ID: 919958098

View in Genome Browser
Species Human (GRCh38)
Location 1:202438910-202438932
Sequence TCGGGGTCACCTCCAGGCAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 154
Summary {0: 1, 1: 1, 2: 0, 3: 8, 4: 144}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
919958098_919958109 17 Left 919958098 1:202438910-202438932 CCTGTGCCTGGAGGTGACCCCGA 0: 1
1: 1
2: 0
3: 8
4: 144
Right 919958109 1:202438950-202438972 CCTGACCTGGAGATGCTCACAGG 0: 2
1: 0
2: 6
3: 27
4: 212
919958098_919958106 4 Left 919958098 1:202438910-202438932 CCTGTGCCTGGAGGTGACCCCGA 0: 1
1: 1
2: 0
3: 8
4: 144
Right 919958106 1:202438937-202438959 GGCCGTGGACTGGCCTGACCTGG 0: 1
1: 0
2: 2
3: 18
4: 138
919958098_919958103 -6 Left 919958098 1:202438910-202438932 CCTGTGCCTGGAGGTGACCCCGA 0: 1
1: 1
2: 0
3: 8
4: 144
Right 919958103 1:202438927-202438949 CCCCGAAGACGGCCGTGGACTGG 0: 1
1: 0
2: 1
3: 4
4: 36
919958098_919958112 22 Left 919958098 1:202438910-202438932 CCTGTGCCTGGAGGTGACCCCGA 0: 1
1: 1
2: 0
3: 8
4: 144
Right 919958112 1:202438955-202438977 CCTGGAGATGCTCACAGGGCAGG 0: 1
1: 1
2: 3
3: 38
4: 314
919958098_919958110 18 Left 919958098 1:202438910-202438932 CCTGTGCCTGGAGGTGACCCCGA 0: 1
1: 1
2: 0
3: 8
4: 144
Right 919958110 1:202438951-202438973 CTGACCTGGAGATGCTCACAGGG 0: 1
1: 1
2: 2
3: 27
4: 211

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
919958098 Original CRISPR TCGGGGTCACCTCCAGGCAC AGG (reversed) Intronic
900467859 1:2834564-2834586 TCCGGGTGACCTCAGGGCACTGG - Intergenic
902610720 1:17595704-17595726 TCCGCCTCTCCTCCAGGCACGGG - Intronic
902734068 1:18388504-18388526 TTGGGGTCACCTCCAGGGTCAGG - Intergenic
903232823 1:21932075-21932097 TAGGCTTCCCCTCCAGGCACAGG + Intronic
903501024 1:23800290-23800312 TCGGGGTCCGCGCCAGGCGCGGG - Intronic
904256626 1:29258803-29258825 TCTGCCCCACCTCCAGGCACAGG - Intronic
913426592 1:118738153-118738175 TGGAGGTCACCACCAGCCACAGG - Intergenic
915734946 1:158078667-158078689 TGGGGGCCTCCTCCAGGAACAGG + Intronic
919892094 1:201982915-201982937 CCGCCGTCACCTCCAGGCACGGG - Exonic
919958098 1:202438910-202438932 TCGGGGTCACCTCCAGGCACAGG - Intronic
922478559 1:225923483-225923505 TGGGGGTCAGATCCAGACACTGG - Intronic
922724443 1:227915862-227915884 TCTGGCTCCCCTCCAGGCAGCGG - Intergenic
924626832 1:245702581-245702603 TCGACATCACCTCCAGGCGCCGG + Exonic
1063105124 10:2986041-2986063 TCCGGCCCACCTGCAGGCACAGG + Intergenic
1066140543 10:32500406-32500428 ACGGGGTCACGGCCAGGCAGAGG + Intronic
1070421446 10:76241628-76241650 TGAGGGTCCCCTGCAGGCACAGG + Intronic
1070600677 10:77864319-77864341 TCCTGGCCACCTCCAGGCCCTGG + Intronic
1076370768 10:129951672-129951694 TCAGGGCCACCACCAGGCCCAGG - Intronic
1082818927 11:57530456-57530478 TAGAGGTGACCTCCAGGAACTGG - Intronic
1083614704 11:64020605-64020627 TGAGGGTCTCCTCCAGGCAGAGG - Intronic
1084336478 11:68460812-68460834 TCGTGGGCACCTCCAGGTAATGG + Exonic
1089183179 11:116596793-116596815 TGGGGCTCCCCACCAGGCACTGG + Intergenic
1092185538 12:6475813-6475835 ACGGGGTCACGGCCAGGCAGAGG + Intergenic
1095886005 12:47189164-47189186 TCAGGGTCACTTTCAGACACTGG - Intronic
1098097554 12:66975082-66975104 TTGGGGTCACCTCCAGGGATAGG + Intergenic
1101414297 12:104495789-104495811 TTGGGTTCAAATCCAGGCACAGG - Intronic
1102248057 12:111367673-111367695 TCAAGGTCACCAGCAGGCACAGG + Intronic
1102389099 12:112535243-112535265 TGGGGGTCAGCTCCTGGCCCAGG + Intergenic
1102999144 12:117371940-117371962 TTGGGGTGACCTCAAGGCAAGGG + Intronic
1103096478 12:118136500-118136522 TCGGGGTGGCCCCCAGGCATGGG - Intronic
1103750285 12:123153931-123153953 CCTGGGTCACATCCTGGCACAGG - Intronic
1104767542 12:131340291-131340313 GTGGGGGCACCTCCAAGCACAGG + Intergenic
1104917124 12:132271533-132271555 TCGGCGTCACCTCGGGGGACAGG - Intronic
1111197479 13:84894216-84894238 GTGGGGTCACGTCCAGGCAGTGG - Intergenic
1113439914 13:110320241-110320263 GCCAGGTCACCTCCGGGCACTGG + Intronic
1113564734 13:111313134-111313156 GCGGGGTCACCCCCAGGATCAGG - Intergenic
1116908566 14:50432349-50432371 TTGAGGTCACCTTCAGGCAGAGG - Intronic
1122975629 14:105169564-105169586 TCGGGGTAGCCTTCAGGGACAGG - Intergenic
1123045698 14:105512770-105512792 TAGGGGTCACCTTCAGCCAAGGG + Intergenic
1202918023 14_KI270723v1_random:3124-3146 CCAGGGTCACCTGCAGGCCCCGG + Intergenic
1124371304 15:29106321-29106343 TTGGGGTCAATGCCAGGCACGGG + Intronic
1127393095 15:58522501-58522523 CCGGGCTCACCTCCAGCCTCAGG + Intronic
1131657970 15:94481648-94481670 TTGGAGTCACATCCAGCCACAGG - Exonic
1131859886 15:96641251-96641273 TGAGGGTCACCTTGAGGCACGGG - Intergenic
1132577082 16:669062-669084 CCGGGGACATCTCCAGGCAAGGG + Intronic
1133115532 16:3576154-3576176 TCAGGGTCACCTCCAGGGAGGGG + Intronic
1137000083 16:35221951-35221973 CCAGGGTCACCTGCAGGCCCTGG + Intergenic
1139455945 16:67076585-67076607 TAGTGGTCACCTCTAGGAACAGG + Intronic
1139516681 16:67456565-67456587 TCTGGGTCAGACCCAGGCACTGG + Intronic
1140263539 16:73400967-73400989 TCTGGGTCACTTCCAGGGCCAGG + Intergenic
1141079268 16:81036194-81036216 TCGGGCTCACCTGCAGGCGGTGG - Exonic
1142042031 16:87900362-87900384 TCGGGGTGGCCTCCTGGGACTGG - Intronic
1142130450 16:88429516-88429538 ATGGGGTCTCCTCCAGGCACTGG - Exonic
1144066242 17:11626917-11626939 TCAGGGACTCTTCCAGGCACTGG + Intronic
1148208095 17:45792137-45792159 TCGGGCTCCCAGCCAGGCACGGG - Intronic
1148237380 17:45977932-45977954 TGGGGTTCATATCCAGGCACCGG - Intronic
1151455789 17:74225162-74225184 GCGGAGACACCTCCAGGCAGAGG + Intronic
1151832215 17:76560245-76560267 TGGGCCTCACCTCCAGGCATGGG + Intergenic
1152065997 17:78112839-78112861 CTGGGGCCACCTCCAGGCGCAGG - Exonic
1152201925 17:78952364-78952386 TGGGAGTCCCCTCCAGGCCCTGG + Intergenic
1152529416 17:80908325-80908347 TCCTGTCCACCTCCAGGCACTGG - Intronic
1156487705 18:37477145-37477167 TCTGGGTCAGTTCCAGGCACAGG + Intronic
1160143960 18:76349009-76349031 TCGCGCTGACTTCCAGGCACTGG - Intergenic
1160557484 18:79735608-79735630 TTGAGTTCACCTCCCGGCACTGG + Intronic
1160754577 19:750899-750921 TCGGGGCCACCTGGAGGCCCTGG + Intergenic
1160828025 19:1089764-1089786 TCGAGGTCCCCTCCAGGCCCTGG + Intronic
1161423310 19:4187659-4187681 GAGGGCTCACCTCCAGGGACAGG + Intronic
1161645114 19:5448562-5448584 ACCGGGTCACCTCCACGCAGCGG + Intergenic
1161810298 19:6467614-6467636 GCGCGCTCACCTCCAGCCACGGG - Exonic
1163654590 19:18538384-18538406 TCAGGGTCACCTCCAGGCACAGG + Exonic
1166198361 19:41220712-41220734 TCGGTGTCAGCTCCAGGTTCAGG + Exonic
1167017350 19:46849867-46849889 GCGGAGTCTCCTCCAGGAACAGG - Intronic
1168129735 19:54310666-54310688 TGGGGGTCACTTCCAAGCTCAGG + Intronic
1168400237 19:56081318-56081340 TCGTCGTCCGCTCCAGGCACTGG - Intergenic
926192564 2:10739630-10739652 ACGGGGTCACCTAGAGGGACCGG - Intronic
929314855 2:40464817-40464839 TCAGCATCTCCTCCAGGCACTGG - Intronic
929946775 2:46377831-46377853 TCGGGCTCACCCCAAGGCAGAGG - Intronic
934896361 2:98123446-98123468 TCCTGGCCCCCTCCAGGCACAGG + Intronic
937234402 2:120421789-120421811 TCGGGGTCTCCTGCAGACCCAGG - Intergenic
944962616 2:204892254-204892276 CCACAGTCACCTCCAGGCACAGG - Intronic
948401871 2:237691311-237691333 CCCGCGCCACCTCCAGGCACAGG - Intronic
948439891 2:237979897-237979919 TCATGGTCCCCTCCAGGCTCTGG - Intronic
948792778 2:240387966-240387988 TCGGGCTCCTCTCCAGCCACTGG + Intergenic
948924242 2:241083668-241083690 TGGTGGTCACCAGCAGGCACTGG - Intronic
1168901829 20:1371335-1371357 TCAAGGTCACATCCAGGCAGTGG - Intronic
1169336502 20:4761175-4761197 TCGGAGTCACCGCCAGGGCCAGG - Intergenic
1173650860 20:44663234-44663256 TTGGGGTCACCTCAAGGCTTTGG - Intergenic
1173902988 20:46604654-46604676 ACAGGGCCAGCTCCAGGCACAGG - Intronic
1175940876 20:62536990-62537012 GCAGGGGCACCTCCAGGCCCCGG - Intergenic
1175999925 20:62827157-62827179 ACGGGGGCCCCTCCAGGCCCGGG - Intronic
1177938729 21:27382497-27382519 TAGGTGTCACATCCAGTCACTGG + Intergenic
1179800403 21:43809041-43809063 CCGGAGTCACCTCCAGGTAAAGG - Intergenic
1180048005 21:45318591-45318613 TCGGGGACCCCTGCATGCACTGG + Intergenic
1180949834 22:19715985-19716007 CTGGGGACACCTGCAGGCACAGG - Intronic
1181512875 22:23396588-23396610 TAGGGGCCACCTGCTGGCACAGG - Intergenic
1184432446 22:44449415-44449437 TCTGGGTCAGCTCCTGGCCCAGG - Intergenic
1184744134 22:46446270-46446292 TGCGGGTGGCCTCCAGGCACTGG - Intronic
1185389572 22:50551736-50551758 TAGGGGTCACCTGCAGCCATTGG - Intronic
954162712 3:48734183-48734205 ACGGGGTCACGGCCAGGCAGAGG - Intronic
955530899 3:59872136-59872158 TGGGGGTCTCCTCAAGTCACTGG + Intronic
955940524 3:64143117-64143139 GCAGGGTCACCTCTAGCCACAGG + Intronic
956145204 3:66184818-66184840 TCAGGGTCACGACCAGGGACAGG - Intronic
959121888 3:102242412-102242434 TGGAGGTCACCTCCAGGTCCCGG - Intronic
964831310 3:160886532-160886554 TGAGTGACACCTCCAGGCACAGG + Intronic
965136929 3:164784572-164784594 ACGGGGTCACGGCCAGGCAGAGG - Intergenic
967911575 3:194546453-194546475 GCGGGGTCTCCTCCTGGCTCCGG - Intergenic
968448500 4:664186-664208 TCCGGGTCGTCTCCAGGGACAGG - Exonic
968472196 4:787250-787272 CTGCGGTCACTTCCAGGCACTGG + Intronic
972346089 4:38193490-38193512 TGGAGGTCACCTGCAGCCACTGG - Intergenic
975801107 4:78059249-78059271 TCGGGTCGACCTCCAGTCACTGG + Intronic
980864936 4:138543025-138543047 TCAGTGGCATCTCCAGGCACGGG + Intergenic
981617908 4:146661846-146661868 TCTGAGGCACCTCAAGGCACTGG + Intergenic
981781809 4:148439556-148439578 TGGGGGTCCCCTTCAGACACGGG - Intronic
982067903 4:151670985-151671007 GTGGAGGCACCTCCAGGCACAGG + Exonic
982564600 4:156971700-156971722 TCGGGGTCACCGCGGGGCTCCGG + Intergenic
985660681 5:1155451-1155473 TCGGTGTCACCTGCAGGCCCCGG + Intergenic
992754387 5:79890477-79890499 TCAAGGTCACCTTCAGGCTCTGG - Intergenic
994177532 5:96728077-96728099 TGGGGTTCACCTCCATGCAGAGG - Intronic
994365041 5:98905060-98905082 TCTGGGTCAGCTTCAGGCTCTGG - Exonic
997393284 5:133534361-133534383 TCTGGGACAAGTCCAGGCACGGG + Intronic
1002092685 5:176814235-176814257 TTGGGTTGACCTGCAGGCACTGG - Intronic
1002565620 5:180111616-180111638 TCATGGGGACCTCCAGGCACTGG - Intronic
1004276249 6:14237810-14237832 CCGGGTTCACATCCAAGCACAGG + Intergenic
1019197698 6:170291640-170291662 GCGGGGACACCTCCTGGCCCAGG + Intergenic
1019361007 7:604156-604178 ACGGGGCCACCTCCTGGGACGGG + Intronic
1020278155 7:6637083-6637105 TCGGGGTCACCTCCGAGACCTGG + Intergenic
1022103719 7:27184132-27184154 TCGGGGCCAGCTCCAGGCTGGGG - Intronic
1023851041 7:44150659-44150681 TCTGGGTCACCTGCAGGCCACGG - Intronic
1029274138 7:99394181-99394203 TGGGGGTCATCTCCAGGGAGTGG - Intronic
1032056630 7:128689429-128689451 TCGGGGTCACGGCCGGGCAGAGG - Intergenic
1033596647 7:142864032-142864054 GCAGGGGCCCCTCCAGGCACCGG + Exonic
1034128847 7:148698361-148698383 TCGGGGACACCACCAGCCTCTGG - Intronic
1035567389 8:650529-650551 TCGGGGGTACCTGCAGCCACCGG - Intronic
1037918014 8:22784504-22784526 ACAGGGTCACATCCAGTCACTGG - Intronic
1042625221 8:70749540-70749562 ATGGGGGCAGCTCCAGGCACTGG - Intronic
1043375212 8:79641496-79641518 TCTGGATCTCCTCCAGGGACAGG - Exonic
1049299160 8:141860702-141860724 GCAGGGTCACCCCAAGGCACAGG - Intergenic
1049433760 8:142576935-142576957 GCGGGGGCACTCCCAGGCACGGG - Intergenic
1049662398 8:143825376-143825398 TTGGGAGCAGCTCCAGGCACGGG - Intronic
1051360183 9:16275356-16275378 ACGGGAGCACATCCAGGCACTGG + Intronic
1051401698 9:16690697-16690719 TCTGTGTCTCCTTCAGGCACTGG - Intronic
1057503150 9:95611602-95611624 CCTGGGTCCCCTCCAGACACTGG - Intergenic
1057850858 9:98565781-98565803 TGGGGTTCACATCCAGGCTCTGG - Intronic
1061451002 9:130666951-130666973 GCGGGGTGAGCTCCAGGCTCGGG - Intronic
1062478558 9:136741327-136741349 TCAGGATCACCTCCTGGGACTGG + Exonic
1188092264 X:25977583-25977605 TCAGTGACATCTCCAGGCACGGG + Intergenic
1188310768 X:28613731-28613753 AAGGAGTCACCTCCAGCCACGGG + Intronic
1193423522 X:81313509-81313531 TAGAGGACACCTCCAGGAACTGG - Intergenic
1193780702 X:85698516-85698538 TGAGGGACATCTCCAGGCACAGG - Intergenic
1193844742 X:86455087-86455109 CTGGTGTCACCTCCAGGTACAGG - Intronic
1194980632 X:100436726-100436748 TGGAGGTCACTTCTAGGCACAGG + Intergenic
1197558448 X:127987768-127987790 TCAGGAGCACCTCCATGCACAGG + Intergenic
1199589190 X:149450849-149450871 TTGGTGATACCTCCAGGCACGGG - Intergenic
1200074125 X:153542882-153542904 TCGGGGTCTCCTCCAAGCCAGGG + Intronic