ID: 919967654 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 1:202544817-202544839 |
| Sequence | ACCAGTCCTACAAACTAATT AGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | 84 | |||
| Summary | {0: 3, 1: 0, 2: 0, 3: 1, 4: 80} |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 919967653_919967654 | 26 | Left | 919967653 | 1:202544768-202544790 | CCATTAATGTGCATAAAGGGAAC | 0: 3 1: 0 2: 0 3: 11 4: 120 |
||
| Right | 919967654 | 1:202544817-202544839 | ACCAGTCCTACAAACTAATTAGG | 0: 3 1: 0 2: 0 3: 1 4: 80 |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 919967654 | Original CRISPR | ACCAGTCCTACAAACTAATT AGG | Intronic | ||