ID: 919958091

View in Genome Browser
Species Human (GRCh38)
Location 1:202438887-202438909
Sequence GCCGCGTGCGGTGGATGTAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 17
Summary {0: 1, 1: 0, 2: 0, 3: 0, 4: 16}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
919958091_919958100 6 Left 919958091 1:202438887-202438909 CCCATACATCCACCGCACGCGGC 0: 1
1: 0
2: 0
3: 0
4: 16
Right 919958100 1:202438916-202438938 CCTGGAGGTGACCCCGAAGACGG 0: 1
1: 1
2: 0
3: 18
4: 153
919958091_919958103 17 Left 919958091 1:202438887-202438909 CCCATACATCCACCGCACGCGGC 0: 1
1: 0
2: 0
3: 0
4: 16
Right 919958103 1:202438927-202438949 CCCCGAAGACGGCCGTGGACTGG 0: 1
1: 0
2: 1
3: 4
4: 36
919958091_919958106 27 Left 919958091 1:202438887-202438909 CCCATACATCCACCGCACGCGGC 0: 1
1: 0
2: 0
3: 0
4: 16
Right 919958106 1:202438937-202438959 GGCCGTGGACTGGCCTGACCTGG 0: 1
1: 0
2: 2
3: 18
4: 138
919958091_919958096 -9 Left 919958091 1:202438887-202438909 CCCATACATCCACCGCACGCGGC 0: 1
1: 0
2: 0
3: 0
4: 16
Right 919958096 1:202438901-202438923 GCACGCGGCCCTGTGCCTGGAGG 0: 2
1: 0
2: 2
3: 17
4: 234
919958091_919958101 12 Left 919958091 1:202438887-202438909 CCCATACATCCACCGCACGCGGC 0: 1
1: 0
2: 0
3: 0
4: 16
Right 919958101 1:202438922-202438944 GGTGACCCCGAAGACGGCCGTGG 0: 1
1: 0
2: 1
3: 0
4: 43

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
919958091 Original CRISPR GCCGCGTGCGGTGGATGTAT GGG (reversed) Intronic
906530474 1:46520904-46520926 GCCCCTTGGGGTGGATGTGTGGG - Intergenic
919958091 1:202438887-202438909 GCCGCGTGCGGTGGATGTATGGG - Intronic
924476189 1:244383794-244383816 GCAGGGTGCGGTGGAGGGATGGG + Intronic
1091785778 12:3242625-3242647 GCTGCGTGTGGAGGATGTAATGG + Intronic
1132957702 16:2604244-2604266 GCTGCGTGCTGTGGATGGAAAGG - Intergenic
1132970164 16:2683320-2683342 GCTGCGTGCTGTGGATGGAAAGG - Intronic
1139538901 16:67599094-67599116 GCCGGGTGCGGTGGCTGAAGCGG + Intronic
1161292310 19:3501229-3501251 GCCAAGGGCGGTGTATGTATAGG + Intergenic
1163819705 19:19489177-19489199 GCTGTGTGCGGTGTATGTAGAGG + Intronic
1165115345 19:33524939-33524961 GCCCCGTGCAGTGGCTTTATTGG - Intergenic
1166302042 19:41916746-41916768 GCCGTGTGCGTTGGCTGTCTGGG - Intronic
932435068 2:71698503-71698525 CCTGCATGCGGTGGATGCATGGG - Intergenic
933696631 2:85223525-85223547 GCTGCTGGAGGTGGATGTATGGG + Intronic
943031984 2:182696491-182696513 GCAGAGTGCGGAGGATGTTTAGG + Intergenic
955972055 3:64445626-64445648 GCCGGGTGCGGGGGAGGGATGGG - Intergenic
1019535014 7:1524193-1524215 GCCTCGTGGGGTGGTTGTGTGGG - Intergenic
1035289210 7:157826860-157826882 GCCCCGTGCGCAGGATATATGGG - Intronic