ID: 919958088

View in Genome Browser
Species Human (GRCh38)
Location 1:202438874-202438896
Sequence GATGTATGGGCTCCTGCCCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 138
Summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 123}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
919958088_919958103 30 Left 919958088 1:202438874-202438896 CCCAGGGCAGGAGCCCATACATC 0: 1
1: 0
2: 1
3: 13
4: 123
Right 919958103 1:202438927-202438949 CCCCGAAGACGGCCGTGGACTGG 0: 1
1: 0
2: 1
3: 4
4: 36
919958088_919958094 1 Left 919958088 1:202438874-202438896 CCCAGGGCAGGAGCCCATACATC 0: 1
1: 0
2: 1
3: 13
4: 123
Right 919958094 1:202438898-202438920 ACCGCACGCGGCCCTGTGCCTGG 0: 1
1: 1
2: 0
3: 12
4: 168
919958088_919958096 4 Left 919958088 1:202438874-202438896 CCCAGGGCAGGAGCCCATACATC 0: 1
1: 0
2: 1
3: 13
4: 123
Right 919958096 1:202438901-202438923 GCACGCGGCCCTGTGCCTGGAGG 0: 2
1: 0
2: 2
3: 17
4: 234
919958088_919958101 25 Left 919958088 1:202438874-202438896 CCCAGGGCAGGAGCCCATACATC 0: 1
1: 0
2: 1
3: 13
4: 123
Right 919958101 1:202438922-202438944 GGTGACCCCGAAGACGGCCGTGG 0: 1
1: 0
2: 1
3: 0
4: 43
919958088_919958100 19 Left 919958088 1:202438874-202438896 CCCAGGGCAGGAGCCCATACATC 0: 1
1: 0
2: 1
3: 13
4: 123
Right 919958100 1:202438916-202438938 CCTGGAGGTGACCCCGAAGACGG 0: 1
1: 1
2: 0
3: 18
4: 153

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
919958088 Original CRISPR GATGTATGGGCTCCTGCCCT GGG (reversed) Intronic
903164308 1:21509853-21509875 TCTGTCTGGGCACCTGCCCTTGG + Intronic
904283250 1:29436293-29436315 GATGCATTGTGTCCTGCCCTAGG + Intergenic
906174948 1:43762980-43763002 CATGTATGTGCCCTTGCCCTTGG + Intronic
906503949 1:46363384-46363406 GGTGCCTGGGCTTCTGCCCTTGG + Intronic
906844440 1:49176326-49176348 TATGTCTGGGCTCCTTACCTAGG - Intronic
909951820 1:81728928-81728950 GAAGTAGGGGATCCTTCCCTAGG - Intronic
913646888 1:120865521-120865543 GATGTATTGGCTCCTGCGACTGG + Intergenic
914079759 1:144397342-144397364 GATGTATTGGCTCCTGCGACTGG - Intergenic
914174660 1:145265880-145265902 GATGTATTGGCTCCTGCGACTGG - Intergenic
914529387 1:148507368-148507390 GATGTATTGGCTCCTGCGACTGG - Intergenic
915001690 1:152600205-152600227 GATAAAAGGGCTCCTACCCTGGG + Intronic
916997634 1:170317631-170317653 GAGGCCTGGGCTCCTGCGCTTGG + Intergenic
917810153 1:178650727-178650749 GATGTCTATGCTCCTGCCATTGG + Intergenic
919958088 1:202438874-202438896 GATGTATGGGCTCCTGCCCTGGG - Intronic
921161975 1:212479284-212479306 GATGGATGGCCGCCTGTCCTGGG - Intergenic
924295668 1:242585127-242585149 CATGTCTGGGCTCCAGCCCATGG + Intergenic
1065457761 10:25925527-25925549 CATGCATGTTCTCCTGCCCTGGG + Intergenic
1067085109 10:43234054-43234076 GAGGTCTGGGGTGCTGCCCTGGG + Intronic
1075159332 10:120009614-120009636 GATTTTTGGGTACCTGCCCTGGG - Intergenic
