ID: 919958089

View in Genome Browser
Species Human (GRCh38)
Location 1:202438875-202438897
Sequence GGATGTATGGGCTCCTGCCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 133
Summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 119}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
919958089_919958103 29 Left 919958089 1:202438875-202438897 CCAGGGCAGGAGCCCATACATCC 0: 1
1: 0
2: 1
3: 12
4: 119
Right 919958103 1:202438927-202438949 CCCCGAAGACGGCCGTGGACTGG 0: 1
1: 0
2: 1
3: 4
4: 36
919958089_919958096 3 Left 919958089 1:202438875-202438897 CCAGGGCAGGAGCCCATACATCC 0: 1
1: 0
2: 1
3: 12
4: 119
Right 919958096 1:202438901-202438923 GCACGCGGCCCTGTGCCTGGAGG 0: 2
1: 0
2: 2
3: 17
4: 234
919958089_919958094 0 Left 919958089 1:202438875-202438897 CCAGGGCAGGAGCCCATACATCC 0: 1
1: 0
2: 1
3: 12
4: 119
Right 919958094 1:202438898-202438920 ACCGCACGCGGCCCTGTGCCTGG 0: 1
1: 1
2: 0
3: 12
4: 168
919958089_919958100 18 Left 919958089 1:202438875-202438897 CCAGGGCAGGAGCCCATACATCC 0: 1
1: 0
2: 1
3: 12
4: 119
Right 919958100 1:202438916-202438938 CCTGGAGGTGACCCCGAAGACGG 0: 1
1: 1
2: 0
3: 18
4: 153
919958089_919958101 24 Left 919958089 1:202438875-202438897 CCAGGGCAGGAGCCCATACATCC 0: 1
1: 0
2: 1
3: 12
4: 119
Right 919958101 1:202438922-202438944 GGTGACCCCGAAGACGGCCGTGG 0: 1
1: 0
2: 1
3: 0
4: 43

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
919958089 Original CRISPR GGATGTATGGGCTCCTGCCC TGG (reversed) Intronic
900574232 1:3375112-3375134 GGTTGTCTGGGGTCCTGCCTCGG - Intronic
900759831 1:4463235-4463257 GGATATTTGGTCTCCAGCCCTGG - Intergenic
903372388 1:22844951-22844973 GGATTTGTGTGCTCCTGGCCAGG + Intronic
906455665 1:45994727-45994749 GGATTTACAGGCTCCTTCCCAGG + Intronic
910759784 1:90723001-90723023 GGCTGTATATGCTGCTGCCCAGG - Intergenic
915001689 1:152600204-152600226 GGATAAAAGGGCTCCTACCCTGG + Intronic
919958089 1:202438875-202438897 GGATGTATGGGCTCCTGCCCTGG - Intronic
1067434967 10:46270264-46270286 GGATGTGGGGTCCCCTGCCCAGG - Intergenic
1070160298 10:73862792-73862814 GGATGTGAAGGCCCCTGCCCGGG - Intronic
1072351997 10:94566113-94566135 GAATTTTTGGGCTCCTGCCTCGG + Intronic
1075093297 10:119455179-119455201 GGATGGACGGCCTCCTTCCCCGG - Exonic
1076656753 10:132029323-132029345 GGAAGAATGGGCTCCAGGCCGGG - Intergenic
1076735454 10:132457044-132457066 TGCTGCATGGGCTCCTGCCGGGG - Intergenic
1076758655 10:132589098-132589120 GGGTGTGGGGGCTGCTGCCCAGG + Intronic
1079922272 11:26447749-26447771 GGATATATGGGATGCTGCTCTGG - Intronic
1081604724 11:44520227-44520249 AGATGGATGGGCTGCTGCCGAGG + Intergenic
1083670807 11:64299185-64299207 GGATGGAAGGGCTCCTCCACTGG - Intronic
