ID: 919957489

View in Genome Browser
Species Human (GRCh38)
Location 1:202433455-202433477
Sequence CTGTAGGCAAAGATAGAGTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 400
Summary {0: 1, 1: 0, 2: 2, 3: 30, 4: 367}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
919957489_919957495 15 Left 919957489 1:202433455-202433477 CCTCACTCTATCTTTGCCTACAG 0: 1
1: 0
2: 2
3: 30
4: 367
Right 919957495 1:202433493-202433515 AGCTCCATAGTCTGGCCTTCAGG 0: 1
1: 0
2: 1
3: 12
4: 122
919957489_919957491 7 Left 919957489 1:202433455-202433477 CCTCACTCTATCTTTGCCTACAG 0: 1
1: 0
2: 2
3: 30
4: 367
Right 919957491 1:202433485-202433507 AAACCCCAAGCTCCATAGTCTGG 0: 1
1: 0
2: 2
3: 14
4: 103

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
919957489 Original CRISPR CTGTAGGCAAAGATAGAGTG AGG (reversed) Intronic
902054717 1:13590748-13590770 CTGTAGGCAGAAATAGAGAATGG + Intronic
902807904 1:18872316-18872338 GTCTGGGCAAAGATACAGTGAGG + Exonic
904375033 1:30075496-30075518 CAGGAGGCCAAGAAAGAGTGAGG - Intergenic
904761971 1:32811835-32811857 CTGCAGGCAAAGATGCAGTTAGG - Intronic
906463642 1:46057184-46057206 CAGCAGGCAAAGAGAGAATGAGG - Intronic
906463927 1:46059120-46059142 CAGCAGGCAAAGAGAGAATGAGG - Intronic
907539465 1:55199949-55199971 CAGCAGGCAAAGAGAGAATGAGG + Intronic
908011737 1:59785577-59785599 CAGCAGGCAAAGAGAGAATGAGG + Intergenic
909703236 1:78551670-78551692 CAGCAGGCAAAGAGAGAATGAGG - Intergenic
910059148 1:83067974-83067996 CAGAAGGCAAAGAGAGGGTGTGG - Intergenic
912579287 1:110705636-110705658 CAGCAGGCAAAGAGAGAATGAGG + Intergenic
915247329 1:154565927-154565949 CTTAAGGAAAAGATAGAGGGTGG - Intergenic
915268139 1:154733200-154733222 CTGTGGGCAAACCTAGAGCGGGG + Intronic
916209147 1:162344672-162344694 CTGTAGCCCAAGCTGGAGTGCGG - Intronic
917134808 1:171779636-171779658 CTGTTGGCCAGGATGGAGTGCGG + Intergenic
917578199 1:176346088-176346110 CAGGAGGAAGAGATAGAGTGGGG + Intergenic
917690461 1:177463061-177463083 CAGTAGGCAAAGAGAGAATGAGG + Intergenic
917720395 1:177781446-177781468 ATGCAGTTAAAGATAGAGTGTGG + Intergenic
917759084 1:178135806-178135828 CAGTAGGCAAAGAGAGAATGAGG + Intronic
917921573 1:179755098-179755120 CTGTAGTCCAGGCTAGAGTGCGG - Intronic
918194683 1:182210206-182210228 CTGCAGGCTAAGCTAAAGTGAGG + Intergenic
919011623 1:191973120-191973142 CAGCAGGCAAAGAGAGAATGAGG + Intergenic
919291786 1:195642750-195642772 CAGCAGGCAAAGAGAGAGAGAGG + Intergenic
919748463 1:201022857-201022879 CTGCAGACAAAGATCGGGTGCGG - Intronic
919957489 1:202433455-202433477 CTGTAGGCAAAGATAGAGTGAGG - Intronic
919968809 1:202557377-202557399 AAGTAGGCAATGATAGTGTGGGG + Intronic
921263127 1:213401291-213401313 CTGAAGGCTGAGATAGAGAGGGG + Intergenic
921723348 1:218498012-218498034 CAGTAAGCAAAGACAGAATGAGG + Intergenic
924025231 1:239825357-239825379 TTGAAGGCAAAGAGAGAGGGAGG - Intronic
924367902 1:243315917-243315939 CAGTAGACAAAGAGAAAGTGAGG - Intronic
1063904943 10:10771663-10771685 CAGCAGGCAAAGACAGAATGAGG - Intergenic
1064587240 10:16851673-16851695 AGGGAGGGAAAGATAGAGTGAGG - Intronic
1064587321 10:16851993-16852015 AGGGAGGCAAAGATAGAGGGAGG - Intronic
1064587326 10:16852013-16852035 AGGGAGGGAAAGATAGAGTGAGG - Intronic
1064587364 10:16852144-16852166 AGGGAGGGAAAGATAGAGTGAGG - Intronic
1064587381 10:16852208-16852230 AGGGAGGGAAAGATAGAGTGAGG - Intronic
1064587401 10:16852284-16852306 AGGGAGGGAAAGATAGAGTGAGG - Intronic
1064587422 10:16852360-16852382 AGGGAGGCAAAGATAGAGGGAGG - Intronic
1064587427 10:16852380-16852402 AGGGAGGGAAAGATAGAGTGAGG - Intronic
1064587453 10:16852480-16852502 AGGGAGGCAAAGATAGAGTGAGG - Intronic
1064587459 10:16852520-16852542 AGGGAGGCAAAGATAGAGTGAGG - Intronic
1065286039 10:24188635-24188657 CTGTAGGGAAAGAAAGATGGAGG + Intronic
1068037775 10:51782742-51782764 CAGCAGGCAAAGACAGAATGGGG - Intronic
1068926970 10:62550678-62550700 CTGGAGGCAATGATAGAATTTGG - Intronic
1069213474 10:65790815-65790837 CTGCAGGCAAAGAGAGAGCTTGG - Intergenic
1069290226 10:66769802-66769824 CTGTAGGCAATGAGAGCTTGAGG - Intronic
1069551620 10:69368322-69368344 CTGGGGGCAAAGATAGGGTGGGG - Intronic
1070468516 10:76750856-76750878 CAGAAAGCAAAGAGAGAGTGGGG + Intergenic
1070909771 10:80107845-80107867 CTGAATGCAAAGATGGAATGAGG + Intergenic
1071015268 10:80989602-80989624 CTGCAGCCAAATATACAGTGAGG - Intergenic
1072074592 10:91956951-91956973 CTGTAGGCCAGGCTAGAGTGCGG - Intronic
1072552940 10:96493182-96493204 CTGTAGGCACAGAGAGATTTAGG + Intronic
1072702563 10:97653878-97653900 CTGTTGCCCAGGATAGAGTGTGG - Intronic
1073793760 10:106965428-106965450 CTGCCAGCAAAGAAAGAGTGGGG + Intronic
1074262590 10:111869311-111869333 CAGCAGGCAAAGAGAGAATGAGG - Intergenic
1076113312 10:127877684-127877706 CTGGAGGCAAAGAGAGATTTTGG - Intergenic
1076471533 10:130722115-130722137 CTGAAGGCAAGGATGGAGGGAGG + Intergenic
1077127338 11:947044-947066 CTGTCGCCAAGGCTAGAGTGCGG + Intronic
1077239223 11:1501964-1501986 CTGTAGGCACAGAGAGACGGTGG - Intergenic
1079446890 11:20565447-20565469 CTGTAATCAAAGATAGGTTGTGG + Intergenic
1079686128 11:23362232-23362254 CAGCAGGCAAAGAGAGAATGAGG + Intergenic
1080151596 11:29057791-29057813 CAGCAGGCAAAGAGAGAATGAGG - Intergenic
1080183161 11:29447376-29447398 CAGCAGGCAAAGAGAGAATGAGG - Intergenic
1081222839 11:40483236-40483258 CTGGAGACAAAGCTAGAGGGAGG + Intronic
1081269715 11:41068352-41068374 CTGTTGCCCAAGCTAGAGTGCGG - Intronic
1083973489 11:66098138-66098160 CTGTAGCCCAAGCTGGAGTGTGG - Intronic
1084053250 11:66614883-66614905 CTGTTGGCCAGGATGGAGTGTGG + Intergenic
1085766493 11:79287711-79287733 CTGTAGCAAAAAAGAGAGTGAGG + Intronic
1087436575 11:98126406-98126428 CAGCAGGCAAAGAGAGAATGAGG - Intergenic
1088632910 11:111791549-111791571 TTGTAGGCAATGAGAGAGTTTGG - Intronic
1090192917 11:124788043-124788065 CTGTTGCCCAAGCTAGAGTGCGG - Intronic
1090591782 11:128278998-128279020 TGGTAGGCAAATATAGTGTGAGG + Intergenic
1092576308 12:9787056-9787078 ATGTAGGCAAAGAAAGACTGGGG - Intergenic
1093021280 12:14206590-14206612 CAGCAGGCAAAGAGAGAATGAGG + Intergenic
1093545554 12:20342210-20342232 ATCCAGGCAAAGAAAGAGTGGGG - Intergenic
1094483198 12:30901352-30901374 CAGCAGGCAAAGAGAGAGTTTGG - Intergenic
1094489045 12:30947191-30947213 CTCTAGGCAAAGAAAAATTGTGG + Intronic
1095918910 12:47509128-47509150 CTCTAGGATAAGATAGAGAGAGG + Intergenic
1097087479 12:56479040-56479062 CTGGAGGCAAAGTGAGAGTCAGG - Exonic
1097124783 12:56765532-56765554 CTGTTGCCCAGGATAGAGTGCGG + Intronic
1097663526 12:62455637-62455659 CGGCAGGCAAAGAGAGAATGAGG + Intergenic
1099091834 12:78320790-78320812 CAGCAGGCAAAGAGAGAATGAGG - Intergenic
1099635062 12:85203183-85203205 CAGCAGGCAAAGACAGAATGAGG - Intronic
1099654931 12:85478317-85478339 CAGCAGGCAAAGAGAGAGTGAGG + Intergenic
1099754032 12:86817855-86817877 CTGTACACTAGGATAGAGTGTGG + Intronic
1100758711 12:97781805-97781827 CAGCAGGCAAAGAGAGAATGAGG - Intergenic
1101325960 12:103716210-103716232 CTTAAGCCAAAGATAAAGTGTGG - Intronic
1101363476 12:104049758-104049780 CTGAAGGCAAAGTTTGTGTGGGG + Intronic
1102660860 12:114526990-114527012 GTGTAGACAGAGACAGAGTGAGG - Intergenic
1104147514 12:126049530-126049552 CAGCAGGCAAAGAGAGAATGAGG + Intergenic
1105486445 13:20837753-20837775 CAGCAGGCAAAGAGAGAATGAGG + Intronic
1105977246 13:25482787-25482809 CAGCAGGCAAAGAGAGAATGAGG - Intronic
1107039302 13:35932591-35932613 CAGCAGGCAAAGAGAGAGTGAGG + Intronic
1109312984 13:60717203-60717225 CTGTAGGAAAAGCCAGAGTAAGG + Intergenic
1109328959 13:60903850-60903872 GTGAAAGCAAAGAGAGAGTGTGG + Intergenic
1109496541 13:63178959-63178981 CAGCAGGCAAAGAGAGAATGAGG - Intergenic
1109810581 13:67508457-67508479 CAGGAGGCAAAGAGAGAATGAGG - Intergenic
1110981097 13:81899408-81899430 CAGCAGGCAAAGAGAGAATGAGG + Intergenic
1112354053 13:98659961-98659983 CTGTAGGCAAAGACTGAATTGGG - Intergenic
1112377287 13:98855048-98855070 TTGTAGGAAAGGATAAAGTGTGG - Intronic
1114738949 14:25074236-25074258 CTAGAGGCAAAGATTGGGTGGGG + Intergenic
1114811182 14:25901426-25901448 GTGTATGCAGAGAGAGAGTGGGG - Intergenic
1116276084 14:42833712-42833734 CAGCAGGCAAAGAGAGAATGAGG + Intergenic
1116468607 14:45261816-45261838 CTGTCGCCCAAGCTAGAGTGTGG + Intergenic
1117729928 14:58712181-58712203 CTGAAGGCAAAGGTAGCGGGTGG + Intergenic
1120775670 14:88434647-88434669 CTGTCGCCCAAGATGGAGTGCGG - Intronic
1121656423 14:95599677-95599699 CTTTAAGCAAAGATAGACTAGGG - Intergenic
1121666609 14:95677126-95677148 CTGTAAGCCAAGTCAGAGTGAGG + Intergenic
1121734067 14:96205748-96205770 CTTTATGCAAAGATAGAGGTAGG + Intronic
1121845003 14:97165132-97165154 CTGTAGTCAGTGAGAGAGTGGGG + Intergenic
1122591541 14:102855757-102855779 CTGTAGCCCAAGCTGGAGTGCGG - Intronic
1123894185 15:24811796-24811818 CTGTCGGCCAGGCTAGAGTGCGG - Intergenic
1124140643 15:27074052-27074074 CAGCAGGCAAAGAGAGAATGAGG + Intronic
1127278517 15:57468896-57468918 CAGCAGGCAAAGAGAGAATGAGG - Intronic
1128227725 15:66013861-66013883 GTGAAGGCAAAGAGAGACTGAGG + Intronic
1130211093 15:81922910-81922932 CTGTAGCCCACGCTAGAGTGTGG - Intergenic
1131317568 15:91353495-91353517 CTGAAGGCAAAAAGAGAGAGTGG - Intergenic
1131439742 15:92450543-92450565 CAGAAGGCAAAGGGAGAGTGAGG + Intronic
1131659381 15:94497902-94497924 CAGCAGGCAAAGAGAGAATGAGG - Intergenic
1131659667 15:94499842-94499864 CAGCAGGCAAAGAGAGAATGAGG - Intergenic
1132004433 15:98213706-98213728 TTGTAGGCCAGGATGGAGTGCGG + Intergenic
1132160926 15:99541655-99541677 CTGTACACAAAAATAGAGTTGGG - Intergenic
1133912917 16:10082165-10082187 TCGTAGGCAGAGATGGAGTGTGG - Intronic
1135999094 16:27277006-27277028 CTGAAAGCATAGATAGAGTGGGG + Intronic
1139196991 16:64930960-64930982 CAGCAGGCAAAGAGAGAATGGGG + Intergenic
1139540437 16:67611297-67611319 CTTCAGGCAAAGGTAGGGTGTGG - Exonic
1141401856 16:83754675-83754697 CAGCAGGCAAAGAGAGAATGAGG - Intronic
1141601396 16:85128707-85128729 CTGTAGGCAAGGGGACAGTGCGG - Intergenic
1142255936 16:89013992-89014014 GTGCAGGCAGAGAAAGAGTGAGG + Intergenic
1203079534 16_KI270728v1_random:1139952-1139974 CTGTGGGCAAAGGGACAGTGTGG + Intergenic
1143354165 17:6312963-6312985 CAGCAGGCAAAGAGAGAATGAGG + Intergenic
1144134993 17:12285881-12285903 CTGTGGCCAAAGATATACTGAGG - Intergenic
1144255020 17:13458998-13459020 ATGTGGGCAAACATAGTGTGTGG - Intergenic
1145785046 17:27588162-27588184 CAGAAGGCAAAGCCAGAGTGAGG - Intronic
1147381057 17:40056538-40056560 GAGCAGGCAAAGGTAGAGTGAGG - Intronic
1147397312 17:40154339-40154361 CTTTGGGCAAAGATCAAGTGTGG - Intronic
1147913757 17:43874254-43874276 CTGAGTGCAAAGACAGAGTGAGG + Intergenic
1148647552 17:49227884-49227906 CAGTGGGCAAAGAGAGGGTGAGG + Intronic
1148770912 17:50065654-50065676 CAGCAGGCAAAGAGAGAATGAGG + Intronic
1151937347 17:77270761-77270783 CTGTCGTCCAGGATAGAGTGCGG + Intergenic
1152194650 17:78910227-78910249 CTGTAGCCCAGGCTAGAGTGTGG + Intronic
1153214631 18:2808530-2808552 CAGCAGGCAAAGAGAGAATGAGG + Intergenic
1153984653 18:10341474-10341496 CAGCAGGCAAAGAGAGAGTGAGG - Intergenic
1154977478 18:21473888-21473910 CGGCAGGCAAAGAGAGAATGAGG + Intronic
1155090916 18:22510175-22510197 CAGCAGGCAAAGAAAGAATGAGG + Intergenic
1155172513 18:23277328-23277350 CAGCAGGCAAAGACAGAATGAGG - Intronic
1155571434 18:27198013-27198035 CTGGAGGCAGAGAATGAGTGAGG + Intergenic
1155773173 18:29725682-29725704 CAGCAGGCAAAGAGAGAATGAGG + Intergenic
1156593055 18:38513133-38513155 CAGCAGGCAAAGAGAGAATGAGG - Intergenic
1159236428 18:65679982-65680004 CTGTAGACATAGCAAGAGTGAGG - Intergenic
1159408342 18:68035956-68035978 CTGGAGGCAAAAATACATTGTGG + Intergenic
1159838941 18:73373611-73373633 CAGCAGGCAAAGAGAGACTGAGG - Intergenic
1162121546 19:8472654-8472676 CAGGAGGCAGAGATTGAGTGCGG - Intronic
1162321523 19:9973627-9973649 CAGGAGGCAAAGTGAGAGTGGGG + Intronic
1162967027 19:14160898-14160920 CTGGAGGCAAAGACAGAAGGGGG - Intronic
1162985771 19:14268586-14268608 CTGTAGCCCAGGCTAGAGTGCGG - Intergenic
1166987926 19:46673262-46673284 CTGGAGTCAAAGGTAGAGAGAGG + Intergenic
1167136746 19:47620941-47620963 CCGTAGACAGAGATCGAGTGGGG - Intronic
1167392123 19:49202378-49202400 CTGTCGCCAAGGCTAGAGTGTGG + Intronic
1167530716 19:50014604-50014626 CTGAAGGCAGTGAAAGAGTGGGG + Intronic
1167627814 19:50604211-50604233 CTGAAGGGAAAGATAAAGGGCGG - Intergenic
1167628173 19:50606106-50606128 CTGAAGGGAAAGATAAAGGGCGG - Intergenic
926605954 2:14898687-14898709 CAGCAGGCAAAGAGAGAATGAGG - Intergenic
926889224 2:17625123-17625145 CAGCAGGCAAAGAGAGAATGAGG - Intronic
927114107 2:19885107-19885129 ATGTAGGCCAGGAAAGAGTGTGG - Intergenic
928478851 2:31660257-31660279 CTGCAGGCAATGATATAGAGGGG + Intergenic
928696668 2:33856333-33856355 CAGCAGGCAAAGAGAGAATGAGG - Intergenic
929325724 2:40608660-40608682 TTGTTGGCAAAGTTAGTGTGTGG - Intronic
930251014 2:49033973-49033995 CTGAAGGAAAAGATGAAGTGAGG + Intronic
930296287 2:49558476-49558498 CTGTAGGAAAAAATAAAGTTAGG + Intergenic
931028378 2:58140495-58140517 CCGTATGCACAAATAGAGTGTGG + Intronic
931033646 2:58212222-58212244 CAGCAGGCAAAGAGAGAATGAGG + Intronic
931262275 2:60630757-60630779 CAGCAGGCAAAGAGAGAATGAGG - Intergenic
931514176 2:63032797-63032819 CTGTCTGCTAAGATAGAATGTGG - Intronic
933077950 2:77953869-77953891 CTGAAGGGAAAGATAAAGGGCGG + Intergenic
933190406 2:79327909-79327931 TAGTAGGCAAAGGTAGGGTGTGG + Intronic
933289953 2:80426855-80426877 CTAGAGGAAAGGATAGAGTGGGG - Intronic
936076669 2:109405732-109405754 CTGTAGGCAAAGAGACAGTGGGG - Intronic
936276155 2:111099404-111099426 CTGTAGGCACAGAGAAACTGAGG + Intronic
936605716 2:113950927-113950949 CAGCAGGCAAAGAGAGAATGAGG + Intronic
936830008 2:116632453-116632475 CAGCAGGCAAAGAGAGAATGAGG + Intergenic
937893017 2:126954398-126954420 CAGCAGGCAAAGAGAGAATGAGG - Intergenic
938170346 2:129070219-129070241 CTCTAGCCAAAGATGGAGTGAGG + Intergenic
938856048 2:135312233-135312255 CTGTTGCCAAAGCTGGAGTGCGG + Intronic
939511602 2:143112977-143112999 CTGAAAGAAGAGATAGAGTGGGG + Intronic
939718468 2:145616026-145616048 CAAGAGGCAAAGATAGATTGTGG - Intergenic
941495788 2:166200670-166200692 CTGTCGCCAAAGCTGGAGTGCGG + Intronic
941894941 2:170619781-170619803 CTGTTGCCCAAGCTAGAGTGCGG + Intronic
942753090 2:179309922-179309944 CTGTGGGCCAAAATAGATTGTGG - Intergenic
942813530 2:180024400-180024422 CTGTAGGCAAACAAGGACTGAGG - Intergenic
943004613 2:182374935-182374957 CAGCAGGCAAAGAGAGAATGAGG + Intronic
943485129 2:188469539-188469561 CAGTAGGCAAAGGGGGAGTGAGG + Intronic
944333786 2:198504371-198504393 CTGGAGGCAATGATACAGTGGGG + Intronic
945067528 2:205959808-205959830 CTGGAGGCAAAAATAGAGAGTGG + Intergenic
945720637 2:213414921-213414943 CAGCAGGCAAAGAGAGAATGAGG + Intronic
947025379 2:225732215-225732237 CTGTATTCAAAGATAGAGGTAGG + Intergenic
947632130 2:231660893-231660915 CTGTAGGAAAAAATAAAGGGAGG + Intergenic
1168837259 20:885457-885479 CTGTAGGCACAGATTGAGGAGGG + Intronic
1169249180 20:4046995-4047017 CTCTATGAAAAGATATAGTGTGG + Intergenic
1169413085 20:5391358-5391380 CTGTAGTCGAAGATAAAGTTAGG - Intergenic
1171025971 20:21630584-21630606 CTGTAGGGAAAGAAAGAGTCAGG + Intergenic
1174661479 20:52216919-52216941 CTGTAGGCCAAGACAGAGTAGGG - Intergenic
1175559808 20:59912870-59912892 CAGCAGGCAAAGAAAGAATGAGG - Intronic
1175779759 20:61675050-61675072 CTCTAGACAGAGATAGAATGGGG + Intronic
1177387783 21:20429672-20429694 CAGCAGGCAAAGACAGAATGAGG - Intergenic
1177621754 21:23604471-23604493 CAGCAGGCAAAGAGAGAATGAGG - Intergenic
1179922424 21:44514309-44514331 CTGTAGGCAAGGATACAGTGGGG - Intronic
1180926753 22:19560282-19560304 CTGCAGGCAAAAGTAGTGTGGGG + Intergenic
1181305951 22:21917380-21917402 CTGCAGGCAAAGTGGGAGTGGGG + Intergenic
1181768397 22:25108695-25108717 TTGAAGGCAAAGATGGGGTGGGG - Intronic
1182951904 22:34383998-34384020 CAGCAGGAAAAGAGAGAGTGAGG - Intergenic
1183071194 22:35397571-35397593 CTGTTGCCAATGCTAGAGTGCGG - Intergenic
1183283282 22:36945606-36945628 CAGCAGGCAAAGAGAGAATGAGG + Intergenic
1184588564 22:45464694-45464716 CTGCAGGCAAAGAGAGAATGAGG + Intergenic
1203239286 22_KI270732v1_random:40417-40439 ATGGAGGCAAAGACAGAGAGAGG - Intergenic
949628160 3:5891435-5891457 CTGTAGGAAAAAATCAAGTGTGG + Intergenic
949628295 3:5892895-5892917 CTGTAGGAAAAAATCAAGTGTGG + Intergenic
949875886 3:8625847-8625869 TTGTAGGCAAAGATGAAATGAGG - Intronic
950420362 3:12895258-12895280 CTGTTGGCAAAGCTGGAGTGTGG - Intergenic
950764675 3:15265020-15265042 CTAGAGGCCAAGATAGAATGAGG - Intronic
951132067 3:19059084-19059106 CAGAAGGCAAAGATAGACAGGGG + Intergenic
951211695 3:19982199-19982221 CTGTAGCCCAAGTTAGAGTGTGG - Intronic
952134635 3:30403418-30403440 CTTGAGCCAAAGATAAAGTGAGG + Intergenic
952741626 3:36739548-36739570 CAGCAGGCAAAGAGAGAATGAGG - Intronic
953356592 3:42261491-42261513 CTGAAGGCAAAGGGAGAGGGGGG + Intronic
955130096 3:56157576-56157598 CTTTAGGAAAAGATTGAGTGAGG + Intronic
956439655 3:69267704-69267726 CGGGAGGCAGAGATAGACTGGGG - Intronic
956751637 3:72348164-72348186 CTGTGGGCAAAGAAACTGTGAGG + Intergenic
956861487 3:73328313-73328335 TGGAAGGCAAAGAGAGAGTGAGG + Intergenic
957314565 3:78560759-78560781 CAGAAGGCAAAGATAGAGTCAGG + Intergenic
957373340 3:79324842-79324864 CTTTAGGAAAAGATAGTGTGTGG + Intronic
958423824 3:93958747-93958769 CAGCAGGCAAAGAGAGAATGAGG - Intronic
958491441 3:94779278-94779300 CTGTTGGAAAAGATAGAGATGGG + Intergenic
960256336 3:115515370-115515392 CTTAAGGCAAAGGGAGAGTGAGG + Intergenic
960626658 3:119687858-119687880 CTGCAGGAAAAGAGAGAATGAGG + Intergenic
961599007 3:128044268-128044290 CTTTAGGCAAAGATGGATTTAGG - Intergenic
961791637 3:129380744-129380766 CTGTCAGCAAACATAGACTGGGG + Intergenic
962946393 3:140174639-140174661 CAGCAGGCAAAGAGAGAATGAGG + Intronic
963368306 3:144366686-144366708 CAGTAGGCAAAGAGAGAATGAGG + Intergenic
963368556 3:144368629-144368651 CAGCAGGCAAAGAGAGAATGAGG + Intergenic
964459971 3:156913587-156913609 CTGTAGCTAAGGATAGAGAGTGG + Intronic
964963007 3:162451237-162451259 CTGTTGCCCAGGATAGAGTGCGG - Intergenic
965109216 3:164400750-164400772 CTGTAGTCACTGATAGCGTGAGG + Intergenic
965226333 3:165997519-165997541 CAGGAGGCAAAGACAGAATGAGG + Intergenic
966272657 3:178126349-178126371 AGGTAGGGAAAGAGAGAGTGAGG + Intergenic
967003401 3:185359194-185359216 CAGCAGGCAAAGAGAGAGTGAGG + Intronic
967521146 3:190434412-190434434 CAGCAGGCAAAGAGAGAGTAAGG - Intronic
967557575 3:190876877-190876899 CTGAAGGGAAAGATAAAGGGTGG + Intronic
967818250 3:193816915-193816937 CTGTAGGCAAGGCTAGACTCTGG + Intergenic
970048557 4:11884156-11884178 ATCTAAGGAAAGATAGAGTGTGG + Intergenic
971274279 4:25181089-25181111 GTGAAGACAAAGATAGAGAGTGG + Intronic
972191851 4:36602517-36602539 CTGTAAGCAATAATAGAGTCAGG + Intergenic
972487388 4:39555267-39555289 CTGTAGCCCAAGCTGGAGTGTGG + Intronic
973979281 4:56293620-56293642 CAGAAGGCAAAGAGGGAGTGAGG + Intronic
974215415 4:58840962-58840984 CAGCAGGCAAAGAGAGAATGAGG - Intergenic
974617837 4:64312728-64312750 CTGTAGCCCAGGCTAGAGTGCGG - Intronic
974703904 4:65487032-65487054 CAGAAGGCAAAGAAGGAGTGAGG - Intronic
975734827 4:77371056-77371078 CTGAGGGAAAAGATGGAGTGTGG - Intronic
976051254 4:81013355-81013377 CAGCAGGCAAAGAGAGAATGAGG - Intergenic
977262207 4:94811318-94811340 CTGAAGGCAAAGAAAGAGCAGGG + Intronic
977432063 4:96942479-96942501 TAGTAGGCAAAGATGTAGTGAGG - Intergenic
977579197 4:98705775-98705797 CAGCAGGCAAAGACAGAATGAGG - Intergenic
979391757 4:120137248-120137270 CAGCAGGCAAAGAGAGAATGAGG + Intergenic
979392048 4:120139176-120139198 CAGCAGGCAAAGAGAGAATGAGG + Intergenic
980885749 4:138760370-138760392 CTGTATGCAAAGAAATTGTGTGG + Intergenic
981914303 4:150016744-150016766 CAGCAGGCAAAGAGAGAATGAGG + Intergenic
982445153 4:155482565-155482587 GGGTAGGCAATGATAGATTGTGG + Intergenic
983273565 4:165591260-165591282 CAGCAGGCAAAGAGAGAATGAGG + Intergenic
983800401 4:171921868-171921890 CTCTAAGCAAATATAGAGTTTGG - Intronic
984121499 4:175750607-175750629 CTGTCGCCAAGGCTAGAGTGTGG + Intronic
985150130 4:186938434-186938456 CTTTAGGGAAAGATAAAGAGGGG + Intergenic
986221951 5:5776102-5776124 CAGCAGGCAAAGAGAGAATGAGG - Intergenic
987279966 5:16403123-16403145 CGGAAGGCAAAGGGAGAGTGAGG + Intergenic
987381836 5:17292751-17292773 CTGAAGGCAGAGATACACTGGGG - Intergenic
987692268 5:21282605-21282627 CTGAATGCAAAGATGGAATGAGG - Intergenic
987783229 5:22465607-22465629 CTGTTGCCCAAGCTAGAGTGTGG - Intronic
987885004 5:23801233-23801255 CAGCAGGCAAAGAGAGAATGAGG - Intergenic
988562588 5:32294264-32294286 CTGGAGGCATATACAGAGTGTGG - Intronic
988865620 5:35331270-35331292 CAGCAGGCAAAGAGAGAATGAGG - Intergenic
990165692 5:52990427-52990449 CATTAGGCAGAGCTAGAGTGTGG + Intronic
990396546 5:55385908-55385930 TTTTAGGCAAAGATAGAATGAGG + Intronic
990487918 5:56277510-56277532 CTGTGGGAAGAAATAGAGTGGGG - Intergenic
990908807 5:60833076-60833098 TTGTAGACAAAGATGGAGGGGGG + Intronic
991152667 5:63388850-63388872 GTGTAGGCACAGAAAGAATGGGG + Intergenic
991748092 5:69767446-69767468 CTGAATGCAAAGATGGAATGAGG + Intergenic
991799672 5:70347293-70347315 CTGAATGCAAAGATGGAATGAGG + Intergenic
991828925 5:70662745-70662767 CTGAATGCAAAGATGGAATGAGG - Intergenic
991892030 5:71346722-71346744 CTGAATGCAAAGATGGAATGAGG + Intergenic
992113193 5:73515206-73515228 CTGTCGCCCAAGGTAGAGTGTGG - Intergenic
992651394 5:78864340-78864362 CAGCAGGCAAAGAGAGAATGAGG + Intronic
992924588 5:81568342-81568364 CAGCAGGCAAAGAGAGAATGAGG - Intronic
995598164 5:113768744-113768766 CAGCAGGCAAAGAGAGAATGAGG - Intergenic
996794007 5:127324605-127324627 TTGGAGGCAAAGACAGAGTGTGG - Intronic
997340976 5:133144418-133144440 CAGCAGGCAAAGAGAGAATGAGG - Intergenic
998403801 5:141862494-141862516 TGGTAGGCTAAGATAGTGTGGGG + Intronic
999572664 5:152938137-152938159 CAGCAGGCAAAGAGAGAGTGAGG - Intergenic
1000408350 5:160912560-160912582 CTGTTGGCCAGGCTAGAGTGCGG - Intergenic
1001224663 5:169933406-169933428 GTGAAGGCAAAGATTGAGAGTGG + Intronic
1002350413 5:178579488-178579510 CTGTCGCCCAGGATAGAGTGTGG + Intronic
1003518225 6:6835286-6835308 CTATAGATACAGATAGAGTGGGG - Intergenic
1003952303 6:11127614-11127636 CAGCAGGCAAAGAGAGAATGAGG + Intronic
1004689175 6:17976763-17976785 CTGTTGCCCAGGATAGAGTGCGG - Intronic
1007081259 6:39106488-39106510 CTGTTGCCCAAGCTAGAGTGTGG - Intronic
1009837882 6:69027801-69027823 CAGTAGGTAGAAATAGAGTGTGG + Intronic
1010459201 6:76094558-76094580 CAGCAGGCAAAGAGAGAATGAGG - Intergenic
1010646654 6:78397146-78397168 GTGTAGGCAGAGAGTGAGTGTGG - Intergenic
1010835157 6:80577594-80577616 CTGAAGGCAAAAATAGAGATTGG - Intergenic
1011073865 6:83417084-83417106 CTGTTGCCCAGGATAGAGTGCGG + Intronic
1013500662 6:110747193-110747215 CTGCAGGTAAACATAGAATGGGG - Intronic
1014406832 6:121063452-121063474 CAGCAGGCAAAGAGAGAATGAGG - Intergenic
1018031883 6:159847907-159847929 CAGCAGGCAAAGAGAGAATGAGG - Intergenic
1018862125 6:167718775-167718797 CAGCAGGCAAAGAGAGAATGAGG - Intergenic
1018943833 6:168330929-168330951 CTGTGGAAAAAGATAGATTGGGG - Intergenic
1020376437 7:7492546-7492568 CTGTTGCCAAAGCTGGAGTGTGG - Intronic
1021275313 7:18642711-18642733 CTGTAGTCAAAGCCAGTGTGAGG + Intronic
1022554879 7:31282976-31282998 CTGTAGGTAAAGAAAGACTTTGG - Intergenic
1023509756 7:40939188-40939210 CAGCAGGCAAAGACAGAATGAGG + Intergenic
1023786752 7:43715954-43715976 CAGCAGGCAAAGAGAGAATGAGG - Intronic
1024438444 7:49387310-49387332 CAGCAGGCAAAGAGAGAATGAGG + Intergenic
1024438686 7:49389229-49389251 CAGCAGGCAAAGAAAGAATGAGG + Intergenic
1024800423 7:53071496-53071518 CTGTAGGAAAAGAAAGAGTAGGG - Intergenic
1025871864 7:65441762-65441784 CTGTAGCCAGGGAAAGAGTGAGG + Intergenic
1026287478 7:68975957-68975979 CAGAAGGCAAAGGGAGAGTGAGG - Intergenic
1026611658 7:71865306-71865328 CTGGAGGAAGAGATAGAGAGGGG - Intronic
1026647596 7:72185795-72185817 CAGCAGGCAAAGAGAGAATGAGG - Intronic
1028247780 7:88502863-88502885 CTGTAGCCCAGGCTAGAGTGTGG + Intergenic
1029116849 7:98242004-98242026 CTGGATGCAAAGAGAGAGAGGGG - Intronic
1030641359 7:112010218-112010240 CTGTAGGGAAAGATAAAATATGG + Intronic
1033644820 7:143292972-143292994 CTGTTGGCAAGGCTGGAGTGCGG - Intronic
1034809328 7:154117547-154117569 CTGCAAGAGAAGATAGAGTGGGG - Intronic
1034836636 7:154358526-154358548 CTGGAGGCAGAGAGAGACTGTGG + Intronic
1035822036 8:2603676-2603698 CTGTTGCCCAGGATAGAGTGCGG - Intergenic
1036493887 8:9252027-9252049 CTGTTGGCAAAGAGAGGGAGGGG + Intergenic
1037712519 8:21366640-21366662 TTACAGGCCAAGATAGAGTGAGG + Intergenic
1040030314 8:42817996-42818018 CTGTGGCCAAGGCTAGAGTGCGG + Intergenic
1040658945 8:49546239-49546261 GTGATGGCAAAGATTGAGTGTGG + Intronic
1041970536 8:63736844-63736866 CTGGAAGCAGAGAAAGAGTGAGG + Intergenic
1042002310 8:64138473-64138495 CTGTAGACAAAGTGAGATTGAGG + Intergenic
1042169655 8:65979196-65979218 CAGCAGGCAAAGAGAGAATGAGG - Intergenic
1042435865 8:68764026-68764048 CTGTAGGGAATGATGGACTGAGG - Intronic
1042961391 8:74307172-74307194 ATGTAGGTAAAGATGAAGTGAGG - Intronic
1043764012 8:84106226-84106248 CTGTAGCCCAGGCTAGAGTGCGG + Intergenic
1044169964 8:89038159-89038181 CTGTAGGTAATTATAAAGTGTGG + Intergenic
1044395374 8:91704481-91704503 CAGGAGGCAAAGAGAGAATGAGG + Intergenic
1044751057 8:95415827-95415849 CTGTAGGGAAAGAAAAAGGGAGG - Intergenic
1046052753 8:109043752-109043774 CAGCAGGCAAAGAAAGAATGAGG + Intergenic
1046061487 8:109144930-109144952 CAGCAGGCAAAGAGAGAATGAGG - Intergenic
1046689179 8:117263500-117263522 CAGCAGGCAAAGAGAGAATGAGG - Intergenic
1047158729 8:122352288-122352310 CAGCAGGCAAAGAGAGAATGAGG - Intergenic
1049076174 8:140398069-140398091 CAGCAGGCAAAGAGAGAATGAGG - Intronic
1049076450 8:140400030-140400052 CAGCAGGCAAAGAGAGAATGAGG - Intronic
1049462429 8:142736294-142736316 CTGTAGGCCCAGAAAGGGTGGGG - Exonic
1050362796 9:4846766-4846788 CTATGGGCACAGCTAGAGTGTGG + Intronic
1050482147 9:6098314-6098336 CAGGAGGCAATGTTAGAGTGTGG + Intergenic
1050502437 9:6313266-6313288 CAGCAGGCAAAGAGAGAATGAGG + Intergenic
1050838911 9:10121881-10121903 TTGTAGTCAAAGTCAGAGTGGGG - Intronic
1051126249 9:13809054-13809076 CTGAAGGCAGTGAAAGAGTGTGG + Intergenic
1051524030 9:18022397-18022419 CAAGAGGCAAAGATAGTGTGGGG - Intergenic
1052473565 9:28930228-28930250 CTGAAGGATAAGAAAGAGTGTGG - Intergenic
1053584504 9:39442720-39442742 TTGTGGGCAAGGATAGTGTGAGG - Intergenic
1053873835 9:42522461-42522483 CTGCAGGCCAAGAGAGATTGGGG + Intergenic
1053898788 9:42772084-42772106 CTGCAGGCCAAGAGAGATTGGGG - Intergenic
1054106084 9:61001466-61001488 TTGTGGGCAAGGATAGTGTGAGG - Intergenic
1054268497 9:62944295-62944317 CTGCAGGCCAAGAGAGATTGGGG - Intergenic
1054551985 9:66613704-66613726 CTGCAGGCCAAGAGAGATTGGGG - Intergenic
1055330947 9:75183489-75183511 CAGCAGGCAAAGAGAGAATGAGG + Intergenic
1055931185 9:81561213-81561235 CAGCAGGCAAAGAGAGAATGAGG - Intergenic
1056874150 9:90311901-90311923 TTGTGGGCAAAGGAAGAGTGAGG - Intergenic
1057551569 9:96054477-96054499 CAGCAGGCAAAGAGAGAATGAGG + Intergenic
1058498893 9:105590948-105590970 CAGGAGGAAAAGAGAGAGTGGGG + Intronic
1059303048 9:113330978-113331000 CTGGAGGGAAAGATAAGGTGGGG - Exonic
1059738770 9:117128854-117128876 CAGCAGGCAAAGAGAGAATGAGG + Intronic
1060552482 9:124492244-124492266 CTGTAGGGAAAGAGAGGGAGGGG - Intronic
1061228998 9:129301354-129301376 CTGTCGACAAAGGTAGAATGGGG - Intergenic
1186039732 X:5462676-5462698 TTTTAGGCAAAGATACAGTTTGG + Intergenic
1186217234 X:7313095-7313117 CTGTAGGCAGAGAAAAAGGGAGG - Intronic
1187176970 X:16904741-16904763 CTGTAGTTAATGATATAGTGTGG + Intergenic
1188345788 X:29063978-29064000 CTGAAGGCAAAGAATCAGTGTGG - Intronic
1188449437 X:30294010-30294032 CAGCAGGCAAAGAGAGAGTGAGG - Intergenic
1188631520 X:32368239-32368261 CTGTAGGCATGATTAGAGTGAGG - Intronic
1189202762 X:39211914-39211936 CAGAAGGCAAAGGGAGAGTGAGG + Intergenic
1190209428 X:48433110-48433132 CTGTGGGGAAAGATGGTGTGGGG - Intergenic
1192434957 X:71137378-71137400 CTCCAGGCAAAGATAGTGAGAGG + Exonic
1194256801 X:91645173-91645195 CTGCAGGCAAAGAGAGAATGAGG - Intergenic
1194311201 X:92309492-92309514 CTGGAGGGAAGGAAAGAGTGAGG + Intronic
1195135640 X:101905159-101905181 CTATGGGCAAAGATAGTTTGTGG - Intronic
1195375892 X:104227891-104227913 CAGCAGGCAAAGAGAGAGAGAGG - Intergenic
1196169664 X:112573820-112573842 CAGCAGGCAAAGAGAGAATGAGG - Intergenic
1196169926 X:112575748-112575770 CAGCAGGCAAAGAGAGAATGAGG - Intergenic
1196189514 X:112780136-112780158 CTGTTGACACAGATTGAGTGTGG + Intronic
1197092696 X:122557152-122557174 CAGCAGGCAAAGAGAGAATGAGG - Intergenic
1197758399 X:130011845-130011867 ATGTAGGCAAGGATAGAAGGAGG + Intronic
1197835154 X:130686385-130686407 CAGAAGGCAAAGATGGAGCGAGG - Intronic
1197927332 X:131660618-131660640 GTGTAGGGAAAGAAAGAGGGAGG - Intergenic
1197975823 X:132164364-132164386 CAGCAGGCAAAGAGAGAATGAGG - Intergenic
1199823687 X:151476355-151476377 CAGCAGGCAAAGAGAGAATGAGG - Intergenic
1199869089 X:151880464-151880486 CTGTCGCCCAAGCTAGAGTGCGG + Intergenic
1200575520 Y:4884438-4884460 CTGCAGGCAAAGAGAGAAGGAGG - Intergenic
1201547233 Y:15178917-15178939 TTTTAGGCAAAGATATAGTTTGG - Intergenic
1201587586 Y:15577882-15577904 CTGTAGGCAGAGAAAAAGAGAGG - Intergenic