ID: 919968429

View in Genome Browser
Species Human (GRCh38)
Location 1:202553284-202553306
Sequence CAGCTTTTATGGCCCAACTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 111
Summary {0: 3, 1: 0, 2: 1, 3: 8, 4: 99}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
919968429 Original CRISPR CAGCTTTTATGGCCCAACTG GGG (reversed) Intronic
902464275 1:16605849-16605871 CAGCTTATCTGCCCCTACTGTGG - Intronic
911798410 1:102102903-102102925 TAGCTTTTATGTCACAACTTTGG - Intergenic
912468910 1:109893100-109893122 CAGCTCTTCTTACCCAACTGGGG - Intergenic
919968429 1:202553284-202553306 CAGCTTTTATGGCCCAACTGGGG - Intronic
920154238 1:203935378-203935400 GAGCTTTTATGGCCCCAGAGAGG + Intergenic
923167915 1:231384835-231384857 CTGCTTTTGTGCCCCAACTCCGG + Intronic
1064656860 10:17565073-17565095 CAGTTTTTATGGGCCAGATGTGG - Intergenic
1066208983 10:33217879-33217901 CAGCTTTAATGGAAAAACTGAGG + Intronic
1069414170 10:68183573-68183595 CAGCTTCTATTGCCTGACTGGGG - Intronic
1069480011 10:68773353-68773375 TAGCTTTTATGGCACAGCTTAGG - Intronic
1075532793 10:123244220-123244242 CAGTTTTTATGGTCAAACTGAGG - Intergenic
1076015623 10:127025362-127025384 AAGCTTTTTTGGCGCAGCTGTGG + Intronic
1077285587 11:1763920-1763942 CAGCTGATCCGGCCCAACTGCGG - Exonic
1079318664 11:19431541-19431563 CAGTTTTTCTGGCCAAAGTGAGG + Intronic
1081018098 11:37907822-37907844 CAGCTGTTAGGCCCCAAGTGTGG - Intergenic
1088815127 11:113415433-113415455 GAGCTTTCAGGGCCCACCTGAGG - Exonic
1103055982 12:117820716-117820738 CAGGTTTTATGGCATATCTGAGG - Intronic
1103341587 12:120223952-120223974 CAGGTTTCCTGGCCCAACTGTGG - Intronic
1104390109 12:128384748-128384770 CAGCCTTTAGTGCCCCACTGTGG - Intronic
1107772800 13:43806595-43806617 CAGATTTTATAGACCACCTGTGG - Intergenic
1109437391 13:62323593-62323615 CAGCTTTCATGGCCAATTTGTGG + Intergenic
1109595116 13:64542623-64542645 CAGTTTTTTAGGCCCAATTGTGG + Intergenic
1114372850 14:22109561-22109583 CACCCTTTATGGCCCAATTCAGG + Intergenic
1114501519 14:23172577-23172599 CAGCATTCCCGGCCCAACTGGGG + Intronic
1114638541 14:24203233-24203255 CAGCATTGAGGGCCCAACTGAGG - Intronic
1117973291 14:61273129-61273151 GAGGTTTTATGGCCCTTCTGTGG + Intronic
1119419989 14:74502803-74502825 CAGCATCTATGGCCCAGATGGGG - Exonic
1122310347 14:100790389-100790411 CAGCTTCTATGGTCTAACAGAGG + Intergenic
1123060292 14:105591385-105591407 CAGCTTTCATGGCTGAGCTGAGG - Intergenic
1130433696 15:83874776-83874798 CAGCAATTAGGGCCCATCTGAGG + Intronic
1131351497 15:91704919-91704941 CAGCTTTAATGGCCTCATTGTGG + Intergenic
1139552656 16:67683970-67683992 CAGATTTTATAGTCCAATTGAGG - Intronic
1144837411 17:18163913-18163935 CAGATTTTAGGGCCCAAGTCAGG + Intronic
1152644074 17:81460816-81460838 CAGCTTTGTGGGCCCAGCTGGGG + Intronic
1156506334 18:37597083-37597105 CAGCTTTTCTAGCCCATCTCTGG + Intergenic
1163061325 19:14764200-14764222 CAGATGTGATGGCACAACTGTGG - Intronic
924990757 2:310818-310840 CAGCTTTCAGGGCTCACCTGTGG - Intergenic
925150132 2:1610044-1610066 CAGTTGTGATGGCCCAGCTGTGG - Intergenic
926968734 2:18444798-18444820 CAGCTATTAGGGTCCAGCTGAGG + Intergenic
929887413 2:45891412-45891434 CAGCTTTTGTGGTACAACTTGGG - Intronic
930952508 2:57160394-57160416 CACCTTTTATAACCAAACTGAGG - Intergenic
944464866 2:199990997-199991019 CACATTTTATGCCCCAAGTGAGG - Intronic
946215681 2:218181760-218181782 CAGCTCTTTTGGCCAAACTGGGG + Intergenic
1170363913 20:15579529-15579551 CAGCTTTAACTGCCAAACTGAGG + Intronic
1173199472 20:40943986-40944008 CTGCTTTTGTGGACCCACTGTGG - Intergenic
1176522527 21:7835254-7835276 CAGCTGTAATGCCCAAACTGTGG - Intergenic
1178656547 21:34465266-34465288 CAGCTGTAATGCCCAAACTGTGG - Intergenic
1180165879 21:46028426-46028448 CTGGTTCTGTGGCCCAACTGAGG - Intergenic
1182336832 22:29589197-29589219 AAGCTTTTATGTCTCACCTGGGG + Intergenic
1182365007 22:29