ID: 919967654

View in Genome Browser
Species Human (GRCh38)
Location 1:202544817-202544839
Sequence ACCAGTCCTACAAACTAATT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 84
Summary {0: 3, 1: 0, 2: 0, 3: 1, 4: 80}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
919967653_919967654 26 Left 919967653 1:202544768-202544790 CCATTAATGTGCATAAAGGGAAC 0: 3
1: 0
2: 0
3: 11
4: 120
Right 919967654 1:202544817-202544839 ACCAGTCCTACAAACTAATTAGG 0: 3
1: 0
2: 0
3: 1
4: 80

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
919967654 Original CRISPR ACCAGTCCTACAAACTAATT AGG Intronic