1076490375 10:130857455-130857477 GGAGCCTGGGCTCCTGCCCTTGG + Intergenic
1079399945 11:20098792-20098814 AATGTATGGGCTCATGGCCTTGG + Intronic
1079401728 11:20111357-20111379 GATGTCTCTGCTGCTGCCCTCGG + Intronic
1083670806 11:64299184-64299206 GATGGAAGGGCTCCTCCACTGGG - Intronic
1084998955 11:73011477-73011499 GAAGTGTGAGCTGCTGCCCTTGG - Intronic
1085045077 11:73347943-73347965 GATGTCTGGGCTCCTGGCCTCGG + Intronic
1085151230 11:74254167-74254189 CATGTCTGGGCACCTGCCCTGGG + Exonic
1085624555 11:78062034-78062056 GCAGAGTGGGCTCCTGCCCTAGG + Intronic
1088754655 11:112875973-112875995 GGTGTGTGGGCTCCACCCCTTGG - Intergenic
1091034431 11:132220580-132220602 GTGGTATGCACTCCTGCCCTTGG - Intronic
1094689191 12:32752010-32752032 GCTGTATGTGCTTCTACCCTGGG + Intronic
1097262179 12:57726152-57726174 TGGGTATGGGCTCCCGCCCTGGG + Intronic
1101344285 12:103871408-103871430 CAGGGATGGGCTCCTGCCCAGGG + Intergenic
1102952026 12:117037480-117037502 GATGTGTTAGCTCCTGCCTTAGG - Intergenic
1107887426 13:44885427-44885449 GATGTATTGGCTCATGCAGTTGG - Intergenic
1112463626 13:99624211-99624233 TATGTTTGGTCTCCTGCACTGGG + Intronic
1113451116 13:110410486-110410508 GATGTATGGGCTTCTGCCACTGG + Intronic
1115357873 14:32468116-32468138 GCTGTCTGGGCTCCTATCCTAGG - Intronic
1122307330 14:100774018-100774040 TGGGTATGGGGTCCTGCCCTAGG + Intergenic
1123981956 15:25612774-25612796 AATGTATGGGCTCCTCACTTTGG + Intergenic
1128357657 15:66939560-66939582 GAGCTCTGGGCTCCTGCACTAGG - Intergenic
1128453968 15:67822660-67822682 GATGACTTGGCTCCTGCCCTGGG + Intronic
1128480824 15:68036467-68036489 GAGGTATGGGCTGCTGCCACCGG + Intergenic
1130222276 15:82029707-82029729 GATGTATGTGCTCCTGCAAAGGG + Intergenic
1131045345 15:89310623-89310645 CATGCATGGGCTCTTGCCCAGGG - Intronic
1132085986 15:98908645-98908667 GATGTTAGCGCACCTGCCCTTGG - Intronic
1132244100 15:100281030-100281052 GATGGAAGAGCACCTGCCCTCGG - Intronic
1133616897 16:7485589-7485611 GAGGTATGGGCTCTTGCCTGGGG - Intronic
1137378661 16:47977169-47977191 GATGCCTGGGCTCCACCCCTAGG + Intergenic
1137900937 16:52268211-52268233 GATGTATGGGCTCAGGGCATAGG - Intergenic
1141606574 16:85157348-85157370 GATTTATGGGCACCTGTCTTGGG - Intergenic
1141627663 16:85269774-85269796 GGTCTCTGGGCTCCTCCCCTGGG + Intergenic
1142177111 16:88650495-88650517 GGGGAATGGGCTCATGCCCTGGG - Intronic
1142893528 17:2960261-2960283 GAAGTTTGCTCTCCTGCCCTCGG + Intronic
1142897626 17:2992133-2992155 GTTGTATGGACTCCTGCCTGAGG - Intronic
1143866040 17:9925004-9925026 TGGGGATGGGCTCCTGCCCTGGG - Intronic
1146684289 17:34830323-34830345 ACTTTCTGGGCTCCTGCCCTAGG - Intergenic
1147449802 17:40497077-40497099 GATGTCTGAGCACCTGCACTTGG + Intronic
1147879176 17:43642981-43643003 GATGTCTGGGCTCCACCCCTAGG - Intronic
