ID: 919957764

View in Genome Browser
Species Human (GRCh38)
Location 1:202436343-202436365
Sequence CAAGCTACTCTGATTCTAAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
919957764_919957767 11 Left 919957764 1:202436343-202436365 CCCCTTAGAATCAGAGTAGCTTG No data
Right 919957767 1:202436377-202436399 CATTATTGAACCCCTAAAGCTGG 0: 1
1: 0
2: 0
3: 7
4: 82
919957764_919957769 16 Left 919957764 1:202436343-202436365 CCCCTTAGAATCAGAGTAGCTTG No data
Right 919957769 1:202436382-202436404 TTGAACCCCTAAAGCTGGAAGGG 0: 1
1: 0
2: 1
3: 6
4: 143
919957764_919957768 15 Left 919957764 1:202436343-202436365 CCCCTTAGAATCAGAGTAGCTTG No data
Right 919957768 1:202436381-202436403 ATTGAACCCCTAAAGCTGGAAGG 0: 1
1: 0
2: 0
3: 8
4: 91
919957764_919957770 17 Left 919957764 1:202436343-202436365 CCCCTTAGAATCAGAGTAGCTTG No data
Right 919957770 1:202436383-202436405 TGAACCCCTAAAGCTGGAAGGGG 0: 1
1: 0
2: 1
3: 18
4: 204

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
919957764 Original CRISPR CAAGCTACTCTGATTCTAAG GGG (reversed) Intronic
No off target data available for this crispr