1083738953 11:64697630-64697652 GGATGTCTGGGGTCCTCCCTTGG - Intronic
1084774152 11:71364512-71364534 GGATGGATGGGCTTCAGGCCTGG + Intergenic
1084777917 11:71389395-71389417 GGAGGGACGGGCTCCTGCCCCGG - Intergenic
1085151229 11:74254166-74254188 ACATGTCTGGGCACCTGCCCTGG + Exonic
1086160120 11:83712602-83712624 GGATTTATGTTCTCTTGCCCAGG - Intronic
1089253294 11:117180148-117180170 GGCTGTGTGGTCTCGTGCCCGGG + Intronic
1090437757 11:126700993-126701015 GGATGAATGGGCTACTGGGCTGG - Intronic
1091305970 11:134536261-134536283 GGATGAATGCTCTCCTGTCCTGG - Intergenic
1095335743 12:41023502-41023524 GGAACTTTGGGCTCTTGCCCAGG + Intronic
1100192027 12:92203145-92203167 GGATGGATGGGCTGAGGCCCCGG - Intergenic
1100579306 12:95923383-95923405 GGATGTCTGGGGTCCAGCCCTGG - Intronic
1101344284 12:103871407-103871429 GCAGGGATGGGCTCCTGCCCAGG + Intergenic
1102595761 12:113991418-113991440 GGCTGGTTGGGCTCCTGCTCAGG + Intergenic
1102882623 12:116497419-116497441 GGATCTCTGGGTTCTTGCCCAGG + Intergenic
1104661121 12:130612085-130612107 TGATGTCTGAGCACCTGCCCTGG - Intronic
1106215095 13:27690255-27690277 GTATGTCTTGGCTCCTGCCTTGG - Intergenic
1108533508 13:51348390-51348412 GGATGGATGTGTTCCTGCCCAGG + Exonic
1112638831 13:101248413-101248435 GGATGTAGAGGCTACTTCCCAGG - Intronic
1115877240 14:37874610-37874632 AGATCTTTGGTCTCCTGCCCGGG + Intronic
1119601231 14:75978676-75978698 GCATCTATGGGGCCCTGCCCGGG + Intronic
1123062233 14:105599561-105599583 GGGTGCAGGGGCTCCTGTCCAGG + Intergenic
1123086977 14:105721289-105721311 GGGTGCAGGGGCTCCTGTCCAGG + Intergenic
1123910968 15:24966685-24966707 GGATGTATAGGTTACTTCCCAGG + Intronic
1128453967 15:67822659-67822681 CGATGACTTGGCTCCTGCCCTGG + Intronic
1129262816 15:74378293-74378315 GGATGGCTGGGTTCCAGCCCAGG + Intergenic
1130024555 15:80260259-80260281 GGATGGATGGGCCCCTGCCTTGG + Intergenic
1130222275 15:82029706-82029728 TGATGTATGTGCTCCTGCAAAGG + Intergenic
1131045346 15:89310624-89310646 CCATGCATGGGCTCTTGCCCAGG - Intronic
1132679443 16:1133741-1133763 GGAGGTAAGGACACCTGCCCAGG + Intergenic
1133616898 16:7485590-7485612 TGAGGTATGGGCTCTTGCCTGGG - Intronic
1141627662 16:85269773-85269795 GGGTCTCTGGGCTCCTCCCCTGG + Intergenic
1143000934 17:3794679-3794701 GGGAGTCTGGGCTCCGGCCCCGG + Intronic
1143768420 17:9152447-9152469 GGAGGTATGGGAGCCTTCCCAGG - Intronic
1146054963 17:29576386-29576408 GGAGGTGTGGGCACCGGCCCTGG + Exonic
1148909828 17:50935441-50935463 GGAGGTCTGGGCACGTGCCCTGG + Intergenic
1149304664 17:55335991-55336013 GGATGTCTGGGGTCCTGTCTGGG - Intergenic
1152962700 18:89275-89297 GGGTGTGTGTGCACCTGCCCTGG - Intergenic
1153687689 18:7562898-7562920 GGCAGGATGGGCTCCTGCCCTGG + Intergenic
1155070828 18:22314534-22314556 GGATGTATGTGCTCCAAGCCTGG - Intergenic