1147925378 17:43942470-43942492 GCCGGATGGGCCCCTGCCCTCGG + Intergenic
1149796386 17:59524393-59524415 GAGGTATGGACCCCTTCCCTCGG - Intergenic
1152081916 17:78192858-78192880 GATGCCTGGGCTCCTGGGCTTGG + Intronic
1153636186 18:7116070-7116092 CATTAAAGGGCTCCTGCCCTGGG + Intronic
1153687690 18:7562899-7562921 GCAGGATGGGCTCCTGCCCTGGG + Intergenic
1156356068 18:36341269-36341291 GATGTTTGGGCTTCTGCTTTTGG + Intronic
1159326299 18:66923979-66924001 GATGTATGGTATCCTGCCCCGGG - Intergenic
1162431979 19:10634583-10634605 GATGTGTGGGATCCAGCCATGGG + Intronic
1166687932 19:44807342-44807364 GAGCTAAGGGCTCCTCCCCTGGG - Intergenic
926479813 2:13377858-13377880 GATGCATGGGTTCCTGAGCTGGG + Intergenic
931894367 2:66712844-66712866 GATGTAGGGGCTCCTGAACCTGG + Intergenic
932281019 2:70491840-70491862 GATGTGTGGAGTGCTGCCCTGGG - Intronic
935602462 2:104936937-104936959 GGTGTATGGGCTGCGGCCCTAGG - Intergenic
937084228 2:119159871-119159893 GATGCATGGGCACATTCCCTTGG + Intergenic
937997070 2:127702077-127702099 GCTGGTTGGGCTGCTGCCCTGGG + Exonic
939240864 2:139558560-139558582 GATGTCTGGGCTGCTGTCTTTGG + Intergenic
941110619 2:161416162-161416184 GATGAAACGGCTCCTGCCATTGG - Exonic
946813233 2:223549460-223549482 GTTGGCTGGGCTCCTGCCCTGGG - Intergenic
948342863 2:237269191-237269213 GATCCATGAGCTCCTGCCTTTGG - Intergenic
1171460508 20:25295511-25295533 GGTGCCTGGCCTCCTGCCCTGGG + Intronic
1175495134 20:59409118-59409140 GATGCATGGTCTCCTCACCTTGG + Intergenic
1175692271 20:61074031-61074053 GGTGTGTGGGCTCCAGACCTGGG - Intergenic
1175728777 20:61337881-61337903 GATGTGTGAGTTTCTGCCCTGGG + Intronic
1175899072 20:62352952-62352974 GATTTATTGGCTCCTGTCCCTGG - Intronic
1176182306 20:63756138-63756160 GCTGCATGGCCACCTGCCCTTGG + Intronic
1181666562 22:24402294-24402316 GATGAATGGGCACCTGCCTGGGG - Intronic
1183631285 22:39034431-39034453 GCTGTGTGGGCACCTGGCCTGGG - Intergenic
1183738350 22:39656294-39656316 GATGGAGGGGCTCCTGCTCTCGG + Intronic
949942899 3:9168297-9168319 GATGGTTGGGCTCCTGCCACTGG - Intronic
953979247 3:47405519-47405541 GATGGAAGGGCTCCTGTCCAAGG - Intronic
954298914 3:49688963-49688985 GAGGTCTGGGCTCCAGCCCCTGG + Exonic
954613396 3:51957829-51957851 GAGGTAGGGCCCCCTGCCCTGGG + Exonic
960284211 3:115809307-115809329 GGAATATGGGGTCCTGCCCTTGG + Exonic
971491503 4:27217024-27217046 GAGATACGGACTCCTGCCCTTGG - Intergenic
983735063 4:171046839-171046861 GCTGTAGTGGCTTCTGCCCTGGG + Intergenic
985553315 5:543990-544012 GATGGATGGGCTCCCACCCACGG - Intergenic
986735211 5:10663057-10663079 GAGGTCCGGGCTGCTGCCCTGGG - Intergenic
988468136 5:31510733-31510755 GGGGCATGGGCTCCTGCTCTCGG + Intronic
988957433 5:36333285-36333307 GATGTCTGGGCCCCAACCCTAGG + Intergenic
989977744 5:50607198-50607220 GATGTATTGGCTCCTGCGACTGG + Intergenic
