ID: 919958103

View in Genome Browser
Species Human (GRCh38)
Location 1:202438927-202438949
Sequence CCCCGAAGACGGCCGTGGAC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 42
Summary {0: 1, 1: 0, 2: 1, 3: 4, 4: 36}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
919958089_919958103 29 Left 919958089 1:202438875-202438897 CCAGGGCAGGAGCCCATACATCC 0: 1
1: 0
2: 1
3: 12
4: 119
Right 919958103 1:202438927-202438949 CCCCGAAGACGGCCGTGGACTGG 0: 1
1: 0
2: 1
3: 4
4: 36
919958088_919958103 30 Left 919958088 1:202438874-202438896 CCCAGGGCAGGAGCCCATACATC 0: 1
1: 0
2: 1
3: 13
4: 123
Right 919958103 1:202438927-202438949 CCCCGAAGACGGCCGTGGACTGG 0: 1
1: 0
2: 1
3: 4
4: 36
919958095_919958103 5 Left 919958095 1:202438899-202438921 CCGCACGCGGCCCTGTGCCTGGA 0: 2
1: 0
2: 0
3: 17
4: 211
Right 919958103 1:202438927-202438949 CCCCGAAGACGGCCGTGGACTGG 0: 1
1: 0
2: 1
3: 4
4: 36
919958097_919958103 -5 Left 919958097 1:202438909-202438931 CCCTGTGCCTGGAGGTGACCCCG 0: 1
1: 1
2: 0
3: 8
4: 207
Right 919958103 1:202438927-202438949 CCCCGAAGACGGCCGTGGACTGG 0: 1
1: 0
2: 1
3: 4
4: 36
919958093_919958103 8 Left 919958093 1:202438896-202438918 CCACCGCACGCGGCCCTGTGCCT 0: 2
1: 0
2: 9
3: 69
4: 726
Right 919958103 1:202438927-202438949 CCCCGAAGACGGCCGTGGACTGG 0: 1
1: 0
2: 1
3: 4
4: 36
919958091_919958103 17 Left 919958091 1:202438887-202438909 CCCATACATCCACCGCACGCGGC 0: 1
1: 0
2: 0
3: 0
4: 16
Right 919958103 1:202438927-202438949 CCCCGAAGACGGCCGTGGACTGG 0: 1
1: 0
2: 1
3: 4
4: 36
919958092_919958103 16 Left 919958092 1:202438888-202438910 CCATACATCCACCGCACGCGGCC 0: 1
1: 0
2: 0
3: 2
4: 28
Right 919958103 1:202438927-202438949 CCCCGAAGACGGCCGTGGACTGG 0: 1
1: 0
2: 1
3: 4
4: 36
919958098_919958103 -6 Left 919958098 1:202438910-202438932 CCTGTGCCTGGAGGTGACCCCGA 0: 1
1: 1
2: 0
3: 8
4: 144
Right 919958103 1:202438927-202438949 CCCCGAAGACGGCCGTGGACTGG 0: 1
1: 0
2: 1
3: 4
4: 36

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
919958103 Original CRISPR CCCCGAAGACGGCCGTGGAC TGG Intronic
900528698 1:3142135-3142157 CCCCGGAAATGGCCCTGGACGGG - Intronic
910168627 1:84354393-84354415 CCCTGAAGACAGTTGTGGACAGG - Intronic
912495347 1:110088173-110088195 CCCCAAAGACGGGCGTCCACTGG + Intergenic
919958103 1:202438927-202438949 CCCCGAAGACGGCCGTGGACTGG + Intronic
1076680806 10:132170280-132170302 CCCCGAGGGCGGCTGGGGACAGG + Intronic
1076816852 10:132919261-132919283 CCCAGAGGGCGGCCGTGGCCAGG + Intronic
1078023578 11:7673915-7673937 CCCCGAGAAGGGCCGTGGTCGGG + Exonic
1085510609 11:77086312-77086334 CCCCGTAGATGTCCTTGGACTGG + Intronic
1085784866 11:79440260-79440282 CCCCGGAGCCCGCCGCGGACTGG - Intronic
1115618923 14:35121951-35121973 CGCGGAAGTCGGCCATGGACTGG - Exonic
1121252049 14:92506536-92506558 CCAAGAAGACGGCCCTGGCCTGG - Intergenic
1202860824 14_GL000225v1_random:80006-80028 CCCCGCAGAAGCCCGGGGACGGG - Intergenic
1124989775 15:34660150-34660172 CCCTGAAGAGGGCCATGGACTGG + Intergenic
1125536174 15:40441936-40441958 CGCCGAAGACGGAAGGGGACCGG + Intronic
1137875208 16:51990081-51990103 CCCCTAAGGCATCCGTGGACTGG + Intergenic
1143108589 17:4541427-4541449 ACCCGAACACGACCGCGGACTGG + Intronic
1143394132 17:6578603-6578625 CCCAGATGACGGCACTGGACAGG + Exonic
1151749546 17:76028735-76028757 CCCTGAACTCGGCCGTGGAGAGG + Intergenic
1163654584 19:18538367-18538389 CCCTGAAGACGGCTGTGGACGGG - Exonic
1163849343 19:19654556-19654578 CCATGCTGACGGCCGTGGACTGG - Exonic
1164692635 19:30222597-30222619 CCCCGCAGACGGCCGGGCAGGGG - Intergenic
1165243077 19:34482363-34482385 CACCGAAGGCGGCCCGGGACCGG - Exonic
925324805 2:3010046-3010068 CCCTGAAGACGGTCTTGGGCAGG + Intergenic
929808575 2:45169564-45169586 CCGCGGAGACGGGCGGGGACGGG + Intergenic
1169345010 20:4822829-4822851 CCTAGAAGACGGCGGCGGACTGG + Intronic
1172771671 20:37385832-37385854 CCCCGGGGACGGACGCGGACAGG + Intronic
1174404975 20:50296983-50297005 CCCCCAAGACGGGGGTGGACGGG + Intergenic
1180980531 22:19876195-19876217 CCCCCAAGATGCCTGTGGACAGG - Intronic
953574330 3:44101035-44101057 CCCTGAAGACGCCTGGGGACAGG + Intergenic
963895813 3:150683943-150683965 CCCCCAAGACGTCCCTGAACTGG - Intronic
968655894 4:1778323-1778345 CCCCGGAGATGGCCGTGGCCAGG + Intergenic
975922448 4:79408240-79408262 CCCCCAACACCGCCGTGGCCTGG - Exonic
985724800 5:1510537-1510559 CTCGTAAGACGCCCGTGGACTGG - Intronic
1014798123 6:125748847-125748869 CCGCGGAGAAGCCCGTGGACTGG - Intronic
1017810676 6:157981660-157981682 CCCCGCAGGCGGGCGTGGAGCGG - Intergenic
1019628372 7:2032939-2032961 CCCCGCAGAAGGACGTGGAGAGG + Intronic
1023970402 7:44986698-44986720 CCCCGAAGCCGTGCGTGGCCGGG + Intergenic
1024113257 7:46168830-46168852 CCCCGAAGAAGGGCATGGAAAGG - Intergenic
1037653917 8:20866725-20866747 CCCTGAAGACAGCCCTGGAGAGG - Intergenic
1041271416 8:56113067-56113089 CCTCGAAGACGGCAGCGGAGAGG + Exonic
1041558614 8:59188046-59188068 CCCCGAAGCCTGCTGTGGACTGG + Intergenic
1062110782 9:134781000-134781022 CCCCGCAGGCCGCCGTGGCCAGG - Intronic