ID: 919958097

View in Genome Browser
Species Human (GRCh38)
Location 1:202438909-202438931
Sequence CGGGGTCACCTCCAGGCACA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 217
Summary {0: 1, 1: 1, 2: 0, 3: 8, 4: 207}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
919958097_919958109 18 Left 919958097 1:202438909-202438931 CCCTGTGCCTGGAGGTGACCCCG 0: 1
1: 1
2: 0
3: 8
4: 207
Right 919958109 1:202438950-202438972 CCTGACCTGGAGATGCTCACAGG 0: 2
1: 0
2: 6
3: 27
4: 212
919958097_919958103 -5 Left 919958097 1:202438909-202438931 CCCTGTGCCTGGAGGTGACCCCG 0: 1
1: 1
2: 0
3: 8
4: 207
Right 919958103 1:202438927-202438949 CCCCGAAGACGGCCGTGGACTGG 0: 1
1: 0
2: 1
3: 4
4: 36
919958097_919958106 5 Left 919958097 1:202438909-202438931 CCCTGTGCCTGGAGGTGACCCCG 0: 1
1: 1
2: 0
3: 8
4: 207
Right 919958106 1:202438937-202438959 GGCCGTGGACTGGCCTGACCTGG 0: 1
1: 0
2: 2
3: 18
4: 138
919958097_919958112 23 Left 919958097 1:202438909-202438931 CCCTGTGCCTGGAGGTGACCCCG 0: 1
1: 1
2: 0
3: 8
4: 207
Right 919958112 1:202438955-202438977 CCTGGAGATGCTCACAGGGCAGG 0: 1
1: 1
2: 3
3: 38
4: 314
919958097_919958110 19 Left 919958097 1:202438909-202438931 CCCTGTGCCTGGAGGTGACCCCG 0: 1
1: 1
2: 0
3: 8
4: 207
Right 919958110 1:202438951-202438973 CTGACCTGGAGATGCTCACAGGG 0: 1
1: 1
2: 2
3: 27
4: 211
919958097_919958101 -10 Left 919958097 1:202438909-202438931 CCCTGTGCCTGGAGGTGACCCCG 0: 1
1: 1
2: 0
3: 8
4: 207
Right 919958101 1:202438922-202438944 GGTGACCCCGAAGACGGCCGTGG 0: 1
1: 0
2: 1
3: 0
4: 43

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
919958097 Original CRISPR CGGGGTCACCTCCAGGCACA GGG (reversed) Intronic
900312692 1:2041788-2041810 CGGGGTCTGCTCCCTGCACAAGG + Intergenic
900549579 1:3247532-3247554 CGGAGCCACCGCCAGGCGCAGGG + Intronic
901632058 1:10652913-10652935 CCTGGACACCTCCAGGCCCAGGG - Intronic
913426591 1:118738152-118738174 GGAGGTCACCACCAGCCACAGGG - Intergenic
915558883 1:156675221-156675243 CGTGGCCACCTCCAGGCTGAGGG + Exonic
915734947 1:158078668-158078690 GGGGGCCTCCTCCAGGAACAGGG + Intronic
916763663 1:167839791-167839813 CTAGGTCACTTCCTGGCACATGG + Intronic
919958097 1:202438909-202438931 CGGGGTCACCTCCAGGCACAGGG - Intronic
1062830154 10:600052-600074 CGGGCCCAGCTCCAGGCAGAGGG + Intronic
1063105126 10:2986042-2986064 CCGGCCCACCTGCAGGCACAGGG + Intergenic
1064956875 10:20921324-20921346 CAGGGTCTCCTCCTGGGACATGG - Intronic
1067046402 10:42987693-42987715 TAGGGTCACCTCCAGCCCCAGGG - Intergenic
1067469685 10:46527552-46527574 CGGGCTCAGCTCCAGTCCCAAGG - Intergenic
1067529047 10:47057278-47057300 CTGTGGCACATCCAGGCACATGG + Intergenic
1067703699 10:48591335-48591357 CGAAGTCACCCCGAGGCACAGGG + Intronic
1068657635 10:59591556-59591578 CTGGGTCATCACCAGGCCCATGG - Intergenic
1070102121 10:73398238-73398260 CTGGATAACCTCCAGGCGCAGGG + Exonic
1070264909 10:74892894-74892916 CAGGGGCAGCTCCAGCCACATGG - Intronic
1073070976 10:100793138-100793160 CGGGGACAGCACCAGGCAGAGGG + Intronic
1073206469 10:101772022-101772044 AGGGGTGACCTCCAGTCCCAAGG + Intronic
1076011730 10:126994847-126994869 CGGGGTGGCCACCAGGCAGAGGG + Intronic
1076075702 10:127532162-127532184 CGGGGTCTGAGCCAGGCACATGG - Intergenic
1076921844 10:133458402-133458424 CCAGGTCACCTCCAGGCGCCCGG - Intergenic
1077188346 11:1245379-1245401 CAGGGCCACCTCCAGGACCACGG + Exonic
1077348000 11:2073223-2073245 AGGGTTCTCCTTCAGGCACAGGG + Intergenic
1081635501 11:44718825-44718847 CCGGGCCATCTCCAGGCTCAAGG - Intergenic
1081991132 11:47338241-47338263 AGGCATCACCCCCAGGCACAGGG + Intronic
1083163397 11:60869194-60869216 CTGGGTCACCTCCAGGCCGCAGG + Exonic
1083614703 11:64020604-64020626 GAGGGTCTCCTCCAGGCAGAGGG - Intronic
1083891998 11:65600092-65600114 AGGGGCAACCTCCAGGCCCAGGG + Intronic
1084065312 11:66700700-66700722 CCGGGTCACCTCCTCGCCCAGGG + Exonic
1084612227 11:70210677-70210699 TTGAGTCACCCCCAGGCACATGG + Intergenic
1085083285 11:73650589-73650611 CAGGGTCCCGTCCAGCCACAGGG - Exonic
1087223113 11:95567812-95567834 CTGGATCACCTCCAGGGAAAGGG + Intergenic
1089324054 11:117645054-117645076 CGGCTTCACCTGCAGGAACACGG + Intronic
1092948028 12:13474998-13475020 CAGGGTCCCCTCCAGGCCTAAGG + Intergenic
1094080552 12:26529951-26529973 CTGGTTCAGCTCCTGGCACATGG + Intronic
1094334933 12:29338920-29338942 TGGAGGCACCTCCAGGCATAGGG + Exonic
1095821679 12:46485522-46485544 GAAGGTCACATCCAGGCACAGGG + Intergenic
1098222332 12:68283329-68283351 CTGGGGCACCACCAGGCACCTGG - Intronic
1101412483 12:104481019-104481041 CTGAGTCACATCCCGGCACAGGG - Intronic
1102219581 12:111185642-111185664 CGGGGTCCCCTCGGGGCTCAGGG - Intronic
1103673652 12:122638971-122638993 AGGGGTCATCTCCAGGAAAATGG + Intergenic
1104138015 12:125958891-125958913 CGAGGTCACCTCAAGGTCCACGG + Intergenic
1104917123 12:132271532-132271554 CGGCGTCACCTCGGGGGACAGGG - Intronic
1105438539 13:20397303-20397325 AGAGGTCATCTCCATGCACATGG + Intergenic
1112375477 13:98836158-98836180 TGGGGTGAGCTACAGGCACACGG - Intronic
1113262519 13:108580718-108580740 TGGGATCATCTCCAGGCAAATGG - Intergenic
1113439916 13:110320242-110320264 CCAGGTCACCTCCGGGCACTGGG + Intronic
1113546351 13:111153978-111154000 CGCGCTCACCTCCAGCCGCAGGG - Exonic
1114671726 14:24415225-24415247 CACGGTCACCTCCAGGCGGAAGG - Exonic
1115257706 14:31420425-31420447 CGGGGACACCTCCGGGCGCGAGG - Intronic
1116812990 14:49556919-49556941 AGGGGTCACATCTAGGCTCAGGG + Intergenic
1119327693 14:73771172-73771194 CTGGCACACCTCCAGCCACAAGG + Intronic
1120764073 14:88312393-88312415 TGCCGTCACCCCCAGGCACACGG + Intronic
1122552001 14:102555372-102555394 CGGGGTCCCCTCCCGGCAAATGG - Intergenic
1123433467 15:20237627-20237649 CAGGGGCACCTACAGGTACAGGG - Intergenic
1123931884 15:25175896-25175918 AGGGGTAACTTCCAGCCACAGGG - Intergenic
1123933124 15:25181451-25181473 AGGGGTGACTTCCAGCCACAGGG - Intergenic
1123935555 15:25192389-25192411 AGGGGTGACTTCCAGCCACAGGG - Intergenic
1123940165 15:25212876-25212898 AGGGGTCACCTCCAGGGTCTCGG + Intergenic
1123942756 15:25224525-25224547 AGTGGTCACCTCCAGGGTCATGG + Intergenic
1123944327 15:25231700-25231722 TAGGGTCACCTCCAGGGTCATGG + Intergenic
1124413877 15:29458571-29458593 CTGGGTCACCTCCAAGTCCAGGG - Intronic
1129844025 15:78760041-78760063 CGTGACCACCTCCAGCCACAGGG + Intronic
1130257781 15:82333759-82333781 CGTGACCACCTCCAGCCACAGGG - Intergenic
1130597154 15:85256204-85256226 CGTGACCACCTCCAGCCACAGGG + Intergenic
1130957814 15:88639537-88639559 CGGGGTCACCCCTCAGCACATGG + Exonic
1132568453 16:633834-633856 CAGCGTCACCTCCAGGTACTTGG - Exonic
1132601680 16:775657-775679 GGGGTTCCCCTCCAGGCAGAGGG - Intronic
1132816143 16:1827522-1827544 GGCGGTCATATCCAGGCACAGGG - Exonic
1132896048 16:2229882-2229904 CGGGGGCACACCCAGGCACCAGG + Intronic
1132932700 16:2467124-2467146 AGGGGGCGCCTCCAGGGACAGGG + Intergenic
1133139285 16:3732409-3732431 CGGGGTCCACTCAAGGCCCACGG + Intronic
1136851158 16:33613501-33613523 CAGGGGCACCTACAGGTACAGGG + Intergenic
1138189277 16:55000902-55000924 CAGGGTCACCCCTAGGTACATGG - Intergenic
1138193591 16:55036086-55036108 TTGGGTCACCTCCAGGCAGCTGG + Intergenic
1138220438 16:55245801-55245823 AGGTGTCACTTGCAGGCACAGGG + Intergenic
1138683938 16:58708209-58708231 AGGGGTCACCTCCAGCAACGTGG - Exonic
1140208206 16:72950489-72950511 CACGGTCAACTCCAGGCACGAGG - Exonic
1142140354 16:88470047-88470069 TGGGGACACAGCCAGGCACAGGG - Intronic
1142278053 16:89133276-89133298 CGGGGTCTCCTCCACTCCCATGG - Intronic
1203112761 16_KI270728v1_random:1461962-1461984 CAGGGGCACCTACAGGTACAGGG + Intergenic
1144828856 17:18120977-18120999 GGGGGGCACCTCCGGGCTCACGG - Exonic
1145418091 17:22741185-22741207 CGGGGTCACGGCCGGGCAGAGGG - Intergenic
1146212095 17:30950684-30950706 TAGGGTCCCCTCCAGGCCCAGGG + Intronic
1151311496 17:73295359-73295381 TGGGCTCACCGCCAGGCACTAGG + Intronic
1151455790 17:74225163-74225185 CGGAGACACCTCCAGGCAGAGGG + Intronic
1152380547 17:79940411-79940433 CGGGGTCCTGTCCAGGCCCAGGG - Exonic
1152428872 17:80236405-80236427 GGGGGTCCCCTCCATACACATGG + Intronic
1152733906 17:81987435-81987457 CGGGGGCACCGCCCGGCCCAGGG - Intronic
1152880032 17:82809232-82809254 CGGGGCCATCTCCAGGGACTTGG + Intronic
1153093125 18:1371093-1371115 CAGGCTCACCTCCAATCACAGGG - Intergenic
1157713410 18:49865583-49865605 CTGGGTCCCCTCCTGGCTCAAGG + Intronic
1160076088 18:75679227-75679249 TGGGGTCACCTGAAGGAACAGGG - Intergenic
1161018802 19:1998227-1998249 GGGAGTCAGCTACAGGCACAGGG + Intronic
1162588591 19:11576638-11576660 CAGGGTCAGCTCAAGCCACAGGG + Intronic
1163167854 19:15509771-15509793 CTGGGTCACCGCCAGACACCAGG - Intronic
1163178595 19:15583379-15583401 CAGGCTCTCCTTCAGGCACATGG - Intergenic
1163184458 19:15628331-15628353 CAGGCTCTCCTTCAGGCACATGG - Exonic
1163654591 19:18538385-18538407 CAGGGTCACCTCCAGGCACAGGG + Exonic
1166198362 19:41220713-41220735 CGGTGTCAGCTCCAGGTTCAGGG + Exonic
1167017349 19:46849866-46849888 CGGAGTCTCCTCCAGGAACAGGG - Intronic
1167409783 19:49338075-49338097 TGGAGTCTCCTCCAAGCACAGGG - Intronic
1167587494 19:50383200-50383222 CAGGGTCACCTCCCTGGACAAGG + Intergenic
1167618873 19:50550498-50550520 CAGGCTCACCCCCAGGCACACGG + Intronic
1168129736 19:54310667-54310689 GGGGGTCACTTCCAAGCTCAGGG + Intronic
926192563 2:10739629-10739651 CGGGGTCACCTAGAGGGACCGGG - Intronic
927674876 2:25097993-25098015 CTGGGTCAGCTCCAGGGCCAGGG - Intronic
936042145 2:109158256-109158278 CAGGGCCACCTCCAGGCTCCCGG + Intronic
937234401 2:120421788-120421810 CGGGGTCTCCTGCAGACCCAGGG - Intergenic
937915076 2:127094928-127094950 TGGGGCCTCCTCCAGGCCCATGG + Intronic
937958554 2:127437736-127437758 CAGGGCCAGCTCCAGGCACCAGG - Intronic
946135624 2:217644576-217644598 TGGGGTCACCACCAGGGCCAGGG - Intronic
947113768 2:226747642-226747664 TGGGGTCACCTTCAGACCCATGG + Intronic
948079042 2:235190432-235190454 GAGGGTCACCTGCATGCACAGGG + Intergenic
948401869 2:237691310-237691332 CCGCGCCACCTCCAGGCACAGGG - Intronic
1172731945 20:37095839-37095861 CAGGTTCAGCTCCTGGCACAGGG + Exonic
1172886840 20:38237013-38237035 CAGGGTCAGCCTCAGGCACATGG + Intronic
1173585190 20:44176971-44176993 CAGGAAGACCTCCAGGCACAAGG + Intronic
1173810479 20:45952318-45952340 CGGGGGCACTGCCAGGCCCAGGG + Exonic
1173811251 20:45957252-45957274 TGGGGGCACCCACAGGCACATGG + Intronic
1175940875 20:62536989-62537011 CAGGGGCACCTCCAGGCCCCGGG - Intergenic
1176177885 20:63737285-63737307 CGTGGTCACCCGCAGGGACACGG + Intronic
1179584790 21:42367663-42367685 TGGGGCCACCTCAAGGCACTAGG - Intergenic
1179624007 21:42638017-42638039 CCGGGTCAGCTCCTGGAACAGGG - Intergenic
1179800402 21:43809040-43809062 CGGAGTCACCTCCAGGTAAAGGG - Intergenic
1181512874 22:23396587-23396609 AGGGGCCACCTGCTGGCACAGGG - Intergenic
1184774057 22:46614766-46614788 CGGGGGAACCTACACGCACAGGG - Intronic
1184774097 22:46614941-46614963 CGGGGGAACCTACATGCACAGGG - Intronic
1184774106 22:46614975-46614997 CGGGGGAACCTACATGCACAAGG - Intronic
1184774124 22:46615043-46615065 CGGGGGAACCTACACGCACAGGG - Intronic
1184774168 22:46615231-46615253 CGGGGGAACCTACATGCACAAGG - Intronic
1184774186 22:46615299-46615321 CGGGGGAACCTACACGCACAGGG - Intronic
1184774252 22:46615575-46615597 CGGGGGAACCTACACGCACAGGG - Intronic
1184774270 22:46615642-46615664 CGGGGGAACCTACACGCACAGGG - Intronic
1184774287 22:46615708-46615730 CGGGGGAACCTACACGCACAGGG - Intronic
1184774305 22:46615776-46615798 CGGGGGAACCTACACGCACAGGG - Intronic
1184774328 22:46615860-46615882 CGGGGGAACCTACACGCACAGGG - Intronic
1184774337 22:46615894-46615916 CGGGGGAACCTACACGCACAGGG - Intronic
1184774421 22:46616232-46616254 CGGGGGAACCTACACGCACAGGG - Intronic
1184774461 22:46616404-46616426 CGGGGGAACCTACACGCACAGGG - Intronic
1184774470 22:46616438-46616460 CGGGGGAACCTACACGCACAGGG - Intronic
1184774533 22:46616694-46616716 CGGGGGAACCTACACGCACAGGG - Intronic
1184774590 22:46616934-46616956 CGGGGGAACCTACACGCACAGGG - Intronic
1184774599 22:46616968-46616990 CGGGGGAACCTACACGCACAGGG - Intronic
1184774730 22:46617479-46617501 CGGGGAAACCTACACGCACAGGG - Intronic
1185339795 22:50286175-50286197 CAGGTTCTCCTCCAGGCTCATGG + Exonic
951144223 3:19206984-19207006 CTGAGTTACCTCCAGGCAAATGG + Intronic
954514759 3:51163550-51163572 AGGGGTCACAAGCAGGCACAGGG + Intronic
960937570 3:122913014-122913036 CGGGAGCACCTCCCCGCACACGG - Exonic
960974630 3:123162214-123162236 AGGAGTCACCTCCATGCAGATGG - Intronic
962593587 3:136916131-136916153 CGCAGTCACCTCCAGTCACCTGG + Intronic
966752034 3:183331324-183331346 CGGGGTCACCTCACGCCGCATGG - Intronic
968044823 3:195618114-195618136 CGGGGGAACCTCCAGAGACAGGG - Intergenic
968060606 3:195724166-195724188 CGGGGGAACCTCCAGAGACAGGG - Intronic
968472197 4:787251-787273 TGCGGTCACTTCCAGGCACTGGG + Intronic
968972087 4:3801274-3801296 AGTCGTCACCTCCAGGCAAAGGG - Intergenic
969725096 4:8914011-8914033 CAGGCTCCCCTGCAGGCACAAGG - Intergenic
976468233 4:85396011-85396033 TGGGGTCACTTCCAGAAACATGG - Intergenic
980983291 4:139672021-139672043 TGGGCTCACCTCCAGCCCCAAGG - Intronic
982067904 4:151670986-151671008 TGGAGGCACCTCCAGGCACAGGG + Exonic
985236452 4:187880637-187880659 GAGGGTCACCTCCAAGCTCACGG + Intergenic
985589180 5:755909-755931 CAGGGTCACCTCCAGGGTCCTGG - Intronic
985603859 5:848425-848447 CAGGGTCACCTCCAGGGTCCTGG - Intronic
998519102 5:142783631-142783653 CAGGGGCACCTCCAGGTAGAAGG - Intronic
999108301 5:149093362-149093384 TGGGGTGATCTCCAGGCCCAAGG - Intergenic
1002777433 6:341089-341111 CAGGGGCACCTCCAGGGAGAGGG - Intronic
1004763764 6:18700990-18701012 GGGGGTAACATCCAGGCAGAGGG - Intergenic
1004897460 6:20162365-20162387 CTGAGGCACCTCCAGGCAGATGG - Intronic
1005097741 6:22136450-22136472 CAGGGTCAACTCCAGGCATTTGG - Intergenic
1005468939 6:26142872-26142894 CAGGGTCACATGCAGGTACAGGG + Intergenic
1012582046 6:100881235-100881257 CGGGGTCGCGCCCAGTCACAGGG + Exonic
1012625857 6:101402558-101402580 AAGGGTCACCTCCAGGCAGGCGG + Intronic
1012866192 6:104621094-104621116 CCTGGGCCCCTCCAGGCACAGGG - Intergenic
1013301499 6:108808848-108808870 CGGTGCCACCTTCAGGCTCAGGG - Intergenic
1014463702 6:121729879-121729901 CGGGGTCGCGGCCAGGCAGAGGG + Intergenic
1018939146 6:168296662-168296684 CACGGGCACCTCCAGGCAAAAGG + Intronic
1019362148 7:610347-610369 CGGGGCCACGCCCAGGCACCTGG - Intronic
1022530636 7:31064874-31064896 CTGGATCTTCTCCAGGCACATGG - Exonic
1026828803 7:73599571-73599593 CGGGGGCACCTCTGGGCCCAGGG + Exonic
1032263819 7:130356599-130356621 GGGTGTCACCTCCATTCACAAGG + Intronic
1032481972 7:132254683-132254705 TGGGGTCAGCTCCTGGCAGATGG - Intronic
1033243834 7:139702430-139702452 CTGGGACCACTCCAGGCACAGGG + Intronic
1033596648 7:142864033-142864055 CAGGGGCCCCTCCAGGCACCGGG + Exonic
1034339288 7:150341584-150341606 AGGGGAGACCTCCAGGCGCAGGG - Exonic
1035107613 7:156455354-156455376 CGGAGTCACCTGCAGTGACAGGG - Intergenic
1035923668 8:3705134-3705156 TGGGGACACCACCAGGGACAGGG + Intronic
1035926093 8:3729270-3729292 AGTGTTCACCTCCTGGCACAGGG + Intronic
1036746319 8:11412648-11412670 CGGGGTCACCTCCTGGATCCTGG - Intronic
1047289108 8:123513683-123513705 CGGGGTCACTTCTGGGCAAAAGG - Intronic
1048378510 8:133843979-133844001 CGTGGTGACCTCCAGTCTCAGGG - Intergenic
1048993685 8:139775865-139775887 CGAGGGCATTTCCAGGCACACGG - Intronic
1049308364 8:141920108-141920130 AGAGGTCAGCTGCAGGCACAGGG + Intergenic
1049312962 8:141943111-141943133 CAGCGGCACCTGCAGGCACAGGG - Intergenic
1049433759 8:142576934-142576956 CGGGGGCACTCCCAGGCACGGGG - Intergenic
1049805374 8:144536411-144536433 TGGGCTCCACTCCAGGCACAGGG + Intronic
1050906372 9:11011799-11011821 CAGGGCCACTTCCATGCACATGG + Intergenic
1051201747 9:14633913-14633935 TGGGGTGATCTCCAGGCCCAAGG - Intronic
1051936284 9:22446835-22446857 CGGGGTCTCTGCCAGGCTCACGG + Exonic
1052861537 9:33440776-33440798 ATGGGTCTCCTCCAGGAACAGGG + Intergenic
1053456194 9:38234736-38234758 CGGTGTCACCCCCAGTCCCAGGG + Intergenic
1059340808 9:113596688-113596710 ATGGGTCCCTTCCAGGCACATGG + Intronic
1061911873 9:133729295-133729317 TGGGTTCACCTCCTGGCACCTGG - Intronic
1062026946 9:134344901-134344923 CTGGGTCCACACCAGGCACAGGG - Intronic
1062048901 9:134437303-134437325 CGGGGCCACCTCCAGGCTGCAGG + Intronic
1062379764 9:136281600-136281622 CGGCGTCTCCTCCAGTCCCAGGG + Exonic
1062687808 9:137824610-137824632 CTGGGCCACCTACAGACACAGGG - Intronic
1186629533 X:11334268-11334290 AGGGATCACCTCCAGCAACACGG - Intronic
1187807017 X:23131878-23131900 CGTGGTCCCCTCCATGGACAAGG + Intergenic
1191030317 X:55962422-55962444 AGGGGTCACCTTCAGCAACATGG + Intergenic
1192336019 X:70220449-70220471 CTGGCTCACCTCCAGGCAGTTGG - Intergenic
1192713421 X:73615750-73615772 CAGGGTCATCTCCAGGCTCCTGG + Intronic
1195277189 X:103293150-103293172 AGGGGTGACCTCCATGAACATGG + Intergenic
1195962111 X:110396990-110397012 CGGAGTCAGCTCCAGGAACATGG - Intronic
1197558449 X:127987769-127987791 CAGGAGCACCTCCATGCACAGGG + Intergenic
1201948333 Y:19535888-19535910 TGGGGTGGCCACCAGGCACACGG - Intergenic