ID: 919967653

View in Genome Browser
Species Human (GRCh38)
Location 1:202544768-202544790
Sequence GTTCCCTTTATGCACATTAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 134
Summary {0: 3, 1: 0, 2: 0, 3: 11, 4: 120}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
919967653_919967654 26 Left 919967653 1:202544768-202544790 CCATTAATGTGCATAAAGGGAAC 0: 3
1: 0
2: 0
3: 11
4: 120
Right 919967654 1:202544817-202544839 ACCAGTCCTACAAACTAATTAGG 0: 3
1: 0
2: 0
3: 1
4: 80
919967653_919967656 27 Left 919967653 1:202544768-202544790 CCATTAATGTGCATAAAGGGAAC 0: 3
1: 0
2: 0
3: 11
4: 120
Right 919967656 1:202544818-202544840 CCAGTCCTACAAACTAATTAGGG 0: 3
1: 0
2: 0
3: 4
4: 70

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
919967653 Original CRISPR GTTCCCTTTATGCACATTAA TGG (reversed) Intronic