ID: 919958095

View in Genome Browser
Species Human (GRCh38)
Location 1:202438899-202438921
Sequence TCCAGGCACAGGGCCGCGTG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 230
Summary {0: 2, 1: 0, 2: 0, 3: 17, 4: 211}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
919958095_919958103 5 Left 919958095 1:202438899-202438921 CCGCACGCGGCCCTGTGCCTGGA 0: 2
1: 0
2: 0
3: 17
4: 211
Right 919958103 1:202438927-202438949 CCCCGAAGACGGCCGTGGACTGG 0: 1
1: 0
2: 1
3: 4
4: 36
919958095_919958110 29 Left 919958095 1:202438899-202438921 CCGCACGCGGCCCTGTGCCTGGA 0: 2
1: 0
2: 0
3: 17
4: 211
Right 919958110 1:202438951-202438973 CTGACCTGGAGATGCTCACAGGG 0: 1
1: 1
2: 2
3: 27
4: 211
919958095_919958109 28 Left 919958095 1:202438899-202438921 CCGCACGCGGCCCTGTGCCTGGA 0: 2
1: 0
2: 0
3: 17
4: 211
Right 919958109 1:202438950-202438972 CCTGACCTGGAGATGCTCACAGG 0: 2
1: 0
2: 6
3: 27
4: 212
919958095_919958101 0 Left 919958095 1:202438899-202438921 CCGCACGCGGCCCTGTGCCTGGA 0: 2
1: 0
2: 0
3: 17
4: 211
Right 919958101 1:202438922-202438944 GGTGACCCCGAAGACGGCCGTGG 0: 1
1: 0
2: 1
3: 0
4: 43
919958095_919958106 15 Left 919958095 1:202438899-202438921 CCGCACGCGGCCCTGTGCCTGGA 0: 2
1: 0
2: 0
3: 17
4: 211
Right 919958106 1:202438937-202438959 GGCCGTGGACTGGCCTGACCTGG 0: 1
1: 0
2: 2
3: 18
4: 138
919958095_919958100 -6 Left 919958095 1:202438899-202438921 CCGCACGCGGCCCTGTGCCTGGA 0: 2
1: 0
2: 0
3: 17
4: 211
Right 919958100 1:202438916-202438938 CCTGGAGGTGACCCCGAAGACGG 0: 1
1: 1
2: 0
3: 18
4: 153

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
919958095 Original CRISPR TCCAGGCACAGGGCCGCGTG CGG (reversed) Intronic
900366304 1:2313265-2313287 TCCAGGGACAGGGAACCGTGGGG + Intergenic
902661750 1:17909111-17909133 TCCAGTCACATGGCTGAGTGTGG - Intergenic
903551027 1:24157438-24157460 GCCAGGCCAAGGGCCGGGTGGGG - Exonic
903666726 1:25012473-25012495 TCCATGCACAGGGCTGTGGGAGG - Intergenic
905803812 1:40862006-40862028 TCCAGGCCCGGGCCCGCGTACGG + Exonic
907924602 1:58943952-58943974 ACCAGGCACATGGCAGGGTGAGG + Intergenic
909601005 1:77461321-77461343 TCCACATACAGGGCCGGGTGCGG - Intronic
909632260 1:77779732-77779754 TCCAGGTACAGGGCCAGGGGCGG + Exonic
911840280 1:102674058-102674080 TTGAGGCACAGGGCCAGGTGTGG - Intergenic
912449342 1:109759741-109759763 TGGATGCACAGGGCCGGGTGTGG - Exonic
913028919 1:114877835-114877857 TCCAGGCACAGGGATGGGTGGGG - Intronic
915303560 1:154965325-154965347 TCCTGGCACAGGGCCAGGCGTGG - Intronic
915602510 1:156931056-156931078 CCCATGCACAGGGTAGCGTGGGG - Intronic