1159326300 18:66923980-66924002 TGATGTATGGTATCCTGCCCCGG - Intergenic
1161373683 19:3927931-3927953 GGAAGGATGGGCTGCTGACCAGG - Exonic
1161997091 19:7719870-7719892 GGCTCTCTGGGCTCCTGACCTGG + Intergenic
1162431978 19:10634582-10634604 GGATGTGTGGGATCCAGCCATGG + Intronic
1164907781 19:31981668-31981690 GGATGTGTGGGTCACTGCCCAGG - Intergenic
1166785585 19:45364852-45364874 GGAAGTATGGGCACCAGCCCTGG + Exonic
1167278365 19:48552336-48552358 GGATCTCCTGGCTCCTGCCCAGG - Intronic
1168452906 19:56479771-56479793 GGATGTCTTGGCTCCTGATCAGG + Intergenic
925996518 2:9298089-9298111 GGCTGTTTGGGACCCTGCCCGGG + Intronic
927945596 2:27133400-27133422 AGTTGTATGGGCACCTGCCATGG - Intronic
937829921 2:126408480-126408502 GGATGTGTGGTTTCCAGCCCTGG + Intergenic
938137494 2:128770942-128770964 GGATTCAGGGGCTCCTGCTCAGG + Intergenic
938324792 2:130391188-130391210 GAAAGTATGGGCTCCTCCACGGG - Intergenic
940732971 2:157415767-157415789 GCATGTTTGGGACCCTGCCCCGG - Exonic
941234792 2:162957767-162957789 GGATGTATTACCTCCTGCCCAGG - Intergenic
941362221 2:164565099-164565121 GGATGTAAGGCCTTCTGACCTGG + Intronic
943364505 2:186956621-186956643 GGATGTGATAGCTCCTGCCCAGG - Intergenic
946813234 2:223549461-223549483 GGTTGGCTGGGCTCCTGCCCTGG - Intergenic
947632494 2:231663167-231663189 TGATTTTTTGGCTCCTGCCCTGG + Intergenic
948822085 2:240555166-240555188 GGATGCAGCGGCACCTGCCCCGG - Intronic
1172310636 20:33915743-33915765 GGATGTGTGGGGTCTTGTCCTGG + Intergenic
1174123173 20:48282765-48282787 GAATCTATGGCCTCCTGCCAAGG + Intergenic
1175259700 20:57666752-57666774 GGAGTTATGGGCACCTGCCATGG + Intronic
1176247149 20:64102673-64102695 GGCTGTAGGGGCTCTTGCCTGGG + Intergenic
1180982493 22:19885410-19885432 GTATGTTTTGACTCCTGCCCCGG - Intronic
1181557190 22:23677936-23677958 GGATGCAGGGGCAGCTGCCCAGG - Intergenic
1181666563 22:24402295-24402317 TGATGAATGGGCACCTGCCTGGG - Intronic
1183608849 22:38883918-38883940 AGCTGTGTGGACTCCTGCCCTGG + Intergenic
1183934609 22:41255123-41255145 GGATGTGGGCGCCCCTGCCCTGG - Intronic
1183984764 22:41563301-41563323 GGAAGTGTCAGCTCCTGCCCGGG + Intronic
950171779 3:10843856-10843878 GGATGTATGGGCTCCCTTCAGGG + Intronic
950604330 3:14064881-14064903 GGCTCTGTGGCCTCCTGCCCAGG - Exonic
952188569 3:30997618-30997640 GGAGCCATGGGCTCCTGCCTAGG - Intergenic
954362288 3:50128452-50128474 GGAGGTAGGGGCTCCTCCCTGGG - Intergenic
954613395 3:51957828-51957850 GGAGGTAGGGCCCCCTGCCCTGG + Exonic
954783678 3:53078032-53078054 GGATGGAAGGGAGCCTGCCCAGG - Intronic
954886713 3:53881703-53881725 GGTTGTGTGCGCTCCTGCCCGGG - Intronic
963864206 3:150342827-150342849 GGAAGTAGGTGCTCCAGCCCTGG - Intergenic
