ID: 919958093

View in Genome Browser
Species Human (GRCh38)
Location 1:202438896-202438918
Sequence AGGCACAGGGCCGCGTGCGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 806
Summary {0: 2, 1: 0, 2: 9, 3: 69, 4: 726}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
919958093_919958103 8 Left 919958093 1:202438896-202438918 CCACCGCACGCGGCCCTGTGCCT 0: 2
1: 0
2: 9
3: 69
4: 726
Right 919958103 1:202438927-202438949 CCCCGAAGACGGCCGTGGACTGG 0: 1
1: 0
2: 1
3: 4
4: 36
919958093_919958101 3 Left 919958093 1:202438896-202438918 CCACCGCACGCGGCCCTGTGCCT 0: 2
1: 0
2: 9
3: 69
4: 726
Right 919958101 1:202438922-202438944 GGTGACCCCGAAGACGGCCGTGG 0: 1
1: 0
2: 1
3: 0
4: 43
919958093_919958100 -3 Left 919958093 1:202438896-202438918 CCACCGCACGCGGCCCTGTGCCT 0: 2
1: 0
2: 9
3: 69
4: 726
Right 919958100 1:202438916-202438938 CCTGGAGGTGACCCCGAAGACGG 0: 1
1: 1
2: 0
3: 18
4: 153
919958093_919958106 18 Left 919958093 1:202438896-202438918 CCACCGCACGCGGCCCTGTGCCT 0: 2
1: 0
2: 9
3: 69
4: 726
Right 919958106 1:202438937-202438959 GGCCGTGGACTGGCCTGACCTGG 0: 1
1: 0
2: 2
3: 18
4: 138

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
919958093 Original CRISPR AGGCACAGGGCCGCGTGCGG TGG (reversed) Intronic
900037774 1:431859-431881 ATGCACAGGGCTGGGTGCAGTGG + Intergenic
900059406 1:667601-667623 ATGCACAGGGCTGGGTGCAGTGG + Intergenic
900121857 1:1051653-1051675 TGGCACAGGGCAGGGGGCGGAGG + Intronic
901208043 1:7508571-7508593 AGGCACAGTGCTGGGTGCTGGGG - Intronic
901250701 1:7777096-7777118 AGGAACAGGGCCAGGTGCGGTGG - Intronic
901377624 1:8850776-8850798 GGGCAAAGGGCTGGGTGCGGTGG + Intergenic
901455713 1:9361696-9361718 AGGCACAAGGCCTTGTGCTGAGG + Intronic
901516725 1:9752576-9752598 AGACTCAGGGCCGGGTGTGGTGG + Intronic
901641355 1:10694635-10694657 CGGCACCGGGCGGCGGGCGGCGG - Intronic
901646410 1:10719203-10719225 GGGCACGGGGCCGGGTGCGGTGG - Intronic
901722452 1:11210420-11210442 AGGCAGAGGGCTGGGTGCGGTGG - Intronic
902032722 1:13434500-13434522 CGGATAAGGGCCGCGTGCGGTGG - Intergenic
902033048 1:13436648-13436670 AGGGAAGGGGCCGGGTGCGGTGG + Intergenic
902426110 1:16323507-16323529 AGGGACAGGGCCGGGCGCAGTGG + Intronic
902954987 1:19919465-19919487 AGTCACAGGGCCGGGCACGGTGG + Intergenic
903416231 1:23185107-23185129 AGGCAGGAGGCCGAGTGCGGTGG + Intergenic
903698832 1:25231091-25231113 AGATACTGGGCCGGGTGCGGTGG - Intronic
904180136 1:28660459-28660481 CGACACAGGGCAGGGTGCGGTGG + Intergenic
904683241 1:32243137-32243159 AGGAATAGGGCTGGGTGCGGTGG + Intergenic
904754532 1:32760874-32760896 ACCCACATGGCCGGGTGCGGTGG - Intronic
905243016 1:36593438-36593460 AAGGACAGGGCCAGGTGCGGTGG + Intergenic
905581863 1:39088374-39088396 ATGTACAGGGCCGGGTGCGGTGG - Intronic
905770256 1:40633192-40633214 AGGCAGAGGGACGCGTGAGGGGG + Intronic
905803814 1:40862009-40862031 AGGCCCGGGCCCGCGTACGGCGG + Exonic
906021146 1:42630667-42630689 ATACACAGGGCCAGGTGCGGTGG - Intronic
906095210 1:43218311-43218333 AGACACTAGGCCGGGTGCGGTGG + Intronic
906451082 1:45948418-45948440 TGGAACCGGGCCGGGTGCGGTGG + Intronic
906457914 1:46013391-46013413 AGAAACAGGGCCAGGTGCGGTGG + Intronic
907125131 1:52043048-52043070 AGTGAAAGGGCCGGGTGCGGTGG - Intronic
907245905 1:53109077-53109099 AGGCACAGGGCAGAGTGTGTGGG - Intronic
907374677 1:54026180-54026202 AGGCAATGGGCCGGGCGCGGTGG - Intergenic
907590354 1:55660969-55660991 GGGCAAAGGGCCGGGTGCGATGG - Intergenic
907872973 1:58459688-58459710 AGTCACAGGGCCGGGTATGGTGG + Intronic
908588668 1:65604602-65604624 AGGCAGAAGGCCCGGTGCGGTGG - Intronic
908697305 1:66857871-66857893 GGGCAGAAGGCCGGGTGCGGTGG - Intronic
909132073 1:71750278-71750300 AGGAGCAGGGCCGGGCGCGGTGG - Intronic
909587812 1:77310666-77310688 AAGAATAGGGCCGGGTGCGGTGG - Intronic
909601003 1:77461318-77461340 ACATACAGGGCCGGGTGCGGTGG - Intronic
910943886 1:92567097-92567119 AGGCACATGGCCGAGCGTGGTGG - Intronic
911268036 1:95766597-95766619 AGGCACAAGGCTGGGCGCGGTGG + Intergenic
911440485 1:97920703-97920725 AGCCACAGGCCCGCGTGGGCAGG - Intronic
911840279 1:102674055-102674077 AGGCACAGGGCCAGGTGTGGTGG - Intergenic
913677098 1:121151108-121151130 AGTTAAAGGGCCGGGTGCGGTGG + Intergenic
914028933 1:143938736-143938758 AGTTAAAGGGCCGGGTGCGGTGG + Intergenic
914240008 1:145846902-145846924 ACACAAAGGGCCGGGTGCGGTGG + Intronic
914352334 1:146851478-146851500 AAGAACAGGGCTGGGTGCGGTGG - Intergenic
915163549 1:153935632-153935654 GGGCACAGGGCTGGGTGCAGTGG - Intronic
915185705 1:154103383-154103405 AGACACTGGGCCGGGCGCGGTGG + Intronic
917410568 1:174756435-174756457 TGGTACAGGGCAGGGTGCGGTGG - Intronic
917818242 1:178732584-178732606 AGGAACATGGCCGAGTGTGGTGG - Intronic
918551506 1:185747605-185747627 AGTAACAGGGCCGGGTGCGGTGG - Intronic
919644007 1:200074448-200074470 AGAAAAAGGGCCGGGTGCGGTGG + Intronic
919891745 1:201980628-201980650 AGTTACAGGGCCGAGTGCAGTGG - Intergenic
919958093 1:202438896-202438918 AGGCACAGGGCCGCGTGCGGTGG - Intronic
920348803 1:205323870-205323892 AAGCACAGGGCCGAGTGTTGGGG + Intergenic
920387633 1:205579965-205579987 AGGCACAGGGCTGGGAGCTGGGG + Intronic
920464398 1:206169625-206169647 AGTTAAAGGGCCGGGTGCGGTGG + Intergenic
920522562 1:206639164-206639186 GGGGAAAGGGCCGGGTGCGGTGG - Intronic
920559105 1:206926199-206926221 AGTCACATGGCTGGGTGCGGTGG - Intergenic
921057902 1:211558031-211558053 GGGCAAAGGGCCAGGTGCGGTGG + Intergenic
921564407 1:216699022-216699044 AGGCTGAGGGCTGCGTGCTGAGG + Intronic
922674739 1:227543350-227543372 AGGCACAGGGTCGGGTGGAGTGG - Intergenic
922916152 1:229259359-229259381 AGGGAGAGGGCCGGGTGCAGTGG + Intergenic
923086728 1:230708152-230708174 AGGGTCAGGGCAGCATGCGGTGG + Intronic
923171751 1:231422548-231422570 AGGCGCAGGCCCGCGAGCGGCGG + Exonic
923274983 1:232387799-232387821 AGGCATATGGCCGGGCGCGGTGG + Intergenic
923357118 1:233169357-233169379 TGACACAGGGCCGGGCGCGGTGG + Intronic
923483144 1:234403590-234403612 AGGCACAAGGCCAGGTGCTGGGG - Intronic
924037926 1:239955085-239955107 TGGCACAAGGACGCGGGCGGGGG - Intergenic
924086105 1:240453700-240453722 AGGCATAGGGCCGGGCGCGGTGG + Intronic
924248413 1:242107186-242107208 ATGGAGAGGGCCGGGTGCGGTGG + Intronic
924414042 1:243839893-243839915 AGGAAAAGGTCCGGGTGCGGTGG + Intronic
1063357617 10:5415724-5415746 ATGAACAGGGCCAGGTGCGGTGG - Intronic
1063605809 10:7521842-7521864 AAGCTCAGGGCTGGGTGCGGTGG - Intergenic
1064109478 10:12526043-12526065 GGACATAGGGCCGGGTGCGGCGG - Intronic
1064378017 10:14814669-14814691 AGGCTCAGGGCCGGGTGCGGTGG + Intergenic
1064745113 10:18471015-18471037 TTACACAGGGCCGGGTGCGGTGG + Intronic
1064843736 10:19627448-19627470 AATAACAGGGCCACGTGCGGTGG + Intronic
1065154175 10:22852768-22852790 AATCTCAGGGCCGAGTGCGGTGG - Intergenic
1065698262 10:28400483-28400505 AGGAACAGGGCCGGGTGCGGTGG + Intergenic
1066334272 10:34460544-34460566 AGGTACAAGGCCGGGCGCGGGGG + Intronic
1068483810 10:57630435-57630457 TGGCATAGGGCTGGGTGCGGTGG + Intergenic
1070287945 10:75097495-75097517 GTGCACAGGGCCGGGTGCGGTGG - Intronic
1070786680 10:79166144-79166166 AGGGACAGGGAGGCGTGTGGCGG - Intronic
1070812155 10:79303831-79303853 AGTCACAGGGCCGGGTGCCCGGG - Intronic
1070926633 10:80227514-80227536 ATACACATGGCCGGGTGCGGTGG + Intergenic
