ID: 919965531

View in Genome Browser
Species Human (GRCh38)
Location 1:202519971-202519993
Sequence CAGGCTATTCCTTTGTAGAG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 176
Summary {0: 1, 1: 2, 2: 0, 3: 14, 4: 159}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
919965527_919965531 2 Left 919965527 1:202519946-202519968 CCACACAGAAACTTCATCCAGCT 0: 1
1: 2
2: 0
3: 26
4: 264
Right 919965531 1:202519971-202519993 CAGGCTATTCCTTTGTAGAGTGG 0: 1
1: 2
2: 0
3: 14
4: 159
919965526_919965531 3 Left 919965526 1:202519945-202519967 CCCACACAGAAACTTCATCCAGC 0: 1
1: 2
2: 2
3: 19
4: 169
Right 919965531 1:202519971-202519993 CAGGCTATTCCTTTGTAGAGTGG 0: 1
1: 2
2: 0
3: 14
4: 159

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
919965531 Original CRISPR CAGGCTATTCCTTTGTAGAG TGG Intronic
900547279 1:3236027-3236049 CATGCTATCCCTTTCCAGAGAGG - Intronic
903470087 1:23580749-23580771 CAGTTTCTTCCTTTGTAAAGGGG + Intergenic
904498649 1:30901710-30901732 CAGGGTTTTCTTTTGGAGAGAGG - Intronic
906456726 1:46003634-46003656 CAGGCTAATTTTTTGTAGAGAGG + Intronic
907661785 1:56400004-56400026 CAGGCTTTTCCCTTGCAGGGTGG - Intergenic
913412298 1:118565392-118565414 CAGGTTTTTCCTCTGTAAAGTGG - Intergenic
917341569 1:173984585-173984607 CAGCCTATTACTTTGTGTAGTGG - Exonic
919190657 1:194214001-194214023 TAAGCTATTCTTTTGTAGACAGG + Intergenic
919480312 1:198079883-198079905 CAGGCTGTTCTTTGTTAGAGAGG + Intergenic
919965531 1:202519971-202519993 CAGGCTATTCCTTTGTAGAGTGG + Intronic
920463013 1:206156782-206156804 GAGGCTATTGTTTTGGAGAGAGG + Intergenic
921477195 1:215626144-215626166 CAGTCTACTCATCTGTAGAGTGG + Intronic
1065021570 10:21506251-21506273 CAGGGTATTCATTTGAAGGGAGG + Intergenic
1065798836 10:29332476-29332498 CAGGCTGTACCATTATAGAGGGG + Intergenic
1066558057 10:36637561-36637583 CAGGATATAGCTTTGGAGAGAGG - Intergenic
1068047631 10:51908075-51908097 TAGGCTATCCTTTTGTAGACTGG + Intronic
1069625081 10:69862793-69862815 CAGGTTTTTCATCTGTAGAGTGG + Intronic
1071312501 10:84356168-84356190 CAACTTCTTCCTTTGTAGAGAGG - Intronic
1073415188 10:103375230-103375252 CAGGATAATTCTTTGTAAAGTGG - Intronic
1076100514 10:127774061-127774083 CAAGCAATTCCTCTGTAAAGAGG + Intergenic
1077571321 11:3340587-3340609 CAGGATGATCCTATGTAGAGAGG + Intronic
1080232060 11:30027439-30027461 CAAGATATTACTTTGAAGAGTGG - Intergenic
1083133228 11:60646895-60646917 CAGTTTATTCTTTTGTAGAGTGG - Intergenic
1085067632 11:73511798-73511820 CAGGCTAATCCTGTGAAGTGTGG - Intronic
1085340319 11:75727171-75727193 CAGGCTCTTCATTTGTAAAGTGG - Intronic
1085689770 11:78655584-78655606 CACCCTATTCCTTTGGGGAGGGG + Exonic
1087267472 11:96076602-96076624 CAGGCTGTTCCTTGGGAGTGAGG - Intronic
1089389785 11:118092957-118092979 CAGGCTTACCCTCTGTAGAGTGG - Intronic
1089949655 11:122513530-122513552 CATGCTAATCCTTCATAGAGTGG + Intergenic
1090998815 11:131891141-131891163 CAAGCTAATCCCTTGTAGGGAGG + Intronic
1091446210 12:545614-545636 CAGTTTATCCCTTTGTAGAGGGG - Intronic
1094358929 12:29609054-29609076 CAGGCTGTTCCCTTCCAGAGAGG + Intronic
1095486015 12:42685435-42685457 CAGACTGTTACTTTGTAGTGGGG + Intergenic
1095940989 12:47726674-47726696 CAGCCTGTTGCTGTGTAGAGAGG + Intergenic
1095951210 12:47783002-47783024 CAGGCTACTCCTATGTGGGGTGG + Exonic
1098861200 12:75712190-75712212 TGGGCTATTCCTTTGTATAAAGG + Intergenic
1100984283 12:100189750-100189772 CAGGCTGTCCCTTTGCAGGGCGG - Intergenic
1103300864 12:119925596-119925618 CAGGCATTTTCTTTGTAGATAGG - Intergenic
1106024092 13:25940748-25940770 CAGGCTAGTCCTCTGTGGGGAGG - Intronic
1107963527 13:45579407-45579429 CAGGCTTTTGTTTTGTGGAGTGG + Intronic
1109417782 13:62066042-62066064 CACGCTATTCCTTTTTTGGGGGG + Intergenic
1110060029 13:71029288-71029310 CAGTGTATTCCTTTGGACAGAGG + Intergenic
1112606352 13:100910442-100910464 AAGGCTTTTCTTTTGTAGGGAGG + Intergenic
1114724986 14:24926659-24926681 GAGGCTAGTCATTTGTAGATTGG + Intronic
1114955172 14:27808329-27808351 TAGGCTCTTCCTTTATATAGAGG - Intergenic
1116412085 14:44636703-44636725 TAGGCTATTCCTTCATATAGTGG - Intergenic
1116880824 14:50167036-50167058 TAGGTTATTTCTTTTTAGAGAGG - Intronic
1118910749 14:70060216-70060238 CAGGTTATTCACTTGTGGAGTGG - Intronic
1119798956 14:77425669-77425691 CAGGATAATCCTTTGTTGTGGGG + Intergenic
1121596462 14:95167207-95167229 TGGGCTATTGCTTTGGAGAGTGG + Intergenic
1121605901 14:95239623-95239645 CAAGCTCTTCCTTTTTGGAGGGG - Intronic
1121906971 14:97755015-97755037 CATGCTTTTCCATTGTCGAGAGG + Intronic
1123158842 14:106257800-106257822 CAGGCTCTTCATTTGCAGATAGG + Intergenic
1123189672 14:106556974-106556996 CAGGCTGTTCATTTGCAGATAGG + Intergenic
1123201195 14:106666115-106666137 CAGGCTGTTCATTTGCAGATAGG + Intergenic
1123212616 14:106775195-106775217 CAGGCTGTTCATTTGCAGATAGG + Intergenic
1129876694 15:78980022-78980044 CAGGATGATCCTTTGTTGAGGGG - Intronic
1130116355 15:81007994-81008016 CAGGTTTTTCTTTTGGAGAGGGG + Intronic
1130828303 15:87572568-87572590 CAGGCGATTCTCTTGTAGACAGG - Intergenic
1132214993 15:100055912-100055934 AAAGCTATTCAGTTGTAGAGTGG + Intronic
1134112006 16:11521564-11521586 CAGTCTATTCCTTTGTCCAAAGG + Intronic
1134197456 16:12170044-12170066 CTGGATAATCCTTTGTAGTGGGG + Intronic
1134385780 16:13770969-13770991 CAGGCTCTTCCTCTGTAAATTGG + Intergenic
1145068417 17:19781191-19781213 GATGCTATTCCTTTATAGAAAGG - Intronic
1151794452 17:76334053-76334075 CAGGCTCTTCCTTTAAAAAGGGG + Intronic
1152424561 17:80211912-80211934 CATTCTTTTCCTCTGTAGAGTGG + Intronic
1153201660 18:2654298-2654320 CATTCTATTCCTTTATATAGTGG - Intergenic
1155249440 18:23940849-23940871 CTGGCTACTCCTTGGTAGGGAGG + Intronic
1161022473 19:2016488-2016510 CAGGCTATGTCTCTGTACAGCGG - Intronic
1163024492 19:14502519-14502541 CAGTCTCCTCCTCTGTAGAGTGG - Intergenic
1167117181 19:47495161-47495183 CAGGCTAATTTGTTGTAGAGAGG + Intronic
1168400782 19:56085163-56085185 CAGGCTACTGGTTTGTAAAGTGG - Intergenic
925178860 2:1803753-1803775 CATGCCATTCCTTTGTAAGGGGG + Intronic
925915322 2:8600432-8600454 CACTCTATTCCTTAGAAGAGTGG - Intergenic
928579827 2:32696210-32696232 AATGCTATTCCTTTTTAAAGCGG + Intronic
929697137 2:44127808-44127830 CAGGCTAATTTTTTGTAGACAGG - Intergenic
929829179 2:45333834-45333856 CAGACTGTTCCTTTGTAGTTTGG + Intergenic
929973955 2:46612987-46613009 CAGGTTATTCTTTTCTAGATGGG - Intronic
930017391 2:46980379-46980401 CTGGCTAATTTTTTGTAGAGAGG + Intronic
931760302 2:65410891-65410913 TAGACTTTTCCTTTGGAGAGTGG + Intronic
933156139 2:78977855-78977877 CATGCAATTCCTTTGTTGGGAGG + Intergenic
933598949 2:84310071-84310093 CAGGCTATACCTTTAGAGAGAGG - Intergenic
934482168 2:94661187-94661209 TAGGCTCTTCCTTTATATAGAGG + Intergenic
938719141 2:134050016-134050038 CTGGCTAATTTTTTGTAGAGAGG - Intergenic
941207635 2:162593956-162593978 CTGGCTAATCCTTTGTATAAAGG + Intronic
941342847 2:164329045-164329067 CCGTCTATTCCTGTGCAGAGAGG - Intergenic
947282434 2:228470246-228470268 CAGGATATTCCATTGCATAGTGG - Intergenic
947574346 2:231260810-231260832 CAGGGTATTCCTTTGCTGAGAGG + Intronic
948172237 2:235914040-235914062 GAAGCTAATCCTTTTTAGAGAGG + Intronic
1174488552 20:50876274-50876296 CAGAGTATTCCATTGTGGAGAGG + Intronic
1177731297 21:25029923-25029945 CTGGCTTTTCATTTCTAGAGAGG + Intergenic
1178365963 21:31988990-31989012 CTGGCTAATTTTTTGTAGAGAGG + Intronic
1180872599 22:19155089-19155111 CAGGTTCTGCCTTTGCAGAGTGG + Intergenic
1183438384 22:37808463-37808485 CAGCCTCTTCGTTTGTAAAGTGG - Intronic
1183586062 22:38753739-38753761 CAGGTTCTTCCCTTGTAGATGGG - Intronic
1184407522 22:44308502-44308524 CAGGCTACGGCTTTGGAGAGGGG - Intronic
952773100 3:37020080-37020102 CAGTCTCTTCATTTGTAAAGTGG - Intronic
955681334 3:61505202-61505224 CTGGCCATGCTTTTGTAGAGTGG + Intergenic
955966966 3:64398701-64398723 CAGGCTTATCCTTTGTAGTCAGG + Intronic
956359280 3:68429376-68429398 CAGGTTCTTCCCTTGTAAAGTGG - Intronic
956980088 3:74626295-74626317 AAGGCTATTCCTTTTTTGATTGG - Intergenic
957400337 3:79704130-79704152 GAGGCTATGCCTGTGTACAGTGG - Intronic
957758667 3:84525626-84525648 CATGCTATTCCTTTCTTCAGAGG - Intergenic
958033833 3:88147906-88147928 CAGGATAATCTTTTGTCGAGGGG - Intronic
958590588 3:96154166-96154188 CTGGCTATGTTTTTGTAGAGCGG - Intergenic
961040335 3:123673885-123673907 CAGGCTGCTCCTCTGAAGAGGGG + Intronic
961192430 3:124973181-124973203 CAGGCTAATTTTTTGTAGAGAGG + Intronic
964231825 3:154479120-154479142 CAGGCTATTTCTAGGTGGAGTGG + Intergenic
964444845 3:156747997-156748019 CAGGTGATTCCTTTGTAGCCCGG - Intergenic
964618113 3:158692045-158692067 CAGGCTTTTCTGTTGAAGAGTGG + Exonic
966572652 3:181463405-181463427 CAGGCTTTTCATCTGTAAAGTGG - Intergenic
969917513 4:10505171-10505193 CTGGCCATGCCTTGGTAGAGTGG - Intronic
971107409 4:23542039-23542061 CTGGCCATGCTTTTGTAGAGTGG - Intergenic
971788126 4:31131226-31131248 CTGCCTATTACTTTGGAGAGTGG - Intronic
972197450 4:36671376-36671398 CAGGGTATGCCTTGGGAGAGTGG + Intergenic
972476166 4:39451793-39451815 CTGGCTAGTTTTTTGTAGAGAGG - Intergenic
972751377 4:41992174-41992196 CAGGCTAATTTTTTGTAGAGAGG - Intronic
977060711 4:92254547-92254569 CTGGCTGTCCCTTTGTGGAGGGG + Intergenic
977435629 4:96990689-96990711 CCTGCTATTCCTTGGTGGAGAGG + Intergenic
981235420 4:142409653-142409675 CAGGCAATGACTTTGTATAGAGG - Intronic
983422276 4:167534142-167534164 CATGCAATTGTTTTGTAGAGTGG + Intergenic
988101544 5:26685870-26685892 CAGTATATTTCTTTGTAAAGTGG + Intergenic
989312360 5:40034894-40034916 CAGGCTCTTTCTGTGTAGGGAGG - Intergenic
989594669 5:43145232-43145254 CAGGCTTTTGTTTTGCAGAGTGG - Intronic
993849588 5:92990377-92990399 CAGGCTAGTGCTTGGAAGAGTGG - Intergenic
994380527 5:99065175-99065197 AAGGATATTCCTTTCAAGAGAGG + Intergenic
995459680 5:112389867-112389889 CAGGCTCCTCTTTTGTAAAGAGG - Intronic
997556589 5:134804598-134804620 CAGGCTAATTTTTTGTAGAGAGG + Intronic
999793723 5:154968092-154968114 CGGTTTATTCCTTTGTAAAGTGG - Exonic
999900625 5:156082557-156082579 TAGCCTGTTCCTTTGTATAGTGG + Intronic
999950979 5:156650072-156650094 CAGGCTATGCATCTCTAGAGTGG - Intronic
1000848750 5:166313871-166313893 CAGGCTCCTCCTTGGTGGAGAGG - Intergenic
1001230892 5:169987262-169987284 CAGGCCAGACCTTTGAAGAGTGG - Intronic
1001583919 5:172820082-172820104 CAGCCTCTTCCTCTGTAGAGAGG - Intergenic
1002209108 5:177585472-177585494 TAGGAAATCCCTTTGTAGAGAGG - Intergenic
1002665820 5:180823792-180823814 CATGCTATTGCTTTGCAGGGTGG - Intergenic
1006139562 6:31920293-31920315 CAGGCTATCCTTTTGTCAAGAGG + Intronic
1007409352 6:41652933-41652955 CAGTCTCTTCATCTGTAGAGTGG + Intronic
1007750803 6:44070108-44070130 CAGGCTAATTTTTTGTAGAGAGG + Intergenic
1008573768 6:52839405-52839427 CAGGGTATTCATTTGTACAAAGG + Intronic
1009961310 6:70525298-70525320 CATGATATTCTTTTGTAGAAGGG - Exonic
1013455883 6:110329480-110329502 CTGTTTATTCCTTTTTAGAGGGG + Intronic
1026403516 7:70040519-70040541 CATGCAATTCCTTTGTAAAATGG - Intronic
1027132018 7:75597939-75597961 CAGCCTGTGGCTTTGTAGAGAGG - Intronic
1029734148 7:102456191-102456213 GAGGCTATTCCTTTGTGATGGGG - Exonic
1030831904 7:114234242-114234264 AAGGCTCCTCCTCTGTAGAGAGG + Intronic
1031687533 7:124749391-124749413 TAGGCTATTCCCTGGTAAAGGGG + Intronic
1033980018 7:147152410-147152432 CAGGCTTTTCCTTTGTAAAATGG + Intronic
1035709651 8:1702763-1702785 CAGGCTTTTCCTTTGAAGACCGG - Exonic
1039813213 8:41068489-41068511 CAGGAAATTCCTTTGGAGGGGGG - Intergenic
1039942385 8:42102266-42102288 CAGGATAATTCTTTGTAGAGGGG + Intergenic
1046835156 8:118792455-118792477 TAGGTTATTCCTTTGTAAACTGG - Intergenic
1047362234 8:124179514-124179536 AAGGCTATTGCATGGTAGAGGGG + Intergenic
1047799775 8:128296732-128296754 CAGGCTCTTGCTTTGTAAATCGG + Intergenic
1051733812 9:20177349-20177371 AAGGATATTTCTTTCTAGAGAGG - Intergenic
1052701320 9:31941353-31941375 CAGGCTATTGCTTCAGAGAGTGG + Intergenic
1053210621 9:36224270-36224292 CTGGCTAATTTTTTGTAGAGAGG - Intronic
1053675661 9:40423532-40423554 TAGGCTCTTCCTTTATATAGAGG - Intergenic
1053925455 9:43049866-43049888 TAGGCTCTTCCTTTATATAGAGG - Intergenic
1054288054 9:63201362-63201384 TAGGCTCTTCCTTTATATAGAGG + Intergenic
1054386763 9:64563596-64563618 TAGGCTCTTCCTTTATATAGAGG - Intergenic
1054508961 9:65952760-65952782 TAGGCTCTTCCTTTATATAGAGG + Intergenic
1054826043 9:69574477-69574499 CAGGCTATGCATATATAGAGAGG - Intronic
1055425697 9:76194038-76194060 CTGGCTTTTCCATTGTAGATTGG + Intronic
1057618154 9:96611921-96611943 CAGGCTCTCCCATGGTAGAGGGG + Intronic
1058481953 9:105404841-105404863 CAGGATCTTCCTTTGTAAAATGG + Intronic
1060005931 9:119999354-119999376 CAGGCTCTTCATTTGTCAAGTGG + Intergenic
1191826174 X:65366626-65366648 TAGTCTATTTCCTTGTAGAGGGG - Intronic
1194183155 X:90737889-90737911 CTGGCTGTTCCTTGGTGGAGGGG - Intergenic
1197109117 X:122751490-122751512 CAGGGTATTTCTTTGTTGGGAGG + Intergenic
1198052952 X:132966352-132966374 AAGGCTATTGTTTAGTAGAGTGG - Intergenic
1198487275 X:137100225-137100247 CAGCTTATTCATCTGTAGAGTGG - Intergenic
1200529767 Y:4319844-4319866 CTGGCTGTTCCTTGGTGGAGGGG - Intergenic
1200907799 Y:8502541-8502563 CTGGCTAGTCATTTGTAGAAAGG - Intergenic
1202301148 Y:23415772-23415794 CAGGCTGTTCCTTTGTAGAGTGG + Intergenic
1202569663 Y:26254826-26254848 CAGGCTGTTCCTTTGTAGAGTGG - Intergenic