964422324 3:156516516-156516538 GGAGGTCTTGGCTCCTGGCCAGG + Intronic
964751254 3:160055972-160055994 GGATGTGATAGCTCCTGCCCAGG - Intergenic
965408058 3:168295098-168295120 GGATGTGTGTGCTTCTGACCTGG + Intergenic
969286830 4:6207811-6207833 GGCTGTCTGGGCTCTAGCCCTGG - Intergenic
973779975 4:54279244-54279266 GGATGTGCGGGCTCCTGCTAAGG + Intronic
977277196 4:94992359-94992381 AGATGTATAGGCCCATGCCCAGG - Intronic
983735062 4:171046838-171046860 GGCTGTAGTGGCTTCTGCCCTGG + Intergenic
991363350 5:65843554-65843576 GGCAGGATGGGCTTCTGCCCGGG - Intronic
994632769 5:102306614-102306636 GGGGGTATGGGATCCTGTCCAGG - Intergenic
998364120 5:141618179-141618201 ACAGGAATGGGCTCCTGCCCAGG - Intronic
999776118 5:154814267-154814289 GGATGTAGAGGCTCCTGCCCAGG - Exonic
1001323026 5:170698442-170698464 GGATGTAAGGTCATCTGCCCAGG - Intronic
1002203255 5:177543968-177543990 GGAACAATGGGCTGCTGCCCAGG - Intronic
1002324719 5:178396861-178396883 GGCGCTCTGGGCTCCTGCCCAGG + Intronic
1005471248 6:26164508-26164530 GGATGTTGAGGCTCCTGTCCAGG - Intronic
1005979627 6:30827125-30827147 GGCAGTCGGGGCTCCTGCCCTGG + Intergenic
1006753887 6:36397775-36397797 GGATTCCTGGGCTCCTGCCTTGG - Intronic
1006840558 6:37025725-37025747 GGAGGGCTGGGCTCCTGCCTTGG - Intronic
1013009277 6:106105310-106105332 GAAGGTTTGGGCTCCTACCCTGG + Exonic
1016122457 6:140360598-140360620 GGCTGTATGGGCTACTTGCCAGG - Intergenic
1019331528 7:462966-462988 GGAGGTGGGGGCTCCGGCCCAGG - Intergenic
1021645193 7:22782758-22782780 AGAGGTATGAGCTCCTGTCCTGG - Intergenic
1022180532 7:27914575-27914597 GGATGTGAGGGCTACTTCCCTGG - Intronic
1023760706 7:43462714-43462736 GGATGTGTGGGCACCTGGCAGGG - Intronic
1032278042 7:130476870-130476892 CAAAGTATGGGATCCTGCCCTGG - Intergenic
1033363444 7:140654029-140654051 GGTTGGCTTGGCTCCTGCCCCGG + Intronic
1035289206 7:157826848-157826870 GGATATATGGGCGCCTTTCCTGG - Intronic
1035422663 7:158742330-158742352 GGATGGAGGAGCTTCTGCCCAGG - Intronic
1037172628 8:15911472-15911494 GGATGTTTGGACACCTGGCCGGG + Intergenic
1037889260 8:22614879-22614901 GGGTGAATGGTCTCCTTCCCTGG + Exonic
1043317736 8:78942136-78942158 TGATGGATGGGGTCCTGCCCGGG + Intergenic
1055711897 9:79072682-79072704 GGATGTATGGGCTCTTGTGTGGG - Intergenic
1057549474 9:96041335-96041357 CCATGTCTGAGCTCCTGCCCCGG - Intergenic
1059155234 9:111983538-111983560 GGCTGAAAGGCCTCCTGCCCAGG + Intergenic
1059574163 9:115472594-115472616 GGAGGTTTGGGTTCTTGCCCTGG - Intergenic
1060052286 9:120385964-120385986 GGGTCTCTGGGCTCCTGCTCTGG + Intergenic
1061158471 9:128879640-128879662 GGAGAGATGGGCTCCTACCCTGG - Intronic
1061485724 9:130919629-130919651 GGATGTGGGGGCTCCTTTCCAGG + Intronic
1192223098 X:69210682-69210704 GGAAGAAGGGGCACCTGCCCTGG - Intergenic