1070963891 10:80517837-80517859 AGGCAGAGGGCAGGGAGCGGAGG - Intronic
1071547377 10:86538776-86538798 AAGCACATGGCCGGGTGCGGTGG - Intergenic
1071585410 10:86815718-86815740 AGGCACTTGGCCGCGTGGGTGGG - Intronic
1072497093 10:95972599-95972621 AAACACAGGGCCAGGTGCGGTGG - Intronic
1072891964 10:99331577-99331599 AGGTCCAGGGCCGGGCGCGGCGG + Intronic
1072960424 10:99924142-99924164 AGGCTCCAGGCCGGGTGCGGTGG + Intronic
1073155734 10:101345012-101345034 AGGCAAGGGGCCGGGTGCGATGG - Intergenic
1073271234 10:102265948-102265970 AGGTGGAGGGCCGGGTGCGGTGG + Intronic
1073400437 10:103252473-103252495 AGGCAATGGGCTGGGTGCGGTGG - Intergenic
1074336008 10:112576305-112576327 AGGCAGGGGGCCGGGCGCGGTGG - Intronic
1075154007 10:119958974-119958996 ACACACACGGCCGGGTGCGGTGG + Intergenic
1076305978 10:129466301-129466323 AGGCAGAAGGCCGCTTGGGGAGG - Intergenic
1076525051 10:131107213-131107235 ATGCACAGGTCCCCGTGAGGTGG - Intronic
1076964502 11:69783-69805 ATGCACAGGGCTGGGTGCAGTGG + Intergenic
1077034777 11:489340-489362 TGGCACAGGGCAGGGTTCGGTGG + Intronic
1077202830 11:1320557-1320579 AGGAACAGGGCCGGGTGCAGCGG + Intergenic
1077276073 11:1709261-1709283 GAACACAGGGCCGGGTGCGGTGG + Intergenic
1078476656 11:11636027-11636049 AGGGACAGGGACTCGTGAGGAGG - Intergenic
1079899758 11:26167534-26167556 AACCACAAGGCCGGGTGCGGTGG - Intergenic
1079944508 11:26725027-26725049 AAAAACAGGGCCGGGTGCGGTGG - Intergenic
1080464981 11:32488106-32488128 AGACAGAGAGCCGGGTGCGGTGG - Intergenic
1081694352 11:45099163-45099185 AGGCTCTGGGCCGGGTGTGGTGG + Intronic
1082893154 11:58161817-58161839 AACCAGAGGGCCGGGTGCGGTGG - Intronic
1083326439 11:61875518-61875540 TGTCTCAGGGCCGGGTGCGGTGG - Intronic
1083789105 11:64972527-64972549 AGAGACAGGGCCGGGCGCGGTGG + Intergenic
1083960442 11:66012271-66012293 AGGCGCAGAGCCAGGTGCGGCGG + Exonic
1084170473 11:67398512-67398534 GGGCACAGGGTGGTGTGCGGGGG + Exonic
1084387840 11:68855260-68855282 AGGCGCAGGGGCGAGTGGGGAGG + Intergenic
1085099261 11:73786633-73786655 AGATACATGGCCGGGTGCGGTGG - Intergenic
1086360030 11:86049003-86049025 AATCAGAGGGCCGGGTGCGGTGG + Intronic
1087253297 11:95927724-95927746 AGGCAAAGGGCCAGGTGAGGTGG + Intergenic
1087619341 11:100524851-100524873 AAGAACAGAGCAGCGTGCGGAGG + Intergenic
1087967042 11:104428603-104428625 ACACACAGGGCCGGGTGCGGTGG - Intergenic
1088217579 11:107529787-107529809 GGAGACAGGGCCGGGTGCGGTGG - Intronic
1088280762 11:108132565-108132587 TGGCTCTGGGCCGGGTGCGGTGG + Intronic
1088410195 11:109525794-109525816 AACCACAGGGCCGGGCGCGGTGG + Intergenic
1088496815 11:110439492-110439514 GGGCAGAGGGCCGGGTGTGGTGG - Intronic
1088610925 11:111575776-111575798 AGGGACTGGGCCGGGCGCGGTGG - Intergenic
1089204923 11:116752231-116752253 AGAAACGGGGCCGGGTGCGGTGG - Intronic
1090040714 11:123288769-123288791 AAACCCAGGGCCGGGTGCGGTGG - Intergenic
1090611589 11:128475836-128475858 AAGCCCCGGGCCGGGTGCGGTGG - Intronic
1090823618 11:130367297-130367319 TGGAACATGGCCGGGTGCGGTGG + Intergenic
1091346601 11:134858416-134858438 AGTAAAAGGGCCGGGTGCGGTGG - Intergenic
1091438282 12:491766-491788 AGGCAATAGGCCGGGTGCGGTGG + Intronic
1091497309 12:983705-983727 ATGCAGCCGGCCGCGTGCGGTGG - Intronic
1091876211 12:3935523-3935545 AGGCAAAGGGCCGGGTGAGGTGG + Intergenic
1093394965 12:18669953-18669975 AGGAAGAGGGCCGGGCGCGGTGG - Intergenic
1093475499 12:19549864-19549886 AAAAACAGGGCCGGGTGCGGTGG - Intronic
1093505824 12:19864822-19864844 AAGCTCAGGGCCGGGTGTGGTGG - Intergenic
1093622332 12:21306612-21306634 AGTCAAAGGGCCGGGTGCAGTGG - Intronic
1094070256 12:26404844-26404866 AGGGAGAGGGCCAGGTGCGGTGG + Intronic
1094609593 12:31980396-31980418 TGGCATAAGGCCGGGTGCGGTGG - Intronic
1095420854 12:42022144-42022166 GGGCACATGGCCGGGAGCGGTGG - Intergenic
1096216834 12:49802532-49802554 AGGCAGAGGGCCAGGCGCGGTGG - Intronic
1096270898 12:50166033-50166055 TGGCTCAAGGCCGGGTGCGGTGG + Intronic
1096291371 12:50346512-50346534 AGATACAGGGCTGGGTGCGGTGG - Intronic
1097112932 12:56675630-56675652 ACAAACAGGGCCGAGTGCGGTGG + Intronic
1097671105 12:62539552-62539574 AGGCAGATGGCCGGGCGCGGTGG - Intronic
1097768357 12:63551585-63551607 AGGCAAAAGGGCGTGTGCGGCGG + Intergenic
1097784722 12:63746649-63746671 AGGCAAAAGGGCGTGTGCGGAGG + Intergenic
1098907021 12:76172747-76172769 AGGCTGTGGGCCGGGTGCGGTGG + Intergenic
1101020432 12:100548005-100548027 AGGAACAGGGCCGGGTGCGGTGG - Intronic
1101700976 12:107173482-107173504 ATGCACTGGGCCGGGTGCAGTGG + Intergenic
1102063590 12:109954019-109954041 AAGCACTGGGCCGGGCGCGGTGG + Intronic
1102480478 12:113220109-113220131 AGGCTAAGGGCCGGGCGCGGTGG - Intronic
1103461562 12:121108961-121108983 AAGCAGAAGGCCGGGTGCGGTGG + Intergenic
1103485760 12:121281658-121281680 GTGCACAAGGCCGGGTGCGGTGG + Intronic
1103536364 12:121636404-121636426 AAACACAGGGCCGGGCGCGGTGG - Intronic
1103654166 12:122457178-122457200 TGGCACAGGGTCGCTTGCTGGGG - Intergenic
1104347644 12:128016351-128016373 AGCAAAAGGGCCGGGTGCGGTGG + Intergenic
1105042268 12:132969800-132969822 AGGCAGAGGGCCAGGTGCAGTGG + Intergenic
1105680769 13:22725142-22725164 TGGCTCAGGGCCAGGTGCGGTGG + Intergenic
1106372460 13:29148763-29148785 AAACACAGGGCCGGGCGCGGTGG - Intronic
1106611142 13:31282350-31282372 ACAGACAGGGCCGAGTGCGGTGG + Intronic
1107488679 13:40858289-40858311 AAGGACAGGGCCGGGTGCGATGG - Intergenic
1107687989 13:42923271-42923293 GGGCATAAGGCCGGGTGCGGTGG + Intronic
1107891801 13:44920738-44920760 GGGCACAGGGCCGGGTGTGGTGG + Intergenic
1108973878 13:56411739-56411761 TAGCACTGGGCCGGGTGCGGTGG + Intergenic
1110072088 13:71190329-71190351 AGTCTCGGGGCCGGGTGCGGTGG - Intergenic
1110206948 13:72925827-72925849 AAAAACAGGGCCGGGTGCGGTGG - Intronic
1111270389 13:85874447-85874469 AGCCTGAGGGCCGGGTGCGGTGG - Intergenic
1111672714 13:91348860-91348882 AGGCCTCGGGCCGCGTGCGACGG + Intergenic
1112050061 13:95636253-95636275 AGGAATAGGGCCGGGTGCAGTGG + Intronic
1112696461 13:101954303-101954325 AGGCACTGGGCGGGGTGGGGGGG + Intronic
1113416939 13:110136163-110136185 AGGCTCAGGGCAGTGTGGGGAGG - Intergenic
1113587646 13:111476261-111476283 AGCCACTGGGCCAGGTGCGGGGG - Intergenic
1114346732 14:21804306-21804328 ACATACAGGGCCGGGTGCGGTGG + Intergenic
1114494394 14:23122545-23122567 AAGGACAGGGCCGGGTGCAGTGG + Intergenic
1115809490 14:37091145-37091167 AGACAATGGGCCGGGTGCGGTGG + Intronic
1115867488 14:37763173-37763195 AGATACAGGGCCGGGTGCAGTGG - Intronic
1116461016 14:45174098-45174120 AAGCAGAGGGCCAGGTGCGGTGG + Intronic
1116980987 14:51170142-51170164 AGGAAAAGGGCCGGGTGCGGTGG - Intergenic
1117147736 14:52852146-52852168 AGCACCAGGGCCGGGTGCGGTGG + Intergenic
1117984081 14:61370228-61370250 ACACACATGGCCGGGTGCGGTGG - Intronic
1118124853 14:62890406-62890428 GGGCAAAGGGCCGGGCGCGGTGG + Intronic
1118141311 14:63086133-63086155 AGGCACTTGGCCGGGCGCGGTGG - Intronic
1118185246 14:63531664-63531686 ACACACACGGCCGGGTGCGGTGG + Intronic
1118359741 14:65045701-65045723 AGGCTCAGGGCCGGGTGCGGTGG - Intronic
1118726565 14:68633112-68633134 AGGCCCAGGGCTGGGTGTGGTGG - Intronic
1119443677 14:74646737-74646759 AAACACATGGCCGGGTGCGGTGG + Intergenic
1119808675 14:77498906-77498928 GGGCACGGGGCCGCGCGGGGCGG + Intergenic
1121260264 14:92560729-92560751 AGACACCGGGCCGGATGCGGTGG + Intronic