917537981 1:175888193-175888215 TGCAGGCACCGGGCAGCTTGGGG + Intergenic
919958095 1:202438899-202438921 TCCAGGCACAGGGCCGCGTGCGG - Intronic
921212920 1:212915420-212915442 TCCAGGCACAGTGCCAGGTGAGG - Intergenic
922252684 1:223864317-223864339 TCCAGACACAGGATGGCGTGGGG + Intergenic
922315216 1:224435232-224435254 TCCAGGCACAGGGCTGTGGTAGG + Intronic
1064735849 10:18381112-18381134 TCCAGACACAGGGCCAGCTGGGG + Intronic
1067560506 10:47301362-47301384 TCCAGGCACTGGGCCCTGTCAGG + Intronic
1067572784 10:47384177-47384199 TGCAGGGACAGAGCCGCGAGCGG - Intronic
1069760452 10:70807097-70807119 GCCAGGCACAGGGTAGCCTGTGG + Intergenic
1070483703 10:76910010-76910032 CACAGGCAAAGGGCTGCGTGAGG + Exonic
1070569647 10:77631403-77631425 GCCAGGCCCTGGGCCGTGTGGGG - Intronic
1070786681 10:79166147-79166169 TGCAGGGACAGGGAGGCGTGTGG - Intronic
1071598543 10:86944895-86944917 TCCAGGCACAAGGGCTTGTGTGG + Intronic
1076674897 10:132142638-132142660 TGCAGGCACCAGGCCTCGTGGGG + Intronic
1077478285 11:2801272-2801294 TACAGGCACAGGGCAGGGTCCGG - Intronic
1078360551 11:10664430-10664452 TTCAGGGACAGGGCCTTGTGGGG + Intronic
1079094499 11:17501882-17501904 CCCAGGAACAGGGCAGTGTGGGG - Intronic
1079249760 11:18778932-18778954 CCCAGGCCCAGGGCAGCATGAGG - Intronic
1083271608 11:61575680-61575702 GCCAGGTACAGGGCCGGGGGAGG + Intronic
1083629684 11:64089154-64089176 TCCAGGCACAGGGCGGGTCGGGG + Intronic
1083644650 11:64165450-64165472 TCCACGCAGGGGGCAGCGTGAGG - Intronic
1087967043 11:104428606-104428628 TGCACACACAGGGCCGGGTGCGG - Intergenic
1089609743 11:119662769-119662791 TCCAGCCACAGGGCAGAGGGAGG - Exonic
1090647445 11:128777198-128777220 TTCAGGCTCAGGGCCGCTGGGGG + Intronic
1091876210 12:3935520-3935542 CACAGGCAAAGGGCCGGGTGAGG + Intergenic
1092160884 12:6314937-6314959 CCCAGCCACAGGGCCCCGGGAGG - Intronic
1092942226 12:13420579-13420601 GCAAGGCACAGGGCGGGGTGGGG - Intergenic
1096259322 12:50081197-50081219 GCCCGGCACGGGGCCACGTGGGG + Intronic
1096707163 12:53429565-53429587 TCCAGGCAGGGGGCTGAGTGAGG - Exonic
1096801860 12:54115689-54115711 TCCAGGCAGAGGGCAGCTTGAGG + Intergenic
1101574108 12:105981531-105981553 GCCAGGCACTGGGCTGGGTGTGG - Intergenic
1105601323 13:21891274-21891296 TCCTGGCCCAGGGCAGGGTGGGG + Intergenic
1107158121 13:37193654-37193676 TCCAGGCAGAGGACCTGGTGAGG + Intergenic
1107994090 13:45843594-45843616 TCCAGGCTCAGAGCCCAGTGGGG + Intronic
1109115699 13:58380474-58380496 TCCAGGGTGAGGGCCACGTGTGG - Intergenic
1113547377 13:111164482-111164504 ACCAAGCACAGGGCCCTGTGTGG - Intronic