999519605 5:152337679-152337701 GATGTGTGGCCTCTTGACCTTGG + Intergenic
999776117 5:154814266-154814288 GATGTAGAGGCTCCTGCCCAGGG - Exonic
1003152267 6:3562928-3562950 GCTGTGCAGGCTCCTGCCCTGGG - Intergenic
1005979628 6:30827126-30827148 GCAGTCGGGGCTCCTGCCCTGGG + Intergenic
1006163682 6:32052485-32052507 AATGCATGGTCTCTTGCCCTAGG + Intronic
1006843936 6:37050004-37050026 GAAGTATGGCCTGCTACCCTTGG - Intergenic
1007738414 6:43996302-43996324 AATGACTGGGCTCCTGCTCTGGG + Intergenic
1011742552 6:90376883-90376905 CATGTATGAGCTCCAGACCTTGG + Intergenic
1014101952 6:117520674-117520696 GAAGCACGGGCTCCTGTCCTGGG + Intronic
1015691024 6:135922976-135922998 GATGTTTGGGCTTCTGCCAGTGG + Intronic
1016462875 6:144296473-144296495 GATGTATTGGTCCCTGCTCTTGG - Intronic
1019194270 6:170272175-170272197 GCTGTGTGGGCTCCAGCCCCAGG + Intergenic
1019257824 7:63050-63072 GATGCATGGTCTCCTGGCCTCGG - Intergenic
1021028742 7:15702606-15702628 TATGTATTGTCTCCTGCGCTTGG + Intergenic
1022453105 7:30534072-30534094 TATGTGTGGGCTTCTGCCCAAGG - Intronic
1022886076 7:34645266-34645288 GCTGCATGGGCACCGGCCCTCGG - Intergenic
1025993195 7:66511591-66511613 GATGCCTGGGCACCTGCCATCGG + Intergenic
1026983472 7:74539913-74539935 GATGCCTGGGCACCTGCCATCGG + Exonic
1028628589 7:92906300-92906322 GATGTATAGGCTTCTGCTCCTGG - Intergenic
1028852963 7:95557234-95557256 GAAGTATGGGCTCCTGTGCAAGG + Intergenic
1029544575 7:101203453-101203475 GATCTGCGGGCTCCAGCCCTGGG + Intergenic
1029695508 7:102210615-102210637 GAAGGATGGTCCCCTGCCCTTGG + Intronic
1032984754 7:137325526-137325548 GTTGAAAGGGCCCCTGCCCTGGG - Intronic
1040434460 8:47376591-47376613 GATGTATGGGATCCTGCCACTGG - Intronic
1041022971 8:53657195-53657217 CCTGTGGGGGCTCCTGCCCTCGG + Intergenic
1042382934 8:68139597-68139619 GATCACTGGGCTTCTGCCCTTGG - Intronic
1043254097 8:78111064-78111086 GTTGTATGGTCTCCTACCGTGGG - Intergenic
1044629282 8:94263081-94263103 GCTGTATTGGCTCATGCCCAAGG - Intergenic
1044740184 8:95318467-95318489 CATCTATCGTCTCCTGCCCTTGG + Intergenic
1047686498 8:127309996-127310018 GATTTAGGCGCTCCTGCTCTAGG + Intergenic
1051111857 9:13648586-13648608 GATGGAGGGTTTCCTGCCCTAGG + Intergenic
1056447594 9:86680904-86680926 GGTGCAAGGGCTCCTGCCCATGG - Intergenic
1056812873 9:89777816-89777838 GATGCATGGGCCCCACCCCTGGG + Intergenic
1059698170 9:116748448-116748470 GGGATATGGGCTTCTGCCCTTGG - Intronic
1060606277 9:124917416-124917438 GATTTATGGGCTTCTGGCTTGGG - Intronic
1062425114 9:136502504-136502526 GATGTCCGGGCACCTGCCCCTGG - Intronic
1062455833 9:136637957-136637979 GCTGTATGGACTCATGCCCCAGG + Intergenic
1188739804 X:33764187-33764209 GAGGTGTGGGCTACTGCACTTGG - Intergenic
1193764048 X:85504177-85504199 GAAATATGAGCTCCTGCGCTTGG + Intergenic
1195730899 X:107965915-107965937 GTAGTAAGTGCTCCTGCCCTTGG - Intergenic