1121898606 14:97672095-97672117 AAGCACAGGACCAGGTGCGGTGG + Intergenic
1122450790 14:101805355-101805377 GTGCACAGGGCCGGGTGTGGTGG - Intronic
1122469992 14:101959989-101960011 AAGAAAAGGGCCGGGTGCGGTGG + Intergenic
1122701809 14:103594751-103594773 AGCAACAAGGCCGGGTGCGGTGG + Intronic
1122708876 14:103640645-103640667 ATTCACAGGGCCGGGCGCGGTGG - Intronic
1122712437 14:103669063-103669085 AACCACAGGGCCGGGTGCAGTGG - Intronic
1122800512 14:104227127-104227149 AGGCACAGGAAAGCGTGCAGAGG - Intergenic
1123003554 14:105310069-105310091 ATGCACATGGCTGGGTGCGGTGG - Exonic
1123010747 14:105348428-105348450 CGGCACAGGGCCGCGTCCTGAGG + Intronic
1123025112 14:105420460-105420482 CAGCACAGGGCCGCGGGCCGGGG - Intronic
1123779008 15:23607068-23607090 AGGCATAGGGCTGAGTGTGGGGG - Intronic
1124067061 15:26354416-26354438 AGACTCAGGGCCGGGCGCGGTGG + Intergenic
1124246698 15:28077344-28077366 AAGCACAGGGCTGGGTGCGGTGG - Intronic
1124667773 15:31608779-31608801 AAGAACAGAGCAGCGTGCGGAGG + Intronic
1125086376 15:35734890-35734912 AGTCACCGGGCCGGGCGCGGTGG - Intergenic
1125536112 15:40441751-40441773 AGGCAAGGGGCCGCGGCCGGGGG + Intronic
1125572705 15:40733241-40733263 AGGGACTGGGCCAGGTGCGGTGG + Intergenic
1125983651 15:44027929-44027951 CAGCACAGGGCCGGGCGCGGTGG - Intronic
1126485125 15:49171367-49171389 AGGCAGAGGGCCGGGCGCGATGG - Intronic
1126494749 15:49277973-49277995 GGGCATAGGGCTGGGTGCGGTGG + Intronic
1128161038 15:65422957-65422979 AGGCGCGGCGCCGCGGGCGGGGG + Exonic
1128187714 15:65657352-65657374 AGGAAAAGGGCCGGGCGCGGTGG + Intronic
1128484243 15:68069179-68069201 ATGGACAAGGCCGGGTGCGGTGG - Intronic
1128502846 15:68240694-68240716 GGGGACAGGGCCGGGTGCGGTGG + Intronic
1128939235 15:71774023-71774045 CACCACAGGGCCGGGTGCGGTGG + Intronic
1129001986 15:72342797-72342819 TACCACAGGCCCGCGTGCGGTGG + Exonic
1129370782 15:75093399-75093421 TAGCAGAGGGCCGGGTGCGGTGG + Intronic
1129562624 15:76588207-76588229 AGAGACAGGGCCGGGCGCGGTGG - Intronic
1129986465 15:79923507-79923529 AGCGAGAGGGCCGCGGGCGGCGG - Exonic
1130511011 15:84589079-84589101 AGGAACAGGGCCAAGCGCGGTGG - Intergenic
1130706091 15:86234263-86234285 AGTCACAAGGCCGAGAGCGGTGG + Intronic
1131255152 15:90857143-90857165 AGACACTGGGCTGGGTGCGGTGG + Intergenic
1131379473 15:91951840-91951862 ATACACAAGGCCGGGTGCGGTGG - Intronic
1131462918 15:92632255-92632277 AGGCTCTCGGCCGGGTGCGGTGG + Intronic
1131564934 15:93477437-93477459 AGGCACAGGGGCGTGTTGGGGGG + Intergenic
1132300354 15:100771457-100771479 ACACACAGGGCTGGGTGCGGTGG + Intergenic
1132424595 15:101704365-101704387 AGTCACAGGGCCGGGTGTGGTGG + Intronic
1132444049 15:101895404-101895426 ATGCACAGGGCTGGGTGCAGTGG - Intergenic
1132651366 16:1022750-1022772 GGGCAGAGGGCTGGGTGCGGTGG + Intergenic
1133305813 16:4807946-4807968 AGGAACAAGGCTGCATGCGGTGG + Intronic
1133469946 16:6065320-6065342 AATCATAGGGCCGCGTGCGGTGG - Intronic
1134032438 16:11003315-11003337 AGGCACAGGGCGGCGTTCATGGG - Intronic
1134175109 16:11999612-11999634 AGGCACTGGGCCAGGTGCAGTGG + Intronic
1134182100 16:12056167-12056189 AGGCACATGGCCAGGTGCAGAGG - Intronic
1134258615 16:12632039-12632061 ATGAACATGGCCGCGTGCAGTGG + Intergenic
1134387610 16:13788397-13788419 AGCAACAGGGCCGGGTGCGGTGG - Intergenic
1134687455 16:16168791-16168813 ATCCATAGGGCCGGGTGCGGGGG + Intronic
1135158285 16:20072837-20072859 ACACACAGGGCAGCCTGCGGTGG - Intronic
1135640292 16:24113927-24113949 AGACAGAGGGCCGGGTGCGGTGG + Intronic
1135879326 16:26238860-26238882 AGGCAGAGGGCTGGGTGTGGTGG - Intergenic
1135885197 16:26299733-26299755 AGACACAGTGCCACGTGCTGGGG + Intergenic
1136457888 16:30392308-30392330 AGATACAGGGCCGGGGGCGGTGG - Intronic
1136476106 16:30514562-30514584 GGGCATAGGGCCGGGTGCGGTGG - Intronic
1136558647 16:31025130-31025152 AGGAATAGGGCCGGGTGCGGTGG + Intergenic
1136562638 16:31049359-31049381 AAGGACAGGGCCCGGTGCGGTGG - Intergenic
1136581607 16:31154813-31154835 TGGCACGGGGCCGGGTGTGGTGG + Intergenic
1137715261 16:50594678-50594700 AGGCTCAGGGCCACCTGGGGTGG + Intronic
1138060070 16:53880814-53880836 AGGGACATGGCCGGGTGTGGTGG + Intronic
1138380135 16:56594882-56594904 AGGCAAAAGGCCGGGTGCAGTGG + Intergenic
1138654054 16:58480406-58480428 GGGGGCAGGGCCGGGTGCGGTGG - Intronic
1138790029 16:59892860-59892882 AGGAACAGGGCTGGGCGCGGTGG - Intergenic
1139000671 16:62506322-62506344 AGGCCCTGGGCCGGGCGCGGTGG + Intergenic
1139424094 16:66868300-66868322 GGGCAGAGGGCCGGGCGCGGTGG + Intronic
1139528903 16:67532184-67532206 AGTCACACGGCCGGGTGCGGTGG - Intronic
1139981695 16:70864041-70864063 AAGAACAGGGCTGGGTGCGGTGG + Intronic
1140098386 16:71894531-71894553 AGAAAAAGGGCCGGGTGCGGTGG - Intronic
1140554087 16:75900633-75900655 AGACACAGGGCCGGGCGTGGTGG - Intergenic
1141324136 16:83039646-83039668 AGGCACTGGGCAGGGTGCTGAGG - Intronic
1141337668 16:83172201-83172223 AGGCAGATGGCCGGGTACGGTGG + Intronic
1141953059 16:87351575-87351597 AGGGATAGGGCTGGGTGCGGTGG + Intronic
1142339955 16:89515221-89515243 AGGTCCAGGGCTGGGTGCGGTGG - Intronic
1142558587 17:796305-796327 ACGAAGGGGGCCGCGTGCGGTGG + Intergenic
1142574760 17:899243-899265 ATGCACAGGCCGGGGTGCGGTGG - Intronic
1142585836 17:972742-972764 AGAATCAGGGCCGGGTGCGGTGG + Intronic
1142728293 17:1832216-1832238 ATGTTCAGGGCCGGGTGCGGTGG - Intronic
1142739686 17:1924319-1924341 ACACACAGGGCTGGGTGCGGTGG - Intergenic
1142752112 17:1995126-1995148 AGGCATGGGGCCGAGTGCAGGGG + Intronic
1142960703 17:3550809-3550831 AGGCAGGAGGCCGGGTGCGGTGG - Intronic
1143117738 17:4590252-4590274 AGGCACGGGGCCAGGCGCGGTGG - Intronic
1143160262 17:4865141-4865163 AGACACTGGGCCGGGCGCGGTGG + Intronic
1143547004 17:7603238-7603260 AGGGACTGGGCCGGGTGCGGTGG + Intronic
1143712815 17:8745668-8745690 ACGCGCAGGGCCGGGCGCGGTGG - Intergenic
1144027998 17:11295674-11295696 AGTCATGGGGCCGGGTGCGGTGG + Intronic
1144365110 17:14536228-14536250 AGGGCCAAGGCCGGGTGCGGTGG + Intergenic
1144945266 17:18966474-18966496 AGACTCTGGGCCGGGTGCGGTGG + Intronic
1145052117 17:19670846-19670868 AGGGAGGGGGCCGGGTGCGGTGG - Intronic
1145280461 17:21463808-21463830 AGGGCCAGGGCCGCGTCCAGAGG - Intergenic
1145742163 17:27284381-27284403 AGGCACAGGGCTGGGCGTGGTGG + Intergenic
1145850731 17:28093078-28093100 AGCCACTAGGCCGGGTGCGGTGG - Intronic
1146319797 17:31838083-31838105 AGGCACAGGGCTGCCTGTGGTGG + Intergenic
1146350398 17:32087269-32087291 ATCCACAAGGCCGGGTGCGGTGG + Intergenic
1147179521 17:38675174-38675196 CGCCACCGGGCCACGTGCGGCGG - Exonic
1147242353 17:39098859-39098881 AGGCAGAGGGCGGTGAGCGGAGG + Intronic
1147356333 17:39900730-39900752 AGGAACAGGGCCAGGTGTGGTGG - Intergenic
1147752523 17:42744944-42744966 AGGCCCAGGGCGGCGAGGGGAGG + Intronic
1147763028 17:42813129-42813151 AAGCAAAGGGCCGGGTGCAGTGG - Intronic
1147881058 17:43653793-43653815 AGGCAGTTGGCCGGGTGCGGTGG - Intronic
1147994630 17:44354043-44354065 AGGCGCGGGGGCGCGGGCGGCGG + Exonic
1148514205 17:48200663-48200685 TGGCCCAGGGCCGGGCGCGGTGG - Intronic
1148738872 17:49880719-49880741 AGGTATAGGGCCGCCTGGGGCGG - Intergenic
1148761720 17:50006511-50006533 AAAAACAGGGCCGGGTGCGGTGG + Intergenic
1148959160 17:51378869-51378891 AGAAACAGGGCCAGGTGCGGTGG - Intergenic
1149619854 17:58035971-58035993 AAGGACAGGGCCAGGTGCGGTGG + Intergenic
1149724945 17:58883770-58883792 AGGCAGCGGGCCGGGCGCGGTGG - Intronic
1149784356 17:59422824-59422846 AGGCTCAGGGCCAGGTGCAGTGG - Intergenic
1150154992 17:62845526-62845548 TGGCCCAGGGCCGGGTGTGGTGG + Intergenic
1150699932 17:67437778-67437800 GGGCCCAAGGCCGAGTGCGGAGG + Intronic
1150920263 17:69475453-69475475 AAACACAGGGCCGGGCGCGGTGG - Intronic
1151272404 17:73007133-73007155 AGACACAGGGCCGGGCGCAGTGG + Intronic
1151699626 17:75736428-75736450 AGGCACAGGGCAGTGTGGGCAGG + Intronic
1151699793 17:75737143-75737165 AGGCACAGGAACGGGTGTGGTGG - Intronic
1151818447 17:76483570-76483592 AGGCCTAGGGCCGGGTGTGGTGG - Intronic
1152110802 17:78356725-78356747 AGGCACGGGGCGGGGGGCGGGGG + Intergenic
1152499477 17:80698268-80698290 AGGCACTGGGCCCCATGCAGAGG + Intronic
1152610369 17:81312252-81312274 AGGAAAAGGGCCGGGCGCGGTGG + Exonic
1153289795 18:3489476-3489498 AGAAATAGGGCCGGGTGCGGTGG - Intergenic
1153312223 18:3688196-3688218 AGTCTCTGGGCCGGGTGCGGTGG - Intronic
1153773462 18:8433465-8433487 AGGCACTTGGCCGCCCGCGGAGG - Intergenic
1153893760 18:9541076-9541098 AGGCACCAGGCCGGGTGCGGTGG + Intergenic
1154352739 18:13599776-13599798 AGACTCACGGCCGGGTGCGGTGG - Intronic
1156448122 18:37251826-37251848 AGGCACTGGGCCCAGTGTGGGGG - Intronic
1157195184 18:45615082-45615104 AAGCAAATGGCCGGGTGCGGCGG - Exonic
1157247175 18:46064855-46064877 AAACACTGGGCCGGGTGCGGTGG + Intronic
1157731955 18:50011681-50011703 AGGAACAGGGCTTCGTGGGGTGG - Intronic
1158532814 18:58278702-58278724 AGGAACAGGGCAGAGTGAGGGGG - Intronic
1159251617 18:65885651-65885673 ACACACAGGGCCGGGCGCGGTGG - Exonic
1159858592 18:73618745-73618767 ATGGGCAGGGCCGTGTGCGGTGG + Intergenic
1160196664 18:76760656-76760678 TGGCACATGGCTGGGTGCGGTGG - Intergenic
1160513560 18:79466062-79466084 GGGCACAGGGCCCAGTGGGGTGG + Intronic
1160607043 18:80059150-80059172 ATGCACAGGGCCGAGGGCTGGGG - Intronic
1160641305 19:139415-139437 ATGCACAGGGCTGGGTGCAGTGG + Intergenic
1160751555 19:736760-736782 AGGCAGAGGGCCGGGCGTGGTGG + Intronic
1160896740 19:1406507-1406529 AGGAACAAGGCCGGGTGAGGTGG - Intergenic
1161121622 19:2530123-2530145 CTGGACAGGGCCGGGTGCGGCGG + Intronic
1161244961 19:3246074-3246096 ACGGACAAGGCCGGGTGCGGTGG + Intronic
1161394545 19:4038231-4038253 GGGCAGAGGGCGGCGGGCGGCGG - Exonic
1161551831 19:4917242-4917264 AGACAAAGGGCCGAGTGTGGTGG - Intronic
1161603013 19:5196538-5196560 AGGAACAGGGCCAGGTGCTGTGG - Intronic
1162352774 19:10161017-10161039 AGGCACAGGGCCGGGCGCGATGG + Intronic
1162455010 19:10778318-10778340 AGGAAGATGGCCGGGTGCGGTGG - Intronic
1162539108 19:11283045-11283067 ACACATAGGGCCGGGTGCGGTGG - Intergenic
1163168467 19:15513788-15513810 GTGCACTGGGCCGGGTGCGGTGG - Intronic
1163249338 19:16117199-16117221 GAGCAGAGGGCCGGGTGCGGTGG + Intronic
1163310415 19:16511021-16511043 AGATACAGGGCCGGGTGCAGTGG - Intronic
1163334333 19:16661141-16661163 AGTCGCCGGGCCGCGGGCGGCGG + Exonic
1163654597 19:18538398-18538420 AGGCACAGGGCCGCGTGCGGGGG + Exonic
1163680850 19:18681541-18681563 AGGAAGATGGCCGGGTGCGGTGG + Intergenic
1163748313 19:19060886-19060908 AAGGCCAGGGCCGGGTGCGGTGG - Intergenic
1164006868 19:21157813-21157835 AGACAAATGGCCGGGTGCGGTGG - Intronic
1164641301 19:29827927-29827949 TGCCAGAGGGCCGGGTGCGGTGG - Intergenic
1165800035 19:38543743-38543765 AGGCAGAGTGCCGTGTGGGGGGG - Intronic
1165967200 19:39592432-39592454 AGGCAAAGGGCTGAATGCGGTGG + Intergenic
1166100653 19:40569705-40569727 AGGCCCAGGGCTGCCTGCTGGGG + Exonic
1166114169 19:40642556-40642578 AGGAAGAGGGCCGGGCGCGGTGG + Intergenic
1166513482 19:43427668-43427690 GGGCAAAGGGCTGGGTGCGGTGG - Intergenic
1166751914 19:45168288-45168310 AGGGTCAGGGCCGGGCGCGGTGG - Intronic
1167275855 19:48538846-48538868 CCGCACAGGGCTGGGTGCGGTGG + Intergenic
1167383824 19:49152856-49152878 AGGGGCAGGGCCGGGTGTGGTGG - Intronic
1167491478 19:49795166-49795188 AGGCTCAGAGCCGAGTGAGGAGG + Intronic
1167562987 19:50237613-50237635 ATGCTCATGGCCGGGTGCGGTGG - Intronic
1167760350 19:51443030-51443052 AAAAACAGGGCCGGGTGCGGTGG - Intergenic
1167860436 19:52278690-52278712 GGGCAAAGGGCCAGGTGCGGTGG - Intronic
1167891938 19:52547233-52547255 AAACACAGGGCCGGGTGAGGTGG - Intronic
1167899439 19:52607858-52607880 ACTTACAGGGCCGGGTGCGGTGG - Intronic
1167955528 19:53060949-53060971 CGGTACAGGGCCGGGTGAGGTGG - Intergenic
1168038236 19:53737550-53737572 AGAGACAGGGCCGGGTGCGGTGG - Intergenic
1168079168 19:53996678-53996700 AAGCACAGGGCCGGGTGTGCTGG - Intronic
1168167216 19:54558013-54558035 ATGATCAGGGCCGGGTGCGGTGG - Intergenic
1168222128 19:54968203-54968225 AACAACAGGGCCGGGTGCGGTGG - Intronic
1168258025 19:55177840-55177862 TGGCTCTGGGCCGGGTGCGGTGG - Intronic
1168311436 19:55462918-55462940 AAACACAAGGCCGGGTGCGGCGG - Intergenic
1168561985 19:57392084-57392106 AAGCACAGGGCTGGGCGCGGTGG - Intronic
1168675614 19:58275894-58275916 ATACACAGGGCCGGGTGCAGTGG + Intronic
925280603 2:2682037-2682059 AGGCAGAGGGCAGGGTGCAGAGG + Intergenic
925281251 2:2686921-2686943 AAGAACAGGGCCACATGCGGTGG - Intergenic
925990817 2:9252626-9252648 AGGAACACGGCCGGGTGCAGTGG + Intronic
926732554 2:16048013-16048035 AGGCACTTGGCCGGGTGTGGTGG + Intergenic
927137606 2:20108345-20108367 AAGAAGAGGGCCGGGTGCGGTGG + Intergenic
927730281 2:25465085-25465107 AGAAACAGGGCCGGGTGCGGTGG + Intronic
927844091 2:26462368-26462390 AGGCACATGGCTGTGGGCGGTGG + Intronic
927897168 2:26790611-26790633 AGACATAGGGCTGGGTGCGGTGG - Intronic
928421227 2:31138765-31138787 AGGCACAGCGCCGCCTGGCGAGG - Intronic
928595903 2:32858601-32858623 TGGCACCTGGCCGGGTGCGGTGG + Intergenic
928655489 2:33446854-33446876 AAGGACTGGGCCGGGTGCGGTGG + Intronic
929713604 2:44289120-44289142 GGGCAAAGGGCCAGGTGCGGTGG - Intronic
929869296 2:45744894-45744916 AGGCAAATGGCTGGGTGCGGTGG - Intronic
929914826 2:46126267-46126289 AGGCACTGTGCAGCGTGCTGGGG + Intronic
930571261 2:53089648-53089670 AGACTCAAGGCCGGGTGCGGTGG + Intergenic
930770415 2:55125476-55125498 AGACATATGGCCGGGTGCGGTGG + Intergenic
931018427 2:58013582-58013604 AGATACAGGGCCGGGCGCGGTGG + Intronic
931129636 2:59320458-59320480 AGATACAAGGCCGGGTGCGGTGG + Intergenic
931391836 2:61851159-61851181 ATGAACAGGGCCGGGCGCGGTGG - Intronic
931406614 2:61985335-61985357 ACACATAGGGCCGGGTGCGGTGG - Intronic
931502305 2:62882593-62882615 AGGAAATGGGCCGGGTGCGGTGG + Intronic
931768444 2:65477343-65477365 AGACAAAGGGCTGGGTGCGGTGG - Intergenic
932156389 2:69421847-69421869 AAGAACAGGGCCAGGTGCGGTGG - Intronic
932234368 2:70109182-70109204 AGACAGAAGGCCGGGTGCGGTGG + Intergenic
932380350 2:71276552-71276574 AGGCGCAGGACTCCGTGCGGCGG - Intronic
933188501 2:79305756-79305778 AGGCACTTGGCCGGGTGCGGTGG + Intronic
933486763 2:82933985-82934007 AAGTAGAGGGCCGGGTGCGGTGG - Intergenic
933678761 2:85080158-85080180 AGACTCAGGGCCGGGCGCGGTGG - Intergenic
933724487 2:85418844-85418866 GGGCAGAGGGGCGCGTGCAGGGG - Intronic
933731445 2:85459320-85459342 AGAAACAGGGCCGGGTGCGGTGG + Intergenic
933783338 2:85817556-85817578 AGCCTCCGGGCCGGGTGCGGTGG - Intergenic
934792898 2:97077443-97077465 ACGCACATGGCCGGGTGCAGCGG - Intergenic
934813291 2:97303044-97303066 ACGCACATGGCCGGGTGCAGCGG + Intergenic
934824404 2:97405436-97405458 ACGCACATGGCCGGGTGCAGCGG - Intergenic
935091247 2:99896920-99896942 ATGCACAGGGCCGGGCGCGGTGG - Intronic
935112288 2:100104733-100104755 GGGCGCAGGGCCGGGGGCGGGGG - Intronic
935764364 2:106350727-106350749 ACGCACAGGGCCGGGCGCAGTGG - Intergenic
936122695 2:109760427-109760449 CGGCGCAGGGCCGGGGGCGGCGG + Intergenic
936221998 2:110611046-110611068 CGGCGCAGGGCCGGGGGCGGTGG - Intergenic
936404779 2:112193151-112193173 TGGCATAGGGCTGGGTGCGGTGG + Intergenic
938570922 2:132561203-132561225 AGGCACTGGGCCAGGTGCAGTGG - Intronic
938900534 2:135795494-135795516 AGATACAGGGCCGGGTGTGGTGG - Intronic
939265041 2:139862019-139862041 AGGAAATGGGCCGGGTGCGGTGG + Intergenic
939996069 2:148921100-148921122 AGGCACAGTGCTGAGTGCTGGGG - Intronic
940670058 2:156656647-156656669 CAGCACAGGGCCGGGTGCGGTGG + Intergenic
941066385 2:160907582-160907604 ATACACACGGCCGGGTGCGGTGG - Intergenic
941376094 2:164732766-164732788 AGACAAATGGCCGGGTGCGGTGG + Intronic
942266291 2:174229159-174229181 ATGCAGAGGGCTGGGTGCGGTGG - Intronic
942313596 2:174679181-174679203 AGATACAGGGCTGGGTGCGGTGG + Intronic
942498440 2:176563451-176563473 ATGCAAAGGGCCGGGTGCGGTGG - Intergenic
942510656 2:176696316-176696338 AGGTACAGGGCTGGGTGCAGTGG - Intergenic
942559598 2:177206608-177206630 AGCAACAGGGCCGGGTGTGGTGG + Intergenic
944701527 2:202250390-202250412 AAGAACAGGGCCGGGCGCGGTGG + Intergenic
944930221 2:204509916-204509938 AAGCACTGGGCCGGGCGCGGTGG - Intergenic
946072523 2:217046770-217046792 AGACAATGGGCCGGGTGCGGTGG - Intergenic
946401975 2:219472984-219473006 AGCCACAGGGCTGCGTAAGGGGG + Exonic
946756248 2:222950823-222950845 TAACACAGGGCCGGGTGCGGTGG - Intergenic
947723433 2:232382336-232382358 AGGCAGAGGGCCCCCTGGGGGGG - Exonic
948144101 2:235695683-235695705 AGGCAGAGGGCCGGGCGCAGTGG + Intronic
948459357 2:238121683-238121705 AGGCTCTGGGCCGGGTACGGTGG - Intronic
949052225 2:241903444-241903466 AGGCTGAGGCCCGAGTGCGGAGG + Intergenic
1168920021 20:1524695-1524717 AGACACAAGGCCGGGAGCGGTGG + Intergenic
1169049549 20:2564435-2564457 AGGCTGAGGGCCGGGCGCGGTGG - Intronic
1169413100 20:5391525-5391547 AGACACAAGGCTGGGTGCGGTGG + Intergenic
1169438014 20:5610816-5610838 AGGCAGCGAGCCGGGTGCGGGGG - Intronic
1170166557 20:13365694-13365716 AGGCACAGGGCCCCGGGCCATGG + Intergenic
1170358476 20:15518709-15518731 AGGCTTATGGCCACGTGCGGTGG + Intronic
1170743853 20:19081072-19081094 AGGCCCTGGGCCGGGCGCGGTGG - Intergenic
1170968983 20:21101473-21101495 AGTGACAGAGGCGCGTGCGGGGG + Intergenic
1171945121 20:31369675-31369697 CTGCATAGGGCCGGGTGCGGTGG - Intronic
1171995654 20:31728956-31728978 AGGAACAAGGCCGGGTGTGGTGG + Intergenic
1172362513 20:34323696-34323718 AGGAATAGGGCCGGGTGCGGTGG - Intergenic
1172463902 20:35140829-35140851 TGGCACAGGGCCAGGTGCAGTGG + Intronic
1172554293 20:35827495-35827517 AGGCTCATAGCCGGGTGCGGTGG + Intronic
1172751198 20:37252477-37252499 AGGCTCTAGGCCGGGTGCGGTGG + Intronic
1172979140 20:38927784-38927806 CGGCAGGGGGCCGGGTGCGGTGG - Intronic
1173265080 20:41471944-41471966 AGACAAAGGGCCGGGTGCAGTGG + Intronic
1173660114 20:44727343-44727365 AGGCACAGGGCCACCAGCTGGGG - Exonic
1174605647 20:51759383-51759405 ACACACACGGCCGGGTGCGGTGG + Intronic
1175183767 20:57166277-57166299 ACACAGAGGGCCGGGTGCGGTGG + Intergenic
1175769306 20:61613372-61613394 TGGCCCAGGGCCGTGTGCGTAGG + Intronic
1175943729 20:62549458-62549480 AGGCACAGGCCCGTGTGATGGGG - Intergenic
1176032385 20:63019055-63019077 AGCCAAAGGGCCAGGTGCGGTGG - Intergenic
1176387253 21:6144675-6144697 ATACACAAGGCCGGGTGCGGTGG - Intergenic
1178187349 21:30237912-30237934 TCACACAGGGCCGGGTGCGGTGG - Intergenic
1179211882 21:39331717-39331739 AAGCTCTGGGCCGGGTGCGGTGG - Intergenic
1179383981 21:40924742-40924764 AGGCACAGGGTTGGGGGCGGGGG + Intergenic
1179736220 21:43393573-43393595 ATACACAAGGCCGGGTGCGGTGG + Intergenic
1179772753 21:43635627-43635649 AATCATAGGGCCGGGTGCGGTGG + Intronic
1179880990 21:44293288-44293310 AGGCACAGGGCCTGGGGCTGTGG + Intronic
1179912657 21:44458449-44458471 AGGCACAGGGCCGGGCGCGGTGG - Exonic
1180719175 22:17894122-17894144 CTACACAGGGCCGGGTGCGGTGG + Intronic
1181006434 22:20016015-20016037 GGGCGCAGGGCGGCGTGGGGAGG + Intronic
1181322358 22:22018035-22018057 AGGAATAGGGCCGGGTGCGGTGG - Intergenic
1181765598 22:25089559-25089581 ACACACATGGCCGGGTGCGGTGG - Intronic
1182296463 22:29313341-29313363 AGGCGCAGGGCCGGGTGTGCAGG + Exonic
1182873079 22:33665603-33665625 AGAAACAGGGCTGCGCGCGGTGG + Intronic
1183214635 22:36471462-36471484 AGGCACAGTGCTGGGTGCTGCGG + Intronic
1183530751 22:38352037-38352059 AGGCCCAGGGCTGGCTGCGGTGG + Intronic
1183660366 22:39216425-39216447 AGGCACAGGGCCGGGTGCTGTGG + Intergenic
1183768273 22:39899693-39899715 AGCTACAGGGCCGGGTGCGGTGG + Intergenic
1184114050 22:42411808-42411830 AGGCTCACGACCGGGTGCGGTGG + Intronic
1184135070 22:42543586-42543608 AAGAACAGGGCCGAGTGCAGTGG - Intergenic
1184511386 22:44935325-44935347 AAGCACATGGCCGGGCGCGGTGG + Intronic
1184526216 22:45024896-45024918 ATGCACTCGGCCGGGTGCGGTGG + Intergenic
1184676921 22:46048395-46048417 AAGCTCAGGGCCCTGTGCGGTGG + Intergenic
1184793080 22:46713215-46713237 AGACACAGGGCCAGGCGCGGTGG + Intronic
1184963359 22:47948114-47948136 AGGCGCAGGGCTGGGCGCGGTGG - Intergenic
1185268093 22:49915269-49915291 AGGCTGAGGGCCAGGTGCGGTGG + Intronic
1185375016 22:50478648-50478670 AGGCTGAGGGCCGAGTGGGGAGG + Intergenic
1185394174 22:50578351-50578373 CGGCACAGGGCGGCCCGCGGGGG - Intronic
950084308 3:10246800-10246822 AGGTAAGGGGCCGGGTGCGGTGG - Intergenic
950435691 3:12978409-12978431 TTGCACAGGGCCGGGCGCGGTGG + Intronic
950446307 3:13040839-13040861 AGGAGCAGGGCTGGGTGCGGGGG - Intronic
950517791 3:13479175-13479197 AAGTACTGGGCCGGGTGCGGTGG - Intergenic
951693761 3:25424621-25424643 AGGCACAGGGCTGGGGGAGGTGG - Intronic
952318558 3:32254179-32254201 AGGGACAAGGCCGGGTGCAGTGG - Intronic
952722130 3:36544455-36544477 AGACACCTGGCCGGGTGCGGTGG - Intronic
952758920 3:36896705-36896727 ATGCAGAGGGCCGGGTGCAGTGG + Intronic
952868434 3:37874441-37874463 AGACACAAGGCCGGGCGCGGTGG + Intronic
953486261 3:43299461-43299483 ATGAACAAGGCCGGGTGCGGTGG - Intronic
953618213 3:44510712-44510734 GGGCCCAGGGCCGCTGGCGGCGG + Intergenic
953725153 3:45390925-45390947 GGGCAAAGGGCCAGGTGCGGTGG - Intronic
953901386 3:46845971-46845993 GGGCACAGGGGCGCGGGTGGCGG - Intergenic
954042494 3:47899425-47899447 AGGCAAGGGGCCGGGTGCGGTGG - Intronic
954131026 3:48561027-48561049 AGGCACGGGACAGCGTGGGGAGG - Intronic
954162170 3:48730656-48730678 AGTAACAGGGCCGGGTGCAGGGG + Intronic
954294879 3:49668706-49668728 AGGCCCAGAGCCCTGTGCGGGGG + Exonic
954392814 3:50276275-50276297 GGGCAGAGGGCAGCGTGAGGCGG - Intronic
954668526 3:52274605-52274627 AAAAACAGGGCCGGGTGCGGAGG + Intronic
954679548 3:52335594-52335616 AGCAAAAGGGCCGGGTGCGGTGG - Intronic
954792644 3:53144565-53144587 AGGCACATGGCAGGGTGCGGTGG - Intergenic
956131467 3:66057480-66057502 AGGTACAGGGCCTGGTGGGGTGG + Intergenic
956885615 3:73556546-73556568 AGGTACAGGGCCTGGTGCTGGGG + Intronic
957016536 3:75070266-75070288 AGGAACAGAGCAGCATGCGGGGG - Intergenic
958262832 3:91402978-91403000 AAGCACAGGGCCAGGTGCGGTGG - Intergenic
958909349 3:99976159-99976181 AGACACTGGGCCAGGTGCGGTGG - Intronic
959222000 3:103531974-103531996 AAGGACAGGACCGGGTGCGGTGG - Intergenic
959792431 3:110378974-110378996 AGACATAGGGCCGGGCGCGGTGG + Intergenic
960310769 3:116113710-116113732 GGGCAAAGGGCCGGGCGCGGTGG - Intronic
960957447 3:123043697-123043719 AGGCACAGGGCCAGGCGCGGTGG + Intergenic
962297997 3:134211241-134211263 AGGCACAGGGACTCATGTGGAGG + Intronic
962330091 3:134470908-134470930 AGGGAGAGGGCCGGGTGCAGTGG + Intergenic
962498469 3:135965920-135965942 AGGCTCGGGGCGGCGCGCGGAGG + Intronic
963038309 3:141051160-141051182 TGGCACAGGGGCGCGGGCGCGGG + Intergenic
963129118 3:141841678-141841700 GGGGAGAGGGCCGGGTGCGGTGG + Intergenic
963199530 3:142572051-142572073 AGAAAAAGGGCCGGGTGCGGTGG - Intronic
963508209 3:146214408-146214430 AGGAAGAGGGCCGGGCGCGGTGG - Intronic
963931250 3:151006293-151006315 AGGAACAGGGCCAGGTGCGGTGG - Intergenic
964113308 3:153109611-153109633 AACTACAGGGCCGGGTGCGGTGG - Intergenic
964855133 3:161138432-161138454 TTGCTCAGGGCCGGGTGCGGTGG - Intronic
965378486 3:167957411-167957433 AGGCACAAGGCCACATGGGGAGG + Intergenic
966085960 3:176067508-176067530 ACGCACTGGGCCGGGCGCGGTGG + Intergenic
966292715 3:178379016-178379038 AGGCACGCGGCCGGGCGCGGTGG + Intergenic
966471350 3:180292827-180292849 AGGAACAAGGCCGGGCGCGGTGG + Intergenic
967008186 3:185404867-185404889 AAGCATAGGGCTGCGCGCGGTGG - Intronic
967504414 3:190237907-190237929 AAACACAGGGCCGGGCGCGGTGG - Intergenic
967540503 3:190661630-190661652 AAGCTCTGGGCCGGGTGCGGTGG - Intergenic
967782437 3:193455049-193455071 GGGCAAAGGGCCGGGTGTGGTGG + Intronic
968032281 3:195510733-195510755 GGGCATAGGGCCGGGTGCGGTGG + Intergenic
968037219 3:195557931-195557953 AGACATAGGGCCGGGTGCGGTGG + Intergenic
968216571 3:196896732-196896754 AGACACTGGGCCAGGTGCGGTGG - Intronic
968261163 3:197325239-197325261 TAGCACATGGCCGGGTGCGGTGG + Intergenic
968338904 3:197938026-197938048 AGACAAAGGGCCGGGCGCGGTGG + Intronic
968504622 4:966122-966144 AGACAGAGGGCCTGGTGCGGTGG - Intronic
968563385 4:1296460-1296482 AGGCACAGGCACGGGTGAGGGGG - Intronic
968650706 4:1759216-1759238 AGGCACAGAGTTGGGTGCGGGGG + Intergenic
969040502 4:4291841-4291863 TGGTACAGGGCTGGGTGCGGTGG + Intronic
969557501 4:7922694-7922716 AATCACTGGGCCGGGTGCGGCGG + Intronic
969581116 4:8066012-8066034 AGGGAGGGGGCCGGGTGCGGTGG + Intronic
969673150 4:8600872-8600894 AGGCTCAGGGCAGCCTGCTGCGG + Intronic
969828667 4:9778405-9778427 AAGTAAAGGGCCGGGTGCGGTGG - Intronic
970426337 4:15949576-15949598 TGCCACACGGCCGGGTGCGGTGG + Intergenic
970630577 4:17938698-17938720 AGTTACAGGGCCGGGCGCGGTGG - Intronic
970891431 4:21049235-21049257 AGGTACTGGGCCGGGCGCGGTGG - Intronic
971294388 4:25376400-25376422 GGGCTCAGGGCCGGGCGCGGTGG - Intergenic
971437740 4:26645834-26645856 GGGCAAAGGGCCGGGCGCGGTGG + Intronic
971655867 4:29343553-29343575 AAGTACAGGGCCGGGCGCGGTGG + Intergenic
971906900 4:32737479-32737501 AGAAACAGGGCCGGGAGCGGTGG - Intergenic
972492427 4:39600400-39600422 AGGAAAAGGGCCGGGTGTGGTGG + Intronic
974070426 4:57118527-57118549 AGGCATAAGGCCGAGTGTGGTGG + Intergenic
975127552 4:70799250-70799272 TGGCACTGGGCCGGGTGCGATGG + Intronic
975399826 4:73922199-73922221 AGGTAAAGGGCCGGGCGCGGTGG - Intergenic
976181897 4:82407046-82407068 AGAGACAAGGCCGCGAGCGGTGG + Intergenic
976564522 4:86538431-86538453 TGGCTCAGGGCCGGGTGCGGTGG - Intronic
978351476 4:107824877-107824899 AGGGAGCGGGCCGCGCGCGGCGG + Intronic
978375212 4:108067978-108068000 AGGCACCGGGCCGGGCGTGGTGG + Intronic
980118609 4:128705253-128705275 AGGCAAAGGGCCAGGTACGGTGG - Intergenic
980744122 4:136993161-136993183 AGGGACAGGGCCCAGTGCAGGGG + Intergenic
981099607 4:140815672-140815694 AGGCATTGGGCCAGGTGCGGTGG - Intergenic
981110531 4:140928831-140928853 AGATACAGGGCCGGGCGCGGTGG - Intronic
981314004 4:143323742-143323764 ATGCACAGGGCCGGGCGTGGTGG - Intergenic
981734678 4:147936614-147936636 AGGAAAAGGGCCGGGCGCGGTGG - Intronic
981927038 4:150151635-150151657 TGGCTCTGGGCCGGGTGCGGTGG + Intronic
981972071 4:150675429-150675451 TGGCACAGGGCTGGGCGCGGTGG + Intronic
982173379 4:152682828-152682850 AGGCTCAGGGCCGGGTGCAGTGG + Intergenic
982258755 4:153474841-153474863 ATTCACAGGACCGAGTGCGGTGG - Intronic
982769166 4:159379766-159379788 AGAAATAGGGCCGGGTGCGGTGG - Intergenic
983687181 4:170424266-170424288 AGACACAGGGCCGGGCGCAGTGG - Intergenic
984106822 4:175558061-175558083 GGACAAAGGGCCGGGTGCGGTGG - Intergenic
984193371 4:176630349-176630371 AGACACTGGGCTGCGTGTGGTGG - Intergenic
984506727 4:180628575-180628597 AGACACAGGGCCGGGCGCGGTGG - Intergenic
984757593 4:183338543-183338565 AAGGACAGGGCCAAGTGCGGTGG + Intergenic
984882236 4:184420153-184420175 AGGCACAGGGCCGGGTGTGGTGG - Intronic
985899931 5:2780478-2780500 AGGCAGAGGGCTGGGGGCGGGGG - Intergenic
986809313 5:11339223-11339245 AGGAACTGGGCCGGGCGCGGTGG - Intronic
987134235 5:14885960-14885982 AGGAAAATGGCCGGGTGCGGTGG - Intergenic
987285668 5:16454198-16454220 TGGGACAGGGCCGGGTGCGGTGG + Intronic
987331088 5:16858670-16858692 ACACACAGGGCCGGGTGCAGTGG + Intronic
988546523 5:32162789-32162811 AGGCCCATGGCCGGGCGCGGTGG + Intronic
988550278 5:32194831-32194853 ATGGACAAGGCCGGGTGCGGTGG + Intergenic
988878493 5:35474273-35474295 AGGAAAAGGGCCAGGTGCGGTGG - Intergenic
989418247 5:41205652-41205674 AGGCACAGGGAGGCTGGCGGAGG + Intronic
989517175 5:42357259-42357281 TGGCACAAGGCCGGGCGCGGTGG + Intergenic
990240512 5:53812006-53812028 CTGCACTGGGCCGGGTGCGGTGG + Intergenic
990624636 5:57597639-57597661 AGGAATGGGGCCGGGTGCGGTGG + Intergenic
990993194 5:61705001-61705023 AGACACAGGGCCGGGTGCTGTGG - Exonic
991050134 5:62264105-62264127 ATGCACATGGCCGGGTGTGGTGG + Intergenic
992787980 5:80187995-80188017 AGGCAGAAGGCTGGGTGCGGTGG + Intronic
993038786 5:82788245-82788267 AAGCAATGGGCCGGGTGCGGTGG - Intergenic
993155308 5:84215005-84215027 ACACATAGGGCCGGGTGCGGTGG - Intronic
994053297 5:95387088-95387110 AGGCAAAGCGCCGGGTGCAGTGG + Intergenic
994172458 5:96672420-96672442 AGGAACTGGGCCGGGAGCGGTGG + Intronic
994189024 5:96846951-96846973 GAGTACAGGGCCGGGTGCGGTGG + Intronic
994410776 5:99404581-99404603 AGGCACGTGGCCAAGTGCGGTGG - Intergenic
996489585 5:124078061-124078083 AGACAAAGGGCCGGGCGCGGTGG - Intergenic
996865380 5:128115410-128115432 AGTCCCAGGGCCAGGTGCGGTGG - Intronic
997382703 5:133449140-133449162 GGGCACAGGGGCACGTGGGGCGG - Intronic
997435113 5:133868217-133868239 AGGCACAGTGCTGGGTGCTGAGG + Intergenic
997435873 5:133874886-133874908 AGGGAGAGGGCCGGGTGCAGGGG - Intergenic
997454536 5:134006954-134006976 AGGCACTCGGCCCCGTGCAGTGG + Intergenic
997466201 5:134089680-134089702 TGGCTCATGGCCGGGTGCGGTGG + Intergenic
997812989 5:136990195-136990217 GGGTACAGGGCCGAGGGCGGTGG - Intronic
997956344 5:138281413-138281435 AGGGAGAGGGCTGGGTGCGGTGG + Intergenic
998423777 5:142010444-142010466 GGCCACAGGGCCGGGTGTGGTGG - Intronic
998832735 5:146177177-146177199 ATGCACAGGGCCGGGCGTGGTGG + Intronic
998968589 5:147567112-147567134 AGAAACAGGGCCAGGTGCGGTGG - Intergenic
999715960 5:154360160-154360182 ATGCACTGGGCTGGGTGCGGTGG + Intronic
999750473 5:154624606-154624628 AGGCACAGGGCTGCGTGCCAGGG - Intergenic
1000839273 5:166196431-166196453 AGACATGGGGCCGGGTGCGGTGG + Intergenic
1001100979 5:168814106-168814128 CACCACAGGGCCGGGTGCGGTGG + Intronic
1001206855 5:169771566-169771588 AGACAAAAGGCCGGGTGCGGTGG - Intronic
1001303096 5:170552275-170552297 AGGCACAGGGCTGGGAGCTGGGG + Intronic
1002736047 5:181387007-181387029 ATGCACAGGGCTGGGTGCAGTGG - Intergenic
1002748652 6:87817-87839 ATGCACAGGGCTGGGTGCAGTGG + Intergenic
1003214670 6:4098455-4098477 ATGAACAAGGCCGGGTGCGGTGG - Intronic
1003390025 6:5705759-5705781 AGGCACAGGGGCGCGAGCTGAGG - Intronic
1003857670 6:10292712-10292734 AAGAAAAGGGCCGGGTGCGGTGG + Intergenic
1003859200 6:10306763-10306785 AACCCCAGGGCCGGGTGCGGTGG + Intergenic
1003997291 6:11555867-11555889 AGGTACAAGGCCGGGCGCGGTGG + Intronic
1004397067 6:15254750-15254772 AGCCACAGGGCCGGGCGCGGTGG + Intronic
1004429957 6:15534362-15534384 GGGAACAGGGCCGGGCGCGGTGG + Intronic
1005050796 6:21682195-21682217 CAGCAGAGGGCCGGGTGCGGTGG - Intergenic
1005298243 6:24447216-24447238 AGGCTCTGGGCCAGGTGCGGTGG + Intronic
1005439726 6:25853703-25853725 ATGCAGAAGGCCGGGTGCGGTGG - Intronic
1006073531 6:31514788-31514810 CGGCACAGGGCCAGGCGCGGTGG + Intergenic
1006548193 6:34796988-34797010 AGGCTCAGGGCCGGGCGCAGTGG - Intronic
1006617897 6:35342407-35342429 TGGCCCGGGGCAGCGTGCGGTGG + Intergenic
1006857318 6:37144048-37144070 AGATAGAGGGCCGAGTGCGGTGG + Intergenic
1006933637 6:37702511-37702533 AGGCACAGGGCCAGCTGCTGAGG - Intergenic
1006987220 6:38183911-38183933 AGGCACTGGGCTGGGTGCTGAGG + Intronic
1007441205 6:41861987-41862009 AGTGACATGGCCGGGTGCGGTGG - Intronic
1007615506 6:43177515-43177537 AGACTCTGGGCCGGGTGCGGTGG - Intronic
1008992582 6:57619907-57619929 AAGCACAGGGCCAGGTGCGGTGG + Intronic
1009181201 6:60519018-60519040 AAGCACAGGGCCAGGTGAGGTGG + Intergenic
1009609810 6:65927055-65927077 AAGTACACGGCCGGGTGCGGTGG - Intergenic
1010280069 6:74013297-74013319 TGGCACACGGCCGGGCGCGGTGG - Intergenic
1010503110 6:76625195-76625217 TGGCACAAGGCCGGGCGCGGTGG - Intergenic
1011127475 6:84022595-84022617 AGTAAGAGGGCCGGGTGCGGTGG + Intergenic
1011459926 6:87592341-87592363 AGGCACAGGGCTGTGTGCAGTGG + Intronic
1012688351 6:102281291-102281313 ACACACATGGCCGGGTGCGGTGG - Intergenic
1013085804 6:106856514-106856536 AGGCACAGTGCCAGGTGCTGAGG + Intergenic
1013314889 6:108932050-108932072 GGGCAAAGGGCCAGGTGCGGTGG - Intronic
1013662943 6:112317075-112317097 AGTCAAACGGCCGGGTGCGGTGG - Intergenic
1014059327 6:117052245-117052267 AGGCAGTGGGCCGGGTGCGGTGG - Intergenic
1015581663 6:134731512-134731534 AGAAACAGGGCCGGGAGCGGTGG + Intergenic
1015782399 6:136882463-136882485 AGGCAAAGGGCCAGGTGCGGGGG - Intronic
1015939199 6:138431747-138431769 AGGCACAGGGGTGAGTGCTGTGG + Exonic
1016955332 6:149621409-149621431 AGGCACAGGGCCGGGCGCGGTGG - Intronic
1017096297 6:150808460-150808482 AGGGAAGGGGCCGGGTGCGGTGG + Intronic
1017137950 6:151164697-151164719 AGCCAGAGGGCTGGGTGCGGTGG + Intergenic
1018391591 6:163345476-163345498 AGGCTCAGGGCCGGGTGTGGTGG + Intergenic
1019213157 6:170422535-170422557 AGGGTCAGGGCCGGGCGCGGTGG + Intergenic
1019241143 6:170662535-170662557 ATGCACAGGGCTGGGTGCAGTGG - Intergenic
1019303404 7:321046-321068 AGACACAGGGCCAGGTGCGGTGG - Intergenic
1019416603 7:930388-930410 AAACACAGGGCCGGGCGCGGTGG + Intronic
1019654680 7:2184712-2184734 AACCACTGGGCCGGGTGCGGTGG + Intronic
1019724666 7:2594808-2594830 CGGCACAGGGCAGGGTGGGGCGG - Intronic
1020006675 7:4787057-4787079 TGGCACCAGGCCGGGTGCGGTGG - Intronic
1020013625 7:4819027-4819049 AGTCTCAGGGCCGGGTGCAGGGG - Intronic
1020181104 7:5923029-5923051 AGGGCCAGGGCCGGGCGCGGGGG + Intronic
1020225363 7:6275488-6275510 GGGGACTGGGCCGGGTGCGGTGG - Intergenic
1020301829 7:6801859-6801881 AGGGCCAGGGCCGGGCGCGGGGG - Intronic
1020389541 7:7643421-7643443 AGGATCAGGGCCGGGCGCGGTGG + Intronic
1021958894 7:25852913-25852935 AGGCACAGGGCGGCGGGCGCAGG - Intergenic
1023249507 7:38242337-38242359 AGGGAATGGGCCGGGTGCGGTGG - Intergenic
1023411249 7:39891200-39891222 AGACACATGGCCGGGTGCAGTGG + Intergenic
1023714361 7:43028553-43028575 AGACACCAGGCCGGGTGCGGTGG + Intergenic
1023824532 7:44000158-44000180 AGGAAGGGGGCCGGGTGCGGTGG + Intergenic
1023957507 7:44898652-44898674 AGGTTCAGGGCCGGGTGAGGTGG - Intergenic
1024487541 7:49935682-49935704 ATGCAAAGGGCCGAGCGCGGTGG - Intronic
1024768224 7:52686571-52686593 AGATACACGGCCGGGTGCGGTGG - Intergenic
1024831761 7:53468305-53468327 AGGCAAGAGGCCGTGTGCGGGGG - Intergenic
1025267599 7:57477371-57477393 AGGCTTAGGGCCGGGCGCGGTGG + Intergenic
1025697779 7:63788842-63788864 GAACACAGGGCCGGGTGCGGTGG - Intergenic
1025951620 7:66150091-66150113 AGACATGGGGCCGGGTGCGGTGG - Intronic
1026088082 7:67278922-67278944 AGGAAGGGGGCCGGGTGCGGTGG + Intergenic
1026160976 7:67868550-67868572 AGCCACATGGCTGTGTGCGGTGG - Intergenic
1026285513 7:68959320-68959342 AGGAAAGGGGCCGGGTGCGGTGG + Intergenic
1026551408 7:71372202-71372224 AGGCCCAGGCCCGAGTGCAGTGG + Intronic
1026603113 7:71793015-71793037 AGGAGCAGAGCCGGGTGCGGTGG + Intronic
1026686118 7:72511688-72511710 AGGAAGAGGGCCGGGTGCGGTGG + Intergenic
1026998554 7:74635590-74635612 AGATACAGGGCTGGGTGCGGTGG - Intergenic
1027327563 7:77060282-77060304 AGGAAGGGGGCCGGGTGCGGTGG - Intergenic
1027368218 7:77480678-77480700 AGGGAAAGGGCCAGGTGCGGTGG - Intergenic
1027465827 7:78513799-78513821 ATGAAGAGGGCCGGGTGCGGTGG + Intronic
1027615324 7:80416262-80416284 AGTCATAGGGCCGGGCGCGGTGG + Intronic
1027703582 7:81500199-81500221 AGGCACCTGGCCGGGTGCAGTGG - Intergenic
1027783802 7:82553894-82553916 AGGAACAAGGCCAGGTGCGGTGG - Intergenic
1028003007 7:85525094-85525116 ACGTATAGGGCCGGGTGCGGTGG + Intergenic
1028356960 7:89922211-89922233 ATGCAGAGGGCCGGGTGTGGTGG + Intergenic
1028882242 7:95892732-95892754 AGTTACAGGGCCAGGTGCGGTGG - Intronic
1029459808 7:100688090-100688112 AGGCTCAGGGCCCTGTCCGGGGG - Exonic
1029719815 7:102355793-102355815 AGGAAGGGGGCCGGGTGCGGTGG - Intergenic
1029752798 7:102553464-102553486 AGGAAGGGGGCCGGGTGCGGTGG + Intronic
1029770749 7:102652557-102652579 AGGAAGGGGGCCGGGTGCGGTGG + Intronic
1029835626 7:103306670-103306692 AGGAACAGGGCCTGGTGTGGTGG - Intronic
1030313652 7:108092616-108092638 GGGGACAGGGCTGGGTGCGGTGG + Intronic
1032206984 7:129874594-129874616 AGATACAGGGCCGGGTGTGGTGG - Intronic
1032233772 7:130101681-130101703 AGGAAGAAGGCCGGGTGCGGCGG + Intronic
1032279567 7:130490338-130490360 AGGCTCAGGGCCGCGTGTTTGGG - Intronic
1033048293 7:137981887-137981909 AGGCACAGGGCAGCTTTTGGGGG + Intronic
1033246335 7:139719389-139719411 AGGAAGAGGGCTGGGTGCGGTGG - Intronic
1033780541 7:144664089-144664111 GGGCAAAGGGCCGGGCGCGGTGG + Intronic
1033955602 7:146843297-146843319 TGGGACAGGGCCGGGCGCGGTGG - Intronic
1034401007 7:150861315-150861337 AGGCACAGGGCCATGTGTGTAGG + Intronic
1034677043 7:152899270-152899292 GGGCACAGGGCCACGGGCAGAGG + Intergenic
1035018420 7:155786655-155786677 AAACACAAGGCCGCGCGCGGTGG + Intergenic
1035439435 7:158883949-158883971 AGTCACTGGGCCGGGCGCGGTGG - Intronic
1035506972 8:145560-145582 ATGCACAGGGCTGGGTGCAGTGG + Intergenic
1036802583 8:11803131-11803153 ATGCCCAGGGCGGCTTGCGGGGG - Intronic
1036812527 8:11877359-11877381 TGGAACCGGGCCGGGTGCGGTGG + Intergenic
1036824578 8:11966204-11966226 CAGCACAGGGCCGGGTGCAGTGG - Intergenic
1037126862 8:15362166-15362188 AGGGATAGGGCAGGGTGCGGTGG - Intergenic
1037233414 8:16687908-16687930 ATGCAGAGGGCCGGGCGCGGTGG + Intergenic
1037275451 8:17173386-17173408 GAGCACAAGGCCGGGTGCGGTGG + Intronic
1037697927 8:21243661-21243683 AGCAACAGGGCCGGGCGCGGTGG - Intergenic
1038039360 8:23710876-23710898 AGGTTCAGGGCCGGGCGCGGTGG - Intergenic
1038295794 8:26290526-26290548 GGGCTCAGGGCCGGGCGCGGTGG - Intergenic
1038414012 8:27380027-27380049 AAGCACAGGGCCAGGTGCAGTGG - Intronic
1038518203 8:28205283-28205305 AGCCTCTGGGCCGGGTGCGGTGG - Intergenic
1038540204 8:28385449-28385471 AGGGCCAGGGGCGCGGGCGGAGG + Intronic
1038620379 8:29137085-29137107 TGTCACAGGGCCGGGCGCGGCGG - Intronic
1038645908 8:29361882-29361904 CTGCAAAGGGCCGGGTGCGGTGG - Intergenic
1038930228 8:32186175-32186197 AAACACAAGGCCGTGTGCGGTGG + Intronic
1039497419 8:37991411-37991433 AGACAAAGGGCCGGGTGCGGTGG - Intergenic
1039991522 8:42492067-42492089 ATGCACTGGGCTGGGTGCGGTGG + Intronic
1040005315 8:42615982-42616004 AAGAACTGGGCCGGGTGCGGTGG - Intergenic
1040006885 8:42628455-42628477 ACACTCAGGGCCGGGTGCGGTGG - Intergenic
1040019421 8:42727083-42727105 ATGCACAGGGCCGGGCGCCGTGG + Intronic
1040277524 8:46021642-46021664 AGGAACTGTGCAGCGTGCGGGGG - Intergenic
1040645572 8:49392662-49392684 AGGAAGATGGCCGGGTGCGGTGG + Intergenic
1042919023 8:73903456-73903478 AAGAACAGGGCCGGGTGTGGTGG - Intergenic
1043054813 8:75424106-75424128 CTGGACAGGGCCGGGTGCGGTGG - Intronic
1043590686 8:81830280-81830302 AATCACAGGGCCGGGTGTGGTGG + Intronic
1044241035 8:89888876-89888898 AGAGACAGGGCTGGGTGCGGTGG - Intergenic
1044964419 8:97561340-97561362 AGTCATGGGGCCGGGTGCGGTGG + Intergenic
1045086560 8:98693107-98693129 AGACACAGGGCTGGGTGCAGTGG + Intronic
1046076990 8:109324797-109324819 AGGCACAAGGCCGGGCGCCGAGG + Intronic
1047739889 8:127798013-127798035 AAGCAAAGGGCCGGGCGCGGTGG + Intergenic
1047744259 8:127832569-127832591 ATGCACATGGCCGGGTGTGGTGG + Intergenic
1048584765 8:135764687-135764709 AGGCACAGGGCTCTGTGCTGGGG + Intergenic
1048674566 8:136764071-136764093 AGACACAGGGCTGGGTGTGGTGG + Intergenic
1049025904 8:139988679-139988701 AGGCAGAGGGTGGCCTGCGGCGG + Intronic
1049426839 8:142541520-142541542 AGGCCCAGGGCCGTGGGCGTCGG + Intronic
1049532436 8:143160994-143161016 AGGCACAGGGACACGTGCAAAGG - Intergenic
1049752378 8:144291414-144291436 AGCGACCGGGCCGCGTGCGCAGG + Intergenic
1049914891 9:307643-307665 AGACAGTGGGCCGGGTGCGGTGG - Intronic
1051038276 9:12775827-12775849 AGGGACAGGGACCCCTGCGGGGG + Exonic
1051280450 9:15437518-15437540 AGGAACAGGGCCGGGTGCGGTGG - Intronic
1053075932 9:35134793-35134815 AGGAACGGGGCCTGGTGCGGTGG + Intergenic
1053218104 9:36289447-36289469 ACACACAGGGCCGGGTGTGGTGG - Intronic
1053230964 9:36408897-36408919 ATGCACATGGCCGGGTGTGGTGG + Intronic
1054116977 9:61173457-61173479 GAGCACTGGGCCGGGTGCGGTGG - Intergenic
1055341604 9:75290409-75290431 AGGCACTGGGCTGGGTGCTGGGG - Intergenic
1055639935 9:78311544-78311566 ATGAACACGGCCGGGTGCGGTGG + Intronic
1056268880 9:84926517-84926539 AGAAACTGGGCCGGGTGCGGTGG - Intronic
1056419708 9:86412077-86412099 AAGGACAGGGCCGTGTGAGGTGG + Intergenic
1056781059 9:89551463-89551485 AAGCTGAGGGCCGGGTGCGGTGG - Intergenic
1057750035 9:97785212-97785234 AGGCAAAGGGCTGGGCGCGGTGG + Intergenic
1058965681 9:110036220-110036242 AAGCACAGGGCCTGGTGCAGTGG - Intronic
1059034941 9:110744252-110744274 TGGCCCAGGGCCGGGTGCAGTGG - Intronic
1059168040 9:112097684-112097706 AGACTCTGGGCCGGGTGCGGTGG - Intronic
1060355124 9:122899375-122899397 AAGCGCAGGGCCGGGCGCGGTGG - Intronic
1060447725 9:123707105-123707127 AAGCTCAGGGCCGGGCGCGGTGG + Intronic
1060546117 9:124460503-124460525 AGACACAGGGCCAGGTGTGGTGG - Intronic
1060694715 9:125698627-125698649 AGCTACCGGGCCGGGTGCGGTGG - Intronic
1060929862 9:127482428-127482450 AGTCACATGGCCGGGTGCGGTGG - Intronic
1061052702 9:128205578-128205600 AGGCACAGGGACGTGTGGGTGGG + Intronic
1061151980 9:128833968-128833990 AGGAACAAGGCCAGGTGCGGTGG + Intronic
1062437267 9:136551863-136551885 AGGCACAGGTCGGGGTGGGGTGG - Intergenic
1062600401 9:137316517-137316539 CGGCCCAGGGCCGCTTGGGGCGG - Intronic
1203601334 Un_KI270748v1:11769-11791 ATGCACAGGGCTGGGTGCAGTGG - Intergenic
1185635575 X:1549418-1549440 ACGCTCGGGGCCGCGTGCGGCGG + Intergenic
1185691238 X:2156816-2156838 CAGCACAAGGCCGGGTGCGGTGG + Intergenic
1185697470 X:2206066-2206088 AGGCAGAGGGCCGGGCGCGGTGG - Intergenic
1185712801 X:2317537-2317559 AAGCACAGGGCCGCACGCAGTGG - Intronic
1186565856 X:10661598-10661620 AGACACAATGCCGGGTGCGGTGG - Intronic
1187783465 X:22856343-22856365 AGTCTCAGGGCCGGCTGCGGTGG - Intergenic
1187907834 X:24083969-24083991 TGGGATAGGGCCGGGTGCGGTGG + Intergenic
1189022934 X:37361053-37361075 ATGCTCAAGGCCGGGTGCGGTGG + Intronic
1189074026 X:37897195-37897217 GGGCAGAGGGCCGGGTGCGGTGG + Intronic
1189323382 X:40098885-40098907 AGGCACCGGGAGGCGTGTGGGGG + Intronic
1189951476 X:46235648-46235670 AAACACAGGGCCGGGCGCGGTGG - Intergenic
1189986864 X:46561286-46561308 AGGCTGAGGGCTGGGTGCGGTGG - Intergenic
1190280594 X:48926638-48926660 AGGCCCAGGGCCAGGTGCAGTGG - Intronic
1190724103 X:53175761-53175783 ATGCTTAGGGCCGGGTGCGGTGG + Intergenic
1190931256 X:54951163-54951185 AGGCACAGGGCCAAATGCTGTGG + Intronic
1192299274 X:69882993-69883015 AGTTACAGGGCCGGGTGCAGTGG - Intronic
1192571517 X:72210075-72210097 ATATACAGGGCCGGGTGCGGTGG + Intronic
1192726365 X:73757408-73757430 TGACACAGGGCTGGGTGCGGTGG - Intergenic
1193999571 X:88410898-88410920 CGGCACAAGGCCGAGCGCGGTGG - Intergenic
1194190072 X:90824674-90824696 ATACACACGGCCGGGTGCGGTGG + Intergenic
1194999338 X:100626968-100626990 AGACACAGAGCCGGGCGCGGTGG - Intergenic
1195019233 X:100809847-100809869 CGGGAGAGGGCCGGGTGCGGTGG - Intergenic
1195275569 X:103276945-103276967 AGTGACAGGGCCCCGTGCTGTGG - Intergenic
1195595403 X:106683163-106683185 AGGCACTGGGCAGAGTGCTGAGG + Intergenic
1196640339 X:118052223-118052245 AAGTAGAGGGCCGGGTGCGGTGG + Intronic
1196703656 X:118698029-118698051 AGACACAGGGCCGGATGCAGTGG - Intergenic
1196982213 X:121227394-121227416 ACCCAAAGGGCCGGGTGCGGTGG - Intergenic
1197134145 X:123041469-123041491 AGTGAGAGGGCCGGGTGCGGTGG + Intergenic
1197135107 X:123051652-123051674 AGGCAATGGGCCGGGCGCGGTGG + Intergenic
1198200876 X:134417570-134417592 ATACACTGGGCCGGGTGCGGTGG + Intronic
1198424607 X:136504156-136504178 GGGCAGGGGGCCGTGTGCGGTGG - Intronic
1198444121 X:136694338-136694360 AGGGACAAGGCCGGGCGCGGTGG - Intronic
1199387765 X:147242806-147242828 AGGTACAAGGCCGGGCGCGGTGG + Intergenic
1199687477 X:150277265-150277287 AGGCAAAGGGCGGCCTGCGAGGG + Intergenic
1199701731 X:150383189-150383211 TGGGACAGGGCCGGGCGCGGTGG - Intronic
1199735445 X:150682081-150682103 AGCAACAGGGCCGGGCGCGGTGG + Intergenic
1199796912 X:151207486-151207508 AGACAAAGGGCTGGGTGCGGTGG - Intergenic
1199903290 X:152199073-152199095 AGGCAGAGGGCTGGGTGCGGTGG + Intronic
1200279461 X:154763881-154763903 TAGCACAGGGCCGGGCGCGGTGG + Intronic
1201336672 Y:12888674-12888696 ATGGCCAGGGCCGGGTGCGGTGG - Intergenic
1202186556 Y:22190926-22190948 AAGCACTGGGCCGGGCGCGGTGG - Intergenic
1202204803 Y:22395470-22395492 AAGCACTGGGCCGGGCGCGGTGG + Intronic