1113931893 13:113973008-113973030 TCCGAGCACAGGGCAGCGGGAGG + Intergenic
1113963834 13:114140540-114140562 TCCCGGCACAGGCCTGCGGGCGG - Intergenic
1114534863 14:23416350-23416372 TCAGGGCACAGGGCAGGGTGGGG + Intronic
1116448397 14:45038398-45038420 GCCAGGCACAGAGCGGCGAGGGG + Intronic
1119169683 14:72524974-72524996 TCCAGGTACAGGGCAGGGTGGGG - Intronic
1119445963 14:74663588-74663610 TCCAGACACAGGGGAGCATGCGG + Exonic
1119781355 14:77278470-77278492 CCCAGGCACAGAGCCGCAGGAGG + Exonic
1122370669 14:101227376-101227398 CCCAGTCACACGGCCCCGTGCGG + Intergenic
1125768434 15:42150070-42150092 TCCAGGCAGAAGGCCTCTTGGGG - Intronic
1126375547 15:47993274-47993296 TCCAGGTGCAGAGCCGCCTGTGG - Intergenic
1126467737 15:48976128-48976150 TCCAGGCACAGCGACTCGGGGGG + Intergenic
1128126682 15:65198158-65198180 TCCAGACACAGGGCTGTGGGAGG - Exonic
1128127722 15:65205251-65205273 TCCTGGCACTGGGCAGGGTGTGG - Intronic
1128927183 15:71668428-71668450 TCCAGGCTCAGAGCCTCTTGGGG - Intronic
1129937696 15:79464403-79464425 TCCAGGCACAGTGGCCTGTGAGG + Intronic
1130899851 15:88199096-88199118 TCCAGGGACAGGGTGGGGTGGGG + Intronic
1131088346 15:89598261-89598283 TCCTGGAACTGGGCCGGGTGTGG - Intronic
1131266497 15:90918540-90918562 TGCTGGCACAGGGAGGCGTGTGG - Intronic
1131397530 15:92098291-92098313 TCCAGGCAAGGTGCCCCGTGGGG - Intronic
1132555068 16:568727-568749 TCCAGGCACAGGGCCTGAGGGGG - Exonic
1132656745 16:1044641-1044663 ACCAGGCTCCGGGCCACGTGAGG - Intergenic
1132656811 16:1044887-1044909 CCCAGGCCCAGGGCTGGGTGGGG + Intergenic
1132688592 16:1172433-1172455 GCCAGGCCCAGGGCAGGGTGAGG - Intronic
1132803594 16:1765791-1765813 TCCAGGCAGAGGGTCGTGGGTGG + Intronic
1132888096 16:2191216-2191238 TCCAGGCCCAGGACAGGGTGGGG + Intronic
1133021207 16:2967719-2967741 TCCACGCACAGGATCGCGCGCGG + Intronic
1134134950 16:11671800-11671822 GCCAGGCACAGGGGCTTGTGGGG + Intronic
1136249117 16:28992065-28992087 TCCTGGAACTGGGCCGGGTGTGG + Intergenic
1136690502 16:32025020-32025042 TCCAGTCACAGGGCTGAGGGTGG + Intergenic
1136791089 16:32968580-32968602 TCCAGTCACAGGGCTGAGGGTGG + Intergenic
1136878725 16:33885352-33885374 TCCAGTCACAGGGCTGAGGGTGG - Intergenic
1137669177 16:50269442-50269464 TCCAGGCACAGGGCAGGGTAGGG - Intronic
1137715259 16:50594675-50594697 ACCAGGCTCAGGGCCACCTGGGG + Intronic
1141923719 16:87153452-87153474 TGCAGGAGCAGGGCTGCGTGAGG - Intronic
1203093297 16_KI270728v1_random:1230041-1230063 TCCAGTCACAGGGCTGAGGGTGG + Intergenic
1142637055 17:1264266-1264288 TCCAGGTCCAGGGCGGTGTGGGG - Intergenic
1143036808 17:4004168-4004190 TCCACACACAGGGCGCCGTGGGG - Intergenic
1143136476 17:4715229-4715251 GCCAGCCACAGGGCTGGGTGGGG + Intronic
1147153361 17:38531156-38531178 TCCAGTCACAGGGCTGAGGGTGG + Exonic
1148053571 17:44780720-44780742 TCCAGGCACTGGGCCACCTCTGG - Exonic
1150154991 17:62845523-62845545 TCATGGCCCAGGGCCGGGTGTGG + Intergenic
1151509603 17:74550176-74550198 TCCAGGCAGAGGGAGGAGTGAGG - Intergenic
1151699795 17:75737146-75737168 ACCAGGCACAGGAACGGGTGTGG - Intronic
1151870818 17:76835271-76835293 CCCTGGCACAGGGCTGGGTGGGG - Intergenic
1152238476 17:79150244-79150266 TCAAGGCACAAAGCCTCGTGGGG + Intronic
1156448126 18:37251829-37251851 GCCAGGCACTGGGCCCAGTGTGG - Intronic
1156494500 18:37517055-37517077 TCCAAGCACAGGGATGGGTGAGG + Intronic
1159858590 18:73618742-73618764 TCCATGGGCAGGGCCGTGTGCGG + Intergenic
1160398197 18:78587742-78587764 TGCAGGGACAGGGCTCCGTGAGG - Intergenic
1160951098 19:1667770-1667792 TCCTGGCCCAGGGCGCCGTGGGG + Intergenic
1161012984 19:1969076-1969098 TCCAGGCCCAGGGCCGCTCTGGG - Intronic
1162033305 19:7926360-7926382 TGCAGGCACAGGGCAGGCTGGGG - Intergenic
1162078202 19:8202961-8202983 TGCTGGCACAGGGGCGCTTGTGG + Intronic
1162455012 19:10778321-10778343 TCCAGGAAGATGGCCGGGTGCGG - Intronic
1163388585 19:17015669-17015691 TCCAGAAACAGGGCCAGGTGAGG - Intronic
1163654593 19:18538395-18538417 TCCAGGCACAGGGCCGCGTGCGG + Exonic
1165000507 19:32758033-32758055 GCCAGGCCCAGGGCTGAGTGAGG - Intronic
1165233774 19:34404490-34404512 TCCAGGCACCCGGCCCTGTGGGG - Exonic
1166048229 19:40242248-40242270 TGCAGGCACAGGGCCTTGGGAGG + Intronic
1166338170 19:42121661-42121683 GCCAGGCACAGGGCCCCATCTGG + Intronic
1166706113 19:44908901-44908923 TGGTGGAACAGGGCCGCGTGCGG + Exonic
1166800955 19:45456564-45456586 GCCAGGCACAGTGACTCGTGAGG + Intronic
1167192208 19:47999037-47999059 TCCAGGCACAGGGATCAGTGAGG - Intronic
1167383826 19:49152859-49152881 ACCAGGGGCAGGGCCGGGTGTGG - Intronic
1167446471 19:49540755-49540777 TCCAGGCACAGTGCGGCCTCTGG + Intronic
1167505874 19:49870825-49870847 ACCAGGAACAGGGCCTGGTGCGG - Intronic
1167574192 19:50309848-50309870 TCCTGGGACAGGGGCCCGTGGGG - Exonic
1168330367 19:55564396-55564418 GCCAGGCTCAGGGCTGGGTGTGG + Intergenic
925066236 2:930754-930776 TCCATGCACAGGGCCCGATGTGG - Intergenic
925808065 2:7672102-7672124 TCCAGGGACAAGGCCTCATGAGG - Intergenic
926783777 2:16499944-16499966 TCCAAGCACAGGGCTCAGTGTGG - Intergenic
928465149 2:31516463-31516485 TCCAGCCACAGGGCAGAGAGGGG - Intergenic
929532948 2:42763801-42763823 TGGAGGTCCAGGGCCGCGTGTGG + Exonic
931695028 2:64865143-64865165 ACCGGGCACAGGGCGGGGTGGGG - Intergenic
932581689 2:72996273-72996295 CACAGGCACAGCCCCGCGTGAGG + Intronic
932624048 2:73284233-73284255 TCCAGACGCAGGGCCGCCTTGGG + Exonic
934663244 2:96154240-96154262 CCCAGGAGCAGGGCCGAGTGAGG + Intergenic
935618919 2:105112121-105112143 GCCTAGCACAGGGCTGCGTGGGG - Intergenic
936251720 2:110873103-110873125 TTCAGGGACAGGGCCGCCTGGGG - Intronic
937294248 2:120800107-120800129 ATCAGGCACAGGGCTGGGTGTGG + Intronic
937995993 2:127695553-127695575 TCCCGGGACAGGCCCGCGCGGGG + Intergenic
938062299 2:128263074-128263096 TCCAGGGACAGGGCCGTGGCTGG + Intronic
940086970 2:149871144-149871166 TCCAGGGAAAGGGACGCCTGAGG - Intergenic
944667347 2:201968761-201968783 TCCAGGCACAGGGAGGCCTCTGG + Intergenic
947368113 2:229417425-229417447 TCCTGGAACAGGGCCGTCTGAGG + Intronic
947636110 2:231681370-231681392 GCCAGGCACAGGCCCGCTTGTGG + Intergenic
947640728 2:231706572-231706594 TCCAGCCACTGGGGCGCCTGGGG + Intergenic
947983427 2:234428834-234428856 TCCAGGAACGGGGCTGCATGTGG - Intergenic
948728257 2:239947623-239947645 TCCAGGCCCAGGGTCCTGTGAGG + Intronic
948857119 2:240735356-240735378 TCCAGGAACAGGGTGGCCTGAGG + Intronic
948903500 2:240967409-240967431 CCCGGGCCCAGAGCCGCGTGGGG + Intronic
1170750045 20:19137384-19137406 TCAGGGCACAGGGGCCCGTGTGG + Intergenic
1171794851 20:29558777-29558799 TCCAGGCAGAGGGCAGCTTGAGG - Intergenic
1171853605 20:30325488-30325510 TCCAGGCAGAGGGCAGCTTGAGG + Intergenic
1174332556 20:49831669-49831691 TCCAGACAGAGGGTCCCGTGGGG + Intronic
1174356707 20:50003173-50003195 TCCTGGTGCAGGGCCGGGTGTGG - Intergenic
1175914299 20:62418616-62418638 CCCAGGCACGGGGCTGCCTGAGG + Intronic
1176077679 20:63255644-63255666 TCCAGGCTCATGGGCGGGTGAGG + Intronic
1176107548 20:63396478-63396500 ACCAGGCGCAGGGCTGTGTGGGG + Intergenic
1179309762 21:40185271-40185293 TCCAGGCAGAGGGCAGCTGGTGG + Intronic
1179787885 21:43740135-43740157 TCCAGGCACAGTGCGGCATCTGG - Intronic
1179815077 21:43900474-43900496 TCCAGCCACAGGGCAGGGAGGGG + Intronic
1179912658 21:44458452-44458474 GCAAGGCACAGGGCCGGGCGCGG - Exonic
1180175302 21:46084298-46084320 AGCAGCCACAGGGCCGGGTGTGG - Intergenic
1181622373 22:24099847-24099869 TCCAAGCACAGTGGCGCATGTGG - Intronic
1183040898 22:35177232-35177254 TCCAGGGACAGGGCAGCCTTTGG + Intergenic
1184278972 22:43426480-43426502 TCCAGGCCCTGGGCCGCCTCTGG + Intronic
1184793078 22:46713212-46713234 TCCAGACACAGGGCCAGGCGCGG + Intronic
1184912137 22:47543206-47543228 TCCAGGCTCAGGGCCGGGCGCGG - Intergenic
1185169214 22:49282713-49282735 TCCAGGCACAGGGACCTGGGTGG - Intergenic
953901387 3:46845974-46845996 TCTGGGCACAGGGGCGCGGGTGG - Intergenic
954392815 3:50276278-50276300 TGCGGGCAGAGGGCAGCGTGAGG - Intronic
954637886 3:52081377-52081399 GCCAGGCACAGGCCAGCGTTGGG - Intronic
956624454 3:71253057-71253079 TCCAGGTACTGGGCCAAGTGGGG + Intronic
956630279 3:71310544-71310566 GCCAGGCAGAGGGCCACGTCTGG + Intronic
961364392 3:126390062-126390084 TCCAGGCAGAGGGCACCGAGGGG + Intergenic
964335529 3:155650023-155650045 TACAGGCACAGGGAGGCGTGAGG + Intronic
966085958 3:176067505-176067527 TCCACGCACTGGGCCGGGCGCGG + Intergenic
967220174 3:187242017-187242039 TCCAGGACCTGGGCAGCGTGGGG - Intronic
968557165 4:1251441-1251463 CCCAGGCACAGGGAGGCGGGTGG - Intergenic
968698637 4:2044381-2044403 TCCAGGCTCAGGGCTGCAGGTGG - Intergenic
968949090 4:3681143-3681165 TCCAGGCACTGGGGCGCCTTTGG - Intergenic
969056353 4:4405229-4405251 TATAGGGAGAGGGCCGCGTGAGG - Intronic
973777264 4:54254967-54254989 GACAGGCACTGGGCCGGGTGGGG + Intronic
983075541 4:163321281-163321303 TTCAGGCAGAGGGTGGCGTGTGG + Intergenic
984882237 4:184420156-184420178 AAGAGGCACAGGGCCGGGTGTGG - Intronic
985441440 4:189984638-189984660 CCCAGGGACAGGGCGGCCTGGGG - Intergenic
985677997 5:1242265-1242287 TCCATGCACACTGCCGGGTGAGG - Intronic
986722728 5:10571532-10571554 TCCAGGCACAAGCCCCAGTGTGG - Intronic
992950337 5:81851859-81851881 TGCAGGCACAGGGCGCCGAGAGG - Intergenic
998157756 5:139796042-139796064 GCCGGGGAGAGGGCCGCGTGCGG + Intronic
998317431 5:141194879-141194901 TTCAGGCACAGGGCCCTGGGAGG + Exonic
1003117739 6:3294544-3294566 TGAAGGCACAGTGCCGTGTGTGG + Intronic
1003606597 6:7567016-7567038 TCCAGGAACAGGGCTCGGTGTGG + Intronic
1003720905 6:8701054-8701076 TCCAGGCAGAGGGAAGAGTGGGG - Intergenic
1003921194 6:10835063-10835085 TCCAGACGCAGGACTGCGTGGGG - Intronic
1004262255 6:14118240-14118262 TCCAGGTACAGGGCCGAATTAGG + Intronic
1006046910 6:31306626-31306648 TCCAGGAGCAGGGCCACATGGGG - Intronic
1007733523 6:43966174-43966196 TCCAGGCACAGGGCTGAAGGGGG - Intergenic
1012813934 6:103998212-103998234 TCCAGGCACACTGCCAAGTGAGG + Intergenic
1013225542 6:108117716-108117738 TCGAGGCACCGGGCTGGGTGGGG - Intronic
1013941414 6:115667716-115667738 ACCAGGCACAGGGCCAGGTAAGG + Intergenic
1014059328 6:117052248-117052270 TACAGGCAGTGGGCCGGGTGCGG - Intergenic
1017017492 6:150113594-150113616 TCCAGACACAGCCCCACGTGAGG + Intergenic
1017676209 6:156816758-156816780 TCCAGGTACAGGGCGGGCTGAGG + Intronic
1018085900 6:160300796-160300818 GCCAGGCACTGGGCTGCTTGTGG - Intergenic
1018948833 6:168365322-168365344 TCCGGGCACACGGACGCCTGAGG + Intergenic
1029459812 7:100688093-100688115 TCCAGGCTCAGGGCCCTGTCCGG - Exonic
1029524685 7:101087655-101087677 TCCAGGCACCGGGCCGTGGCCGG - Exonic
1032789787 7:135233753-135233775 GCCAGGGACAGGGCCGCGATTGG + Intronic
1033889800 7:145997572-145997594 TCCAGGCACATGGCTGCCTCAGG - Intergenic
1034243262 7:149625137-149625159 TCCAGGCCCAGGACCTCGGGCGG - Intergenic
1034415059 7:150959884-150959906 GGCAGGCACATGGCCGGGTGGGG - Intronic
1034431425 7:151043183-151043205 TGCAGGCACAGGGCAGGGTGTGG + Intronic
1034489991 7:151387994-151388016 TTCAGGCCCTGGGCTGCGTGTGG - Intronic
1035275612 7:157746308-157746330 TCCTTGCTCAGGGCCCCGTGAGG - Intronic
1035275625 7:157746359-157746381 TCCTTGCTCAGGGCCCCGTGAGG - Intronic
1037797717 8:22010466-22010488 GCCAGGCACACGGCGCCGTGGGG - Intergenic
1040492981 8:47942006-47942028 TCCTAGCACAGGGCTGGGTGGGG - Intronic
1041205375 8:55494090-55494112 GCCAGGCACAGAGCAGCGAGGGG + Intronic
1044425689 8:92047232-92047254 TCCAGGCAGAGGGTAGAGTGTGG - Intronic
1047744258 8:127832566-127832588 TTCATGCACATGGCCGGGTGTGG + Intergenic
1049408746 8:142463193-142463215 TACAGGCACAGGGCCTGGGGAGG - Intronic
1053038969 9:34852901-34852923 TCCAGGTACAGAGCTGGGTGTGG - Intergenic
1053791411 9:41688785-41688807 TCCAGGCAGAGGGCAGCTTGAGG + Intergenic
1054153746 9:61625985-61626007 TCCAGGCAGAGGGCAGCTTGAGG - Intergenic
1054179760 9:61900478-61900500 TCCAGGCAGAGGGCAGCTTGAGG + Intergenic
1054473530 9:65557105-65557127 TCCAGGCAGAGGGCAGCTTGAGG - Intergenic
1054657781 9:67680342-67680364 TCCAGGCAGAGGGCAGCTTGAGG - Intergenic
1056453722 9:86740600-86740622 TCCAGGCACAGGTCGGCCTTGGG - Intergenic
1061160902 9:128893149-128893171 CCCAGGCTCAGGACCCCGTGTGG - Intronic
1061418899 9:130462705-130462727 TCCAGGAACGGGGCCGGCTGGGG + Intronic
1061992107 9:134164989-134165011 TCCCGGGGCAGGGCCGCGTCCGG - Intergenic
1062437269 9:136551866-136551888 ACCAGGCACAGGTCGGGGTGGGG - Intergenic
1062521896 9:136961409-136961431 TGCAGGGACAGGGCTGCGAGGGG + Intergenic
1185467194 X:362034-362056 TCCAGGGACAGGGTTGCCTGTGG - Intronic
1187146286 X:16640275-16640297 TCCAGGCAGAGGGCACAGTGTGG - Intronic
1188659739 X:32743982-32744004 GCTAGGCACAGGGCAGGGTGTGG + Intronic
1200009203 X:153108662-153108684 TCCAGGCCCAGCCCCGCCTGTGG + Intergenic
1200030397 X:153291260-153291282 TCCAGGCCCAGCCCCGCCTGTGG - Intergenic
1200229143 X:154435460-154435482 GCCAGGGAGAGGGCTGCGTGCGG - Exonic