ID: 919967364

View in Genome Browser
Species Human (GRCh38)
Location 1:202541476-202541498
Sequence TGTGGCTCCTTGGGAAAAAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 306
Summary {0: 1, 1: 2, 2: 1, 3: 36, 4: 266}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
919967364_919967373 18 Left 919967364 1:202541476-202541498 CCTTTTTTTCCCAAGGAGCCACA 0: 1
1: 2
2: 1
3: 36
4: 266
Right 919967373 1:202541517-202541539 AGCTGTTGGGTATTTTTTGCTGG 0: 1
1: 2
2: 2
3: 17
4: 164
919967364_919967368 4 Left 919967364 1:202541476-202541498 CCTTTTTTTCCCAAGGAGCCACA 0: 1
1: 2
2: 1
3: 36
4: 266
Right 919967368 1:202541503-202541525 GCTTTCACCCCACTAGCTGTTGG 0: 3
1: 0
2: 0
3: 7
4: 80
919967364_919967369 5 Left 919967364 1:202541476-202541498 CCTTTTTTTCCCAAGGAGCCACA 0: 1
1: 2
2: 1
3: 36
4: 266
Right 919967369 1:202541504-202541526 CTTTCACCCCACTAGCTGTTGGG 0: 3
1: 0
2: 0
3: 6
4: 113

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
919967364 Original CRISPR TGTGGCTCCTTGGGAAAAAA AGG (reversed) Intronic
903448736 1:23438439-23438461 TCTGGGTATTTGGGAAAAAAAGG + Intronic
904005885 1:27363014-27363036 TGTTCCTCCTAGGGAAAAGATGG + Exonic
904311904 1:29634634-29634656 TGTGGCTTGTGGGGACAAAACGG - Intergenic
904853378 1:33476321-33476343 TATGGTTCCTTAGAAAAAAAAGG + Intronic
904966072 1:34373834-34373856 TGTATCTCCCTAGGAAAAAAAGG - Intergenic
905585485 1:39114066-39114088 GGTAGATGCTTGGGAAAAAATGG - Intronic
906935257 1:50208998-50209020 TTTGAATCCTTGGGAGAAAAAGG + Intergenic
907009636 1:50951630-50951652 TGTAGGTCATTGGGAAAATAAGG - Intronic
907375436 1:54034270-54034292 TGCTGCTGCTTGGGAGAAAATGG + Intronic
909278454 1:73719232-73719254 TCTGTTTCCTTGGGAAATAAAGG - Intergenic
910168600 1:84354141-84354163 TGTAGCTCCATGGGAAATTAAGG + Intronic
911094704 1:94045876-94045898 TGCTGCTCCTTGGGAAACCATGG + Intronic
911129920 1:94377302-94377324 TGTGGGTTCTTGGGCAAGAAAGG - Intergenic
911225348 1:95298368-95298390 AGTGGTTACTTGGGAAAAGAGGG - Intergenic
911796409 1:102082060-102082082 CGTTGCACCTTGTGAAAAAAAGG + Intergenic
911844406 1:102731823-102731845 TATAGCTACTTGAGAAAAAAAGG + Intergenic
913191091 1:116413602-116413624 GGAGGCTCCTGGGGAAAATAAGG + Intergenic
914397735 1:147286882-147286904 TGTGGTTATTTGGGAAGAAAGGG - Intronic
915323489 1:155069004-155069026 TCTGGCTCCTTGGGATGAGAGGG - Exonic
916756601 1:167776599-167776621 TGTGGATTCTTTAGAAAAAATGG + Intronic
917631113 1:176892402-176892424 TGTGGCTCTTGGTGATAAAATGG + Intronic
918112746 1:181471674-181471696 TGCGGCTCTTGGGGAAATAAAGG + Intronic
918371630 1:183867204-183867226 TGTGGCTTCCTGGGAACTAAGGG + Intronic
918814902 1:189169852-189169874 TAGGTCTCCTTGGGGAAAAATGG - Intergenic
919024480 1:192149905-192149927 TCTAGATCCTTGAGAAAAAAAGG + Intergenic
919104064 1:193127439-193127461 TGGGACTACTTGGGAAAATAAGG + Intronic
919967364 1:202541476-202541498 TGTGGCTCCTTGGGAAAAAAAGG - Intronic
921320641 1:213934973-213934995 TGTGGCTCTTTGGAGAAAGAGGG + Intergenic
921535697 1:216346286-216346308 TGGGACTCCTTGGGAAAAAAAGG + Intronic
921863288 1:220061956-220061978 AGAGGGTCCTTGGGAAAATAAGG + Intronic
922759621 1:228119241-228119263 TGGAGCTCCTTGGGAAAAACAGG - Intergenic
924380065 1:243454647-243454669 TTTGGCTCCTTTGGAGAACACGG - Intronic
924483303 1:244455754-244455776 TGGGACTCCTTGGGAAAAACAGG + Intronic
924808620 1:247381721-247381743 TGGGACTTCTTGGGAAAAACAGG - Intergenic
1064122400 10:12631176-12631198 TGGCGCTGCTTAGGAAAAAAAGG + Intronic
1064653484 10:17533524-17533546 TGTGGCTTTGTGGGAAACAAAGG - Intergenic
1065560992 10:26963599-26963621 TGTGGATCCTGGGGAATGAATGG - Intergenic
1067332955 10:45338818-45338840 GAGGTCTCCTTGGGAAAAAATGG - Intergenic
1067367107 10:45642683-45642705 TGTGGTTCTTTGAAAAAAAAAGG - Intronic
1067976812 10:51035737-51035759 TGTGGATCATTTGGAAACAACGG + Intronic
1070557590 10:77540503-77540525 AGTGGCTCTTTGGGTAAAAATGG + Intronic
1070640575 10:78166026-78166048 TGAGCCTACTTGGGACAAAAAGG + Intergenic
1071251707 10:83825659-83825681 TGTGCCTCCTTCTTAAAAAAAGG + Intergenic
1071357260 10:84810610-84810632 TGGGACTCCTTGGAAAAAACAGG - Intergenic
1072284454 10:93899545-93899567 TTTGTCTCTTTGGGCAAAAAAGG + Intronic
1073660210 10:105467422-105467444 TGTTCCACCTTGGTAAAAAAGGG - Intergenic
1075097053 10:119479035-119479057 TGTTGCTCCTTGGAAGCAAATGG - Intergenic
1075720099 10:124579576-124579598 TGTGTCTCCTTGTGCAAATATGG + Intronic
1076391662 10:130107971-130107993 TATGCCTCCTTTGGATAAAATGG + Intergenic
1077701037 11:4442898-4442920 TGTGTCTCTGTGGGAAGAAAGGG + Intergenic
1078137953 11:8667985-8668007 TGTGGCTGCTGTGGAAAATATGG - Intronic
1078185812 11:9051330-9051352 TGTGCCTTCCTGAGAAAAAAAGG + Intronic
1079013571 11:16849944-16849966 TGTGCCTCCTTAGGAAGGAAAGG + Intronic
1079146090 11:17853360-17853382 TGTGGTGCCTTGGGAAATACAGG - Intronic
1079217599 11:18527455-18527477 TCTGGCTTCTTGTGAAACAAAGG - Intergenic
1080810677 11:35701295-35701317 TGGGACTCCTTGGGAAAAACAGG - Intronic
1080892797 11:36424075-36424097 TGAGTCTCCGTGGAAAAAAATGG + Intronic
1082834527 11:57641854-57641876 TAGGCCTCCTTGAGAAAAAAAGG + Intergenic
1083001541 11:59296851-59296873 TGGGACTCCTTGGGAAAAACAGG - Intergenic
1083048068 11:59754470-59754492 TTTGTCTTCTTGGGAACAAATGG - Intronic
1083104085 11:60340823-60340845 ATTGACTTCTTGGGAAAAAACGG + Exonic
1083452221 11:62753707-62753729 AGTGGCTCCCTGAGAAAAAAGGG + Exonic
1083990865 11:66244960-66244982 GGTGGGTCCTGGGGAAAAACGGG - Intergenic
1084583599 11:70040184-70040206 TGCAGCTCATTGGGAAAATATGG + Intergenic
1084878124 11:72149122-72149144 TGGGACTCCTTGGGGAAAACAGG + Intergenic
1084878608 11:72153281-72153303 TATGACTCCCTGGGAAAAACAGG - Intergenic
1085905246 11:80752591-80752613 TGCAGCTCCCTGGCAAAAAATGG - Intergenic
1089197626 11:116703905-116703927 TGTGTCTCCTTGGTGAAAATGGG - Intergenic
1091585556 12:1814275-1814297 TGAGGCTCCTTGGGCAGAAATGG + Intronic
1094239899 12:28210568-28210590 TGGGACTCCTTGGGAAAAACAGG - Intronic
1094431335 12:30373116-30373138 GGGGACTCCTTGGGAAAAACAGG - Intergenic
1095080624 12:37995394-37995416 TGAGGCTTATGGGGAAAAAAAGG + Intergenic
1096875938 12:54630641-54630663 TGTGGCTCCAAGTGAATAAAAGG + Intergenic
1098502359 12:71207566-71207588 TGAGACTCCTTGGAAAAAACAGG + Intronic
1099400260 12:82194837-82194859 TGGGTCTCCTTGGGAAAGGATGG - Intergenic
1099915962 12:88893611-88893633 TCTGGCTGCTTTGCAAAAAATGG + Intergenic
1101591948 12:106132606-106132628 TGAGGCTGCTTGGGAAACAAAGG + Intronic
1101639603 12:106578554-106578576 TGTGGGTCCCTGGGAAAAAGGGG + Intronic
1103636575 12:122312266-122312288 TTTGGATCTTAGGGAAAAAAGGG - Intronic
1103636655 12:122312798-122312820 TGTGGTTCCTGGAGAAAAAGGGG - Intronic
1103758733 12:123232766-123232788 CGGGGCACCTTGGCAAAAAATGG + Intronic
1106021296 13:25918419-25918441 TCTGGCTCTTTGGGCAACAACGG - Intronic
1107311525 13:39083363-39083385 TGGGACTTCTTGGGAAAAACAGG + Intergenic
1108297952 13:49044120-49044142 CGTGTCTCCTTGGGATGAAAAGG + Intronic
1108699205 13:52929387-52929409 TGAGGCTCTTTTGGAAACAAAGG - Intergenic
1109464309 13:62709012-62709034 TAAAGCTCCTAGGGAAAAAAAGG - Intergenic
1111120202 13:83838465-83838487 TATGGCTCATTAGGAAAAAGAGG - Intergenic
1111847030 13:93523937-93523959 TGTGGCAACCTGGGAAAAACAGG + Intronic
1112187052 13:97137546-97137568 TCTGGCTCCTTGGCAAATAACGG - Intergenic
1113486422 13:110655902-110655924 TGTGGCTGCTGGGGAAGGAATGG + Intronic
1113664059 13:112128566-112128588 TGAGGCTCCTGGAGAAAAACAGG - Intergenic
1114405594 14:22453152-22453174 TGTGAGTCCCTGGGAGAAAATGG - Intergenic
1114971643 14:28037074-28037096 TGTACCTCTTTGGAAAAAAATGG + Intergenic
1115631284 14:35248243-35248265 TGAATCTCTTTGGGAAAAAATGG - Intronic
1118866715 14:69710184-69710206 CTTGGCTCCTTGGGAAGATAAGG - Intronic
1118919566 14:70137835-70137857 TTTGGCTCCCTGGGAAAAATGGG + Intronic
1118981800 14:70723132-70723154 TGTGGCTCAATGTGACAAAAAGG + Intronic
1119305512 14:73604990-73605012 TGGGACTCATTGGGAAAAACAGG - Intergenic
1120494970 14:85223622-85223644 TCTGGTGCTTTGGGAAAAAAGGG - Intergenic
1121003805 14:90473395-90473417 TGGGACTCCTTGGCAAAAACAGG + Intergenic
1121109940 14:91305691-91305713 TGTGGCTCCTGGGGACCAACTGG - Intronic
1121976197 14:98406211-98406233 TGGGCCTCCTAGGGAAATAAAGG + Intergenic
1127001365 15:54510979-54511001 TCTGGCTCCTTGGAAACAAGTGG + Intronic
1127186903 15:56489822-56489844 TTTGGCTCCTTTTAAAAAAATGG - Intergenic
1128363707 15:66981991-66982013 TGTGGCTGCCTGGGAGAAACAGG + Intergenic
1128565075 15:68695734-68695756 TGTGGGTCCTTGGAAAAATCAGG - Intronic
1128727386 15:69998324-69998346 TGTGGCAGCTTGCAAAAAAATGG - Intergenic
1129357756 15:75003367-75003389 TGTGGCTCTCTGGGGAACAAAGG - Intronic
1130082310 15:80744674-80744696 AGTGACTTGTTGGGAAAAAAGGG - Intronic
1133501437 16:6371035-6371057 TATGGCACCCTGGGAAAAACAGG - Intronic
1135740408 16:24970352-24970374 TGAGACTCCTTGGGAGAAAGTGG - Intronic
1138015504 16:53424816-53424838 TGGGACACCTTGGGAAAAACAGG - Intergenic
1141314832 16:82951858-82951880 TGTGGCTCCTGGGAAAGAAATGG - Intronic
1141776240 16:86124373-86124395 TCTTGCTCTTTGGGAAATAACGG + Intergenic
1143988836 17:10939240-10939262 GGGGGCTCCTTGGAAAAAATTGG + Intergenic
1144329422 17:14210935-14210957 TGTGGTTCCATGAGAAAAGATGG + Intergenic
1146785943 17:35721433-35721455 TATGGCTCCTAGGGAGAAAGAGG - Intronic
1147519527 17:41156992-41157014 TGAGGATTATTGGGAAAAAAAGG + Intergenic
1151260859 17:72914998-72915020 TGTTTTTCATTGGGAAAAAATGG + Intronic
1152129323 17:78466570-78466592 GCTGGCTCCCTGGGAGAAAAGGG - Intronic
1154365352 18:13703017-13703039 TGGGACCCCTTGGGAAAAACAGG + Intronic
1155277601 18:24203710-24203732 TGTGGCTCTTTGGGAACATGTGG - Intronic
1157396510 18:47346051-47346073 TGCTGCTCCTTGGGAAAGAGGGG + Intergenic
1157488088 18:48103514-48103536 TTTGGCAACTTGGGGAAAAATGG + Intronic
1158899412 18:61949009-61949031 TGTGGCTCTTTGAAAACAAAAGG + Intergenic
1159367989 18:67494546-67494568 TATTGCTCCTGGGGAAATAAAGG - Intergenic
1159400902 18:67932584-67932606 TGTGGCTCATAGAGACAAAAGGG + Intergenic
1159689355 18:71466869-71466891 TGTGGCATCTTGGGATCAAATGG + Intergenic
1160556764 18:79730577-79730599 TGTAGCTCTTTGGGAACAAATGG + Intronic
1160580210 18:79879355-79879377 TGAGGCACATTGGGAAAGAATGG + Intronic
1163520280 19:17787932-17787954 TGGGGATCCTTGGGAAAGATAGG + Intronic
1164903111 19:31945048-31945070 TTTGTCTCCTTGGGAGAAACAGG + Intergenic
1166278247 19:41770840-41770862 AGTGGTTCCATGGGATAAAATGG - Exonic
1166289734 19:41854880-41854902 AGTGGCCCCTTGGGAACATAGGG - Intergenic
1166402564 19:42494204-42494226 TGGGACTCCTTGGGAAAAACAGG - Intergenic
1166900910 19:46062081-46062103 TGGAACTCCTTGGGAAAAACAGG - Intronic
1167119475 19:47507971-47507993 CAAGGCTCCTTGGGAAAATAAGG + Intronic
1168027610 19:53654353-53654375 TGGGACTCCTTGGGAAAAACAGG + Intergenic
1168254862 19:55159713-55159735 TCTGGGTCCTGGGGAAAGAAGGG + Intronic
928632295 2:33206107-33206129 AGTGGCTCTTTGGGGAACAATGG + Intronic
930133468 2:47877417-47877439 TGTTGCTTAGTGGGAAAAAATGG - Intronic
931795110 2:65701016-65701038 TGTGCCTCGTTGGGTAAAACAGG + Intergenic
934724285 2:96605363-96605385 TGTGTCCCCTTGGGAGATAAGGG + Exonic
936267896 2:111024146-111024168 TGTGGCTCCATGACAAAGAAGGG + Intronic
938836865 2:135112676-135112698 TGTTGCCGCTTGAGAAAAAAAGG - Intronic
939782374 2:146465055-146465077 TGTGTATCCTGGGGAAAACAGGG + Intergenic
940946464 2:159623571-159623593 TGAGGCTCCTATAGAAAAAAGGG + Intergenic
941322896 2:164077459-164077481 AGTGGCACCTTGGAAAATAAAGG - Intergenic
941639588 2:167972750-167972772 TGGGACTCCTTGGGAAAAACAGG + Intronic
943720063 2:191194647-191194669 TGGGGTTCCTTGGGAAGAAAAGG - Intergenic
944377620 2:199065536-199065558 TGTGTCCCTTTGGGAAAAAAAGG - Intergenic
944833636 2:203557257-203557279 TGGGAATCCTGGGGAAAAAAAGG + Intergenic
945913479 2:215677268-215677290 TGGGCCTTTTTGGGAAAAAAAGG - Intergenic
946118629 2:217489151-217489173 TATGGCTGCTTGGCAAAAGATGG + Intronic
948292740 2:236838479-236838501 TGTGGCTTTGGGGGAAAAAAGGG - Intergenic
948877868 2:240839766-240839788 TGTGGCTTCTGGGAAAAAAGAGG + Intergenic
1169181824 20:3575909-3575931 TGTGGTTCCTGGGGACACAATGG - Exonic
1171012153 20:21514637-21514659 TGTGGCGCCTTTGGAAAAGGGGG + Intergenic
1173900335 20:46583030-46583052 TGTGGCTCCCTGGGCAACCAAGG + Intronic
1174708790 20:52683978-52684000 TGAGGCTCCTTAAGAAAAATCGG - Intergenic
1175053840 20:56179387-56179409 TGTGGCCACTTTGCAAAAAAAGG - Intergenic
1175754247 20:61519452-61519474 TGTAGCTCCTTTGGTCAAAAAGG - Intronic
1180134013 21:45849169-45849191 TTTGGAACCTTGGGAGAAAAAGG - Intronic
1180599848 22:17008507-17008529 GGTGGCTCCTTGGGAGAAGAGGG + Intergenic
1181714517 22:24714384-24714406 TATGGCTCCTGGGGAATATATGG + Intergenic
1182483736 22:30626815-30626837 TCAGACTCCTTGGCAAAAAACGG + Exonic
1184085538 22:42261018-42261040 TGTTGCTTCTTGGGTAGAAAGGG - Intronic
949188374 3:1220707-1220729 TGTGGCTCCTGAGTAAAAATAGG - Exonic
950145080 3:10643262-10643284 TGTGGATCCATGGGAGAGAACGG + Intronic
950152002 3:10694965-10694987 TGTGGCTGCTTGTGATTAAAAGG + Intronic
951010301 3:17669584-17669606 TAGGGCTCCTTGGTAAAATAAGG + Intronic
953106384 3:39884752-39884774 TGTGGCTGTTAAGGAAAAAAAGG - Intronic
953232550 3:41077657-41077679 TGTGGGCCCTAGGGCAAAAATGG + Intergenic
953384272 3:42497506-42497528 TGTGGCTGCTTTTGAAAACAGGG + Intronic
953525620 3:43687872-43687894 TGTGTCTTCTTGGGAGACAATGG - Intronic
954504829 3:51059837-51059859 GATGGATCCTGGGGAAAAAAGGG - Intronic
955922930 3:63976780-63976802 TGAGGCTTATTGGGAAAACAGGG + Intronic
956940510 3:74155660-74155682 TGATGCTCCTTAGGAAAAATAGG - Intergenic
958053867 3:88384580-88384602 TATTGCTCTTTGGGGAAAAATGG - Intergenic
958149863 3:89677645-89677667 TGTGGCTACTAGGAAACAAAGGG - Intergenic
961595805 3:128015332-128015354 TGGGACTCCTTGGGAAAAACAGG + Intergenic
961614204 3:128165924-128165946 TGTGGCACTTGAGGAAAAAATGG + Intronic
962455098 3:135557846-135557868 TATTTCTCCTTGTGAAAAAAAGG - Intergenic
963249969 3:143094346-143094368 TGTTGCTACTTTGGAAAAAATGG - Intergenic
964370673 3:155996987-155997009 ACTGGCTTCTTGGAAAAAAATGG + Intergenic
966202981 3:177376764-177376786 TGTGCCCCCTTGATAAAAAATGG - Intergenic
969280534 4:6167582-6167604 TGGGGCTCCTTGTTAAAAAATGG - Intronic
969485147 4:7468001-7468023 TGTGGCTCCATGGGGCAGAAAGG - Intronic
971348708 4:25836968-25836990 TGTGGCTACTGGGGAGAAATTGG - Intronic
971814107 4:31464941-31464963 TGGGACTCCTTGGAAAAAACAGG - Intergenic
972669943 4:41205482-41205504 TTTGGGTCCCTGGGAAAAAAGGG + Intronic
973854894 4:55001480-55001502 AGTGGATCTTTGGGGAAAAAGGG + Intergenic
974510698 4:62836676-62836698 TGTGGATCCCTAGGAAAGAATGG - Intergenic
974634278 4:64539068-64539090 CTTAGCTCCTTGTGAAAAAATGG + Intergenic
975662096 4:76698410-76698432 TGTCATTCATTGGGAAAAAATGG - Intronic
976350196 4:84051983-84052005 CGTTGTTCCTTAGGAAAAAAGGG + Intergenic
977717604 4:100199502-100199524 TATGGCTCTTGGGGAAAAACAGG - Intergenic
979041765 4:115807088-115807110 TGTTGCTCCTTAGCAAGAAAAGG - Intergenic
980343545 4:131583379-131583401 TGTGCCCCCATGGGAGAAAAAGG - Intergenic
981828044 4:148967458-148967480 TATGGCTCCTTTTGCAAAAATGG + Intergenic
984749278 4:183256360-183256382 TGTATCTACTTGGGAAAGAAAGG - Intronic
985099907 4:186448611-186448633 TCTGGCTGCCTGGGAAAAACAGG - Intronic
986067265 5:4246742-4246764 TGTGGCTTATTGGGAAATACAGG - Intergenic
988136594 5:27179741-27179763 TGTAGCTCCTTGGGGAAAGGTGG - Intergenic
989194779 5:38706240-38706262 GGTTGCTCCTTAGGAAAAGAAGG - Intergenic
990523497 5:56602701-56602723 TCTGGCTCTTTTAGAAAAAAGGG - Intronic
990835493 5:60014728-60014750 TGTGCCACCTTGGAAGAAAAGGG + Intronic
992005166 5:72470435-72470457 TCTGGCTCTTTTGGAAAGAAAGG - Intronic
994150458 5:96441616-96441638 AGTGGCACCTTAGAAAAAAAGGG + Intergenic
994431375 5:99666440-99666462 TGTAGCTCAATGGGGAAAAAAGG - Intergenic
994522158 5:100853575-100853597 TGTTGCTCTTTGGAATAAAATGG + Intronic
994606873 5:101979059-101979081 TGGGGATCCTTGAGAAACAAAGG - Intergenic
995357405 5:111254815-111254837 TGTGGATCATTGGGTAAAAAGGG + Intronic
995832191 5:116365324-116365346 GGTGGCTCCTTGGGGAGAAGGGG + Intronic
997210698 5:132075093-132075115 TCTGACTCCTTGGGATGAAATGG - Intronic
997512083 5:134460860-134460882 AGTGGCTCCCTGGGAGCAAAGGG - Intergenic
997723170 5:136097282-136097304 TGTAGCAACTTGGGAAGAAAGGG + Intergenic
998861540 5:146448327-146448349 TGAGGTTCCAGGGGAAAAAAAGG - Intronic
1001382310 5:171312572-171312594 TGAGGCTCCGCGGGAAAAAGAGG - Intergenic
1001956242 5:175849981-175850003 TGTGGCTCCTTTGGAGCACAGGG - Intronic
1004651223 6:17611329-17611351 AGTTGCTACTTGGGAATAAAGGG + Exonic
1004821314 6:19371107-19371129 AGCTTCTCCTTGGGAAAAAAAGG + Intergenic
1006406449 6:33848500-33848522 TGTGGCTTCTGGGGGATAAAGGG + Intergenic
1008540973 6:52546215-52546237 TGTGACTCCCTGGGAAAATGAGG + Intronic
1009716783 6:67408063-67408085 TGGAACTCCTTGGGAAAAACAGG + Intergenic
1010104069 6:72147530-72147552 TGGGACTCCTTGGGAAACAGAGG - Intronic
1010653623 6:78484777-78484799 TGTGACCACTTGGAAAAAAATGG - Intergenic
1010719146 6:79262714-79262736 TGGGACTCCTTGGGCAAAACAGG - Intergenic
1010822975 6:80437377-80437399 TGAGGCTCTTTGCAAAAAAAAGG - Intergenic
1010985384 6:82417698-82417720 TGTGCCTCCTTGTAAAAATATGG + Intergenic
1012026546 6:94001097-94001119 TGTTATTCTTTGGGAAAAAAAGG - Intergenic
1013054057 6:106565926-106565948 TGTGACTCAATTGGAAAAAATGG + Intronic
1015125091 6:129745421-129745443 TGTGGTTATGTGGGAAAAAAAGG - Intergenic
1015377524 6:132527684-132527706 TGGGACTCCTTGGGAAAAACAGG + Intergenic
1015894794 6:138006994-138007016 TGGGGCTCCTTGGGAAAGATGGG - Intergenic
1018946754 6:168352696-168352718 TATGTCTTCTTGGGAGAAAATGG - Intergenic
1019996935 7:4730596-4730618 TGTGGCGGCTTTGGAAAATAAGG - Intronic
1020350549 7:7214286-7214308 TGGAACTCCTTGGGAAAAACAGG - Intronic
1021126037 7:16851988-16852010 TGTGCCACCATGTGAAAAAAAGG - Intergenic
1024153510 7:46597105-46597127 TGCTGCTCCTAGGGAAAAGAAGG + Intergenic
1027414513 7:77960870-77960892 TGTGCCTGCTTAGGAAGAAAGGG - Intergenic
1028326891 7:89539447-89539469 TTTGGGTCCTCGGAAAAAAATGG - Intergenic
1029521803 7:101067524-101067546 TGTGAATCTTTGGGAAAAGAGGG + Intergenic
1029811058 7:103049652-103049674 TGGGACTCCTTGGGAAAAACAGG - Intronic
1030696910 7:112595472-112595494 TGAGGCTTCTAGGGAAAAATTGG - Intergenic
1032823255 7:135544246-135544268 TTTGTTTTCTTGGGAAAAAAGGG + Intergenic
1035642769 8:1196692-1196714 TGCGGCTGCTTGGGAAATCATGG - Intergenic
1037435205 8:18855335-18855357 TGTGGCTTTTTGGGAACACATGG - Intronic
1038043234 8:23744520-23744542 TATGGCTGCTTGACAAAAAATGG + Intergenic
1039183774 8:34894178-34894200 TGGGACTCCTTGGAAAAAACAGG + Intergenic
1042253578 8:66780852-66780874 TCTGGCTACTGGGGAAAAAATGG + Intronic
1042973233 8:74433935-74433957 TGTGGCTCCATGGGGAAGGAAGG + Intronic
1044434971 8:92151134-92151156 TCTGGCTACTTGGTAAAAGAAGG + Intergenic
1045321353 8:101084231-101084253 TGTTGCTTCTGGGGAACAAAAGG + Intergenic
1046528415 8:115412216-115412238 TATGCCTACTTAGGAAAAAAAGG - Exonic
1046748967 8:117906749-117906771 GTTGTCTCCTTGGGAAAGAATGG + Intronic
1048583238 8:135748329-135748351 GGTGGCTCCATGGTAATAAAGGG - Intergenic
1050237430 9:3596683-3596705 TGTCCCTCCTTGAGACAAAAAGG - Intergenic
1050524604 9:6534585-6534607 TGGGGCACCTTGTGAAATAAGGG - Intronic
1051271644 9:15361048-15361070 TATGGCTGATTGGGGAAAAAGGG - Intergenic
1051357412 9:16252648-16252670 TATGGCTCCTTTGGTATAAAGGG - Intronic
1052421739 9:28251233-28251255 TCTGGGTTCTTGGGAAAAAAAGG - Intronic
1052713283 9:32084013-32084035 TGTTTCTCCTTGTGAAAGAAAGG - Intergenic
1052743485 9:32416435-32416457 AGACACTCCTTGGGAAAAAAGGG - Intronic
1052862120 9:33443646-33443668 TTTGGCCCCTTGGGAAAGGAGGG - Intronic
1053453710 9:38214536-38214558 TTTGTCTCCTTGGGAAATTAGGG - Intergenic
1054811897 9:69441705-69441727 TGTGCCTCCTTGGGAGAATGGGG + Intronic
1055829603 9:80362206-80362228 TTTTCCTCTTTGGGAAAAAATGG - Intergenic
1056726926 9:89127441-89127463 TGGGGCTCCTTGAGAAAAACAGG + Intronic
1056920495 9:90783893-90783915 TGAGGCTCCTTGGACAAAGAGGG + Intergenic
1056990547 9:91406352-91406374 TGTAACTCCTTAGGAATAAAAGG - Intergenic
1057324888 9:94052941-94052963 TGTGGCTGCTTGTGGGAAAAAGG + Intronic
1057780672 9:98047458-98047480 TGGGACTCCTTGGGTAAAACAGG + Intergenic
1058355754 9:104081966-104081988 TGGGACTCCTTGGGAAAAACAGG - Intergenic
1058838815 9:108885742-108885764 AGTTGTTCCTTGGGAAAAAATGG - Intronic
1060100686 9:120838349-120838371 TTTGGCTCGTTGGCAAAGAAGGG - Intronic
1062065107 9:134522497-134522519 AGGGGCTTCTGGGGAAAAAACGG - Intergenic
1188539093 X:31229723-31229745 TTTGGCTTCTTGGGAAAATTTGG - Intronic
1190059958 X:47204386-47204408 TGTTGCTACTGGGGAAATAAAGG - Intronic
1191617244 X:63182421-63182443 TGGGACTCCTTGGGAAAAACAGG + Intergenic
1191619054 X:63196502-63196524 TGGGACTCCTTGGGAAAAACAGG - Intergenic
1193700497 X:84754963-84754985 TGTTGCCCCTTGGTAAAAGATGG - Intergenic
1194131474 X:90087737-90087759 TGGGACTCCATGGGAAAAACAGG - Intergenic
1194288968 X:92045417-92045439 TGTGGGTCATCAGGAAAAAAAGG + Intronic
1194379907 X:93178943-93178965 TGGGACTCCTTGGGAAAAATAGG + Intergenic
1195535843 X:106008503-106008525 TGTGGCTCCTTCTTAAAAACTGG + Intergenic
1196527030 X:116739316-116739338 TTTGGTTCCTTGGTAGAAAAAGG - Intergenic
1197778826 X:130139586-130139608 TTAAGCTCCTAGGGAAAAAATGG - Intronic
1198020684 X:132654835-132654857 TGTGGCTCCTTGAGGAAGAGTGG - Intronic
1198181978 X:134219230-134219252 TGGGACTCCTTGAGAAAAACAGG - Intergenic
1199158464 X:144578183-144578205 TATGGCCACTTGGAAAAAAATGG + Intergenic
1200606486 Y:5269985-5270007 TGTGGGTCATCAGGAAAAAAAGG + Intronic
1200684552 Y:6246841-6246863 TGTGACTCTTTGGGGAACAAAGG + Intronic
1200990081 Y:9338100-9338122 TGTGACTCTTTGGGGAACAAAGG + Intronic
1200992743 Y:9358415-9358437 TGTGACTCTTTGGGGAACAAAGG + Intronic
1200995396 Y:9378693-9378715 TGTGACTCTTTGGGGAACAAAGG + Intronic
1200998061 Y:9399039-9399061 TGTGACTCTTTGGGGAACAAAGG + Intronic
1201000571 Y:9467573-9467595 TGTGACTCTTTGGGGAACAAAGG + Intronic
1201003237 Y:9487903-9487925 TGTGACTCTTTGGGGAACAAAGG + Intronic
1201005894 Y:9508185-9508207 TGTGACTCTTTGGGGAACAAAGG + Intergenic
1201008551 Y:9528498-9528520 TGTGACTCTTTGGGGAACAAAGG + Intronic
1201011133 Y:9548667-9548689 TGTGACTCTTTGGGGAACAAAGG + Intergenic
1201187654 Y:11419743-11419765 TGTAGCTCATTTGGAAGAAAAGG - Intergenic
1202044463 Y:20724724-20724746 TGTGGCTCCTTGGAAATTGAAGG - Intergenic
1202302964 Y:23437238-23437260 TGTGGCTCCTTGGGAAAAAGAGG - Intergenic
1202567847 Y:26233356-26233378 TGTGGCTCCTTGGGAAAAAGAGG + Intergenic