ID: 919958092

View in Genome Browser
Species Human (GRCh38)
Location 1:202438888-202438910
Sequence GGCCGCGTGCGGTGGATGTA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 31
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 28}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
919958092_919958106 26 Left 919958092 1:202438888-202438910 CCATACATCCACCGCACGCGGCC 0: 1
1: 0
2: 0
3: 2
4: 28
Right 919958106 1:202438937-202438959 GGCCGTGGACTGGCCTGACCTGG 0: 1
1: 0
2: 2
3: 18
4: 138
919958092_919958100 5 Left 919958092 1:202438888-202438910 CCATACATCCACCGCACGCGGCC 0: 1
1: 0
2: 0
3: 2
4: 28
Right 919958100 1:202438916-202438938 CCTGGAGGTGACCCCGAAGACGG 0: 1
1: 1
2: 0
3: 18
4: 153
919958092_919958103 16 Left 919958092 1:202438888-202438910 CCATACATCCACCGCACGCGGCC 0: 1
1: 0
2: 0
3: 2
4: 28
Right 919958103 1:202438927-202438949 CCCCGAAGACGGCCGTGGACTGG 0: 1
1: 0
2: 1
3: 4
4: 36
919958092_919958101 11 Left 919958092 1:202438888-202438910 CCATACATCCACCGCACGCGGCC 0: 1
1: 0
2: 0
3: 2
4: 28
Right 919958101 1:202438922-202438944 GGTGACCCCGAAGACGGCCGTGG 0: 1
1: 0
2: 1
3: 0
4: 43
919958092_919958096 -10 Left 919958092 1:202438888-202438910 CCATACATCCACCGCACGCGGCC 0: 1
1: 0
2: 0
3: 2
4: 28
Right 919958096 1:202438901-202438923 GCACGCGGCCCTGTGCCTGGAGG 0: 2
1: 0
2: 2
3: 17
4: 234

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
919958092 Original CRISPR GGCCGCGTGCGGTGGATGTA TGG (reversed) Intronic
900232456 1:1567353-1567375 GGCCGTGTGTGGTAGATGTTTGG - Intronic
919958092 1:202438888-202438910 GGCCGCGTGCGGTGGATGTATGG - Intronic
1080686839 11:34523064-34523086 GGGAGAGTGTGGTGGATGTAGGG - Intergenic
1096255180 12:50058136-50058158 GGCTGCCCGAGGTGGATGTATGG - Intronic
1104415492 12:128594097-128594119 GGACGCCTGCGGTGGAGGTGGGG - Intronic
1104888183 12:132124378-132124400 GGCCGGATGGGGTGGATGGATGG - Intronic
1123119348 14:105909605-105909627 GGCTGCGTGGGGTTGATGTTGGG + Intergenic
1128652905 15:69432595-69432617 GGCTGTGTGCCATGGATGTAGGG + Intronic
1131159891 15:90098809-90098831 GGCCGCGTGCGGTGGCTCCCAGG - Intronic
1133187849 16:4113445-4113467 GGGCACGTCCGGTGAATGTAAGG - Intronic
1144943965 17:18960384-18960406 GGCCGGGTGCTGGGGCTGTAAGG + Intronic
1153636374 18:7117232-7117254 GGCCGGGCGCGGGGGATGAATGG - Intronic
1160829230 19:1095209-1095231 GGGCGCGGGCGGCGGGTGTAGGG - Intronic
1161280342 19:3442203-3442225 GGCTGCGTGGGGTGGAGGGAAGG + Intronic
1166302043 19:41916747-41916769 GGCCGTGTGCGTTGGCTGTCTGG - Intronic
1167159816 19:47759981-47760003 GGCGGCGGGGGGTGGATGTGTGG + Intergenic
1173572712 20:44087835-44087857 GGCTGCGTGAGGTGGCTGAACGG - Intergenic
1174382245 20:50163569-50163591 GGCCGGGTGCGGTGGCTCTCAGG - Intergenic
1174400506 20:50273452-50273474 GGCCCCGAGCCCTGGATGTATGG - Intergenic
1177198222 21:17925107-17925129 GGCCGTGTGGGGTGGAAGAAAGG + Intronic
1179822274 21:43943749-43943771 GGCCGCGTGCTGTTGGTGTAGGG + Intronic
1179998376 21:44984373-44984395 GGCTGTGTGGGGGGGATGTATGG - Intergenic
965040545 3:163500819-163500841 GGCCGGGTGCGGTGGCTCTAAGG - Intergenic
965769061 3:172161851-172161873 GGCCTAGTGCTGGGGATGTAGGG - Intronic
984778667 4:183505131-183505153 GGCCGCGGCCGGTGCATGTGCGG + Exonic
1019690839 7:2410731-2410753 TGCTGGGTGCGGTGGATGAACGG + Intronic
1024832603 7:53479015-53479037 GGCCGTGTGCGGTGGGTGAGGGG - Intergenic
1035336002 7:158127331-158127353 GGCCACGTGCAGAGGATGCAGGG - Intronic
1035355206 7:158272563-158272585 GGCCGCGTGCGGTGTCTTTGAGG - Intronic
1036707279 8:11055229-11055251 AGCAGCGTGGGGTGGATGAAAGG + Intronic
1202630200 M:10184-10206 GGACGCGGGCGGGGGATATAGGG - Intergenic