694945 22:46133896-46133918 GAGCTAAAACTGGTGGAGCCGGG - Intergenic
954824718 3:53362511-53362533 TAAATAAAACTGATTCAGTCAGG - Intergenic
955158343 3:56440245-56440267 CACATAAAACTGAATGCGGCCGG + Intronic
957226714 3:77458384-77458406 GAGACAGAAAAGATTGAGGCTGG + Intronic
957424836 3:80024144-80024166 GAGATCAAACTCATTTAGGATGG + Intergenic
959063943 3:101638823-101638845 GAGATAAAACTGCACCAGGCAGG + Intergenic
959158239 3:102693025-102693047 GTGATGAGACTGATAGAGGCAGG - Intergenic
959188796 3:103083119-103083141 AAGAAAAAAATGATTTAGGCAGG - Intergenic
960453021 3:117833548-117833570 GAGAAAATATTGATTGAGGATGG - Intergenic
960508792 3:118524201-118524223 GAGAAAAAGATGAGTGAGGCCGG - Intergenic
960864821 3:122188753-122188775 GAGAAAAAAGTGAATCAGGCTGG - Intronic
962952204 3:140229598-140229620 GAGCTAAAACCCATTCAGGCAGG + Intronic
964035310 3:152188525-152188547 GAGATTAAACTTAGTGAGGAAGG + Intergenic
964155427 3:153579550-153579572 GGGATTAAAATGAGTGAGGCAGG + Intergenic
964598046 3:158459300-158459322 TAGATAAATCAGATTTAGGCAGG + Intronic
965922868 3:173940383-173940405 AAGATATAACTATTTGAGGCCGG - Intronic
966664060 3:182450770-182450792 GAGATAAAACACAGTGAGGAGGG - Intergenic
966778242 3:183561671-183561693 GAGGTAGGATTGATTGAGGCCGG + Intergenic
967923089 3:194627260-194627282 GAGACAACACTGCTTGAAGCAGG + Intronic
968803755 4:2759302-2759324 GAGATAGGATTGCTTGAGGCAGG + Intergenic
973725403 4:53770870-53770892 TAGCTAATATTGATTGAGGCAGG - Intronic
974744929 4:66059843-66059865 GAGAAGAAACTGAGTGAAGCAGG + Intergenic
974888459 4:67850476-67850498 GAGATAAAACTGCTGGGGGTGGG + Intronic
979515452 4:121604002-121604024 GAGATAATATTGATTGAAGTAGG - Intergenic
979917405 4:126453612-126453634 GAGATAAAACTGGGTATGGCAGG - Intergenic
981655274 4:147105420-147105442 GAGAGAAAAATGAGAGAGGCTGG - Intergenic
982036464 4:151350657-151350679 GTGGGAGAACTGATTGAGGCAGG + Intergenic
982930959 4:161407371-161407393 GAGAGAAAACTGAATGAGGATGG + Intronic
985141541 4:186845247-186845269 GAGATAAAAATGAGTCATGCTGG + Intergenic
986345788 5:6833939-6833961 GAGATGGAGCTGTTTGAGGCCGG - Intergenic
990372974 5:55139714-55139736 CTGATGAAACTGAATGAGGCAGG + Intronic
990544742 5:56812018-56812040 GAGAGAAAAGTGATTGAAACTGG - Intergenic
990766759 5:59192704-59192726 GAGATAAAACTGATTTAACCTGG - Intronic
991368670 5:65895542-65895564 GAGTTAAAAGTAAATGAGGCCGG + Intergenic
992465874 5:77003772-77003794 GAGAAAGAACTGACTCAGGCAGG - Intergenic
993784363 5:92110298-92110320 GAGATGAAACTGATAGAAGTTGG + Intergenic
994330409 5:98498476-98498498 GAGATGAAACATATTGAGGAAGG + Intergenic
994472870 5:100231728-100231750 GAAAAAAAACGAATTGAGGCTGG + Intergenic
994572579 5:101533189-101533211 TTGAAAAAACTGATTCAGGCTGG + Intergenic
995777093 5:115735251-115735273 GTGATGAAATTGAGTGAGGCAGG - Intergenic
998984127 5:147736362-147736384 GAGGTAAAACTGCTTGAACCTGG + Intronic
999666208 5:153916440-153916462 GAGCCGAAACTGATTGAGGGTGG - Intergenic
999860879 5:155644422-155644444 TAGATAATATCGATTGAGGCTGG - Intergenic
1000712862 5:164602118-164602140 GATAAAAAACTGATAGAGGCTGG + Intergenic
1001413923 5:171529681-171529703 GAGATAAAGCTGTTGAAGGCAGG - Intergenic
1002208655 5:177582209-177582231 AAAATAAAACTGATCGGGGCAGG + Intergenic
1002616074 5:180457222-180457244 AAAAGAAAGCTGATTGAGGCTGG + Intergenic
1003394950 6:5745107-5745129 GAAATAAAACTGACTGAGTTAGG + Intronic
1004547532 6:16612967-16612989 GAGATAAAAATTATTTTGGCCGG + Intronic
1005124964 6:22436198-22436220 GAGCTAAAACTGATAAAGGATGG + Intergenic
1005525249 6:26641276-26641298 GAGAAAGAACTGAATGAGGTGGG + Intronic
1006237169 6:32643741-32643763 GAGATAAAAATTCTTTAGGCAGG + Intronic
1007976577 6:46107737-46107759 TAGATAAAACTTAATGGGGCTGG + Intergenic
1008516817 6:52326303-52326325 GAGCTGAAAGAGATTGAGGCAGG - Intergenic
1009735327 6:67669758-67669780 GAGAGGAAAATGATAGAGGCAGG - Intergenic
1010529829 6:76954061-76954083 TATAAAAAATTGATTGAGGCCGG - Intergenic
1011029434 6:82905625-82905647 GAGAGAAAAATGTTTGGGGCAGG + Intronic
1012009553 6:93765272-93765294 GAAATCAAACTGGTTGAGGGGGG + Intergenic
1012159829 6:95870483-95870505 GAAAAAAATCTGATTAAGGCTGG + Intergenic
1013326539 6:109050495-109050517 TATATAAAACTGATTGAAGGAGG + Intronic
1013712092 6:112913592-112913614 GTGACAAAACTGAATGAGGTAGG + Intergenic
1016777733 6:147923597-147923619 GTGAGAAAACTGGTTGAGGGAGG + Intergenic
1021285639 7:18777923-18777945 GATTTAAAAGAGATTGAGGCAGG - Intronic
1023300431 7:38764643-38764665 GAGATTAAACAGAATGAGGAGGG + Intronic
1024076778 7:45825033-45825055 TAGAAAAATCTGATTAAGGCTGG - Intergenic
1024936968 7:54720330-54720352 GAGATAAAACAGACTCAGTCTGG + Intergenic
1025127636 7:56356387-56356409 TAGAAAAATCTGATTAAGGCTGG + Intergenic
1027375884 7:77549020-77549042 GAGATAAAAGTGAATGAGACAGG - Intronic
1031282723 7:119824254-119824276 TAAATAAAACTGATGGAGCCCGG - Intergenic
1032439683 7:131932999-131933021 GAGATAAAATTGCATGAGGAGGG - Intergenic
1037067444 8:14599586-14599608 GGGAGAAAACTGAATAAGGCTGG + Intronic
1037318624 8:17623042-17623064 GGAATGAAACTGATAGAGGCAGG - Intronic
1038393439 8:27227632-27227654 GAGACAGAACTGATTGAACCCGG - Intergenic
1041145748 8:54874618-54874640 GAGAGAAAACAGACTGTGGCAGG - Intergenic
1042093897 8:65190802-65190824 GAAATAAAAATAATTGAGGGGGG + Intergenic
1042857496 8:73282836-73282858 GAGTCAAAGCTGAATGAGGCTGG + Intergenic
1044689479 8:94862236-94862258 GAGATAGAAATGATTCAGGTCGG - Intronic
1044695050 8:94914462-94914484 GAGATAAAACTGGCGGTGGCTGG - Intronic
1044805094 8:95998641-95998663 GACAGAAAACTAAATGAGGCAGG + Intergenic
1046377168 8:113398891-113398913 GTGATGAAACTGAGTGATGCTGG + Intronic
1046551229 8:115719716-115719738 GAGCTAGAACTGCTAGAGGCAGG - Intronic
1047053129 8:121135719-121135741 GAGAAAAAAATGATTAAGGCCGG + Intergenic
1048609594 8:136007767-136007789 GAGATGAAGCTGATGGAGCCAGG - Intergenic
1049462708 8:142737448-142737470 GACATAAAGTTGAGTGAGGCGGG + Intergenic
1051318138 9:15866100-15866122 GAGATAAAGCTCAATGAGGCAGG + Intronic
1056141168 9:83681515-83681537 GAGATAACACTTAATGAGTCTGG + Intronic
1057257305 9:93560063-93560085 GAGAGAGAATTGCTTGAGGCAGG + Intronic
1061628602 9:131857064-131857086 GAGATGAACCTGAGGGAGGCCGG - Intergenic
1203489268 Un_GL000224v1:87808-87830 GAGAGAGAACTGAGTGTGGCTGG - Intergenic
1203501889 Un_KI270741v1:29703-29725 GAGAGAGAACTGAGTGTGGCTGG - Intergenic
1187239322 X:17498360-17498382 GGGATAAATCAGATAGAGGCAGG - Intronic
1192113458 X:68388739-68388761 TAGATATAACAGATTGAAGCTGG + Intronic
1193111058 X:77731412-77731434 GATCTAATACTGATAGAGGCAGG + Intronic
1193381063 X:80816312-80816334 GGGATAACACTGATTTTGGCAGG - Intergenic
1193403394 X:81072604-81072626 GTGATAAGACTAATTGAGGAAGG - Intergenic
1198458444 X:136839943-136839965 AAGATAAAACAAATTGAGCCAGG - Intergenic
1199164469 X:144654476-144654498 GAGAAAAAACAGGTTGATGCAGG + Intergenic
1200377450 X:155798759-155798781 GCTATAAGACTGATTGAGGGAGG + Intergenic
1202577938 Y:26347149-26347171 GAGATAAAACTAATTGAGGCTGG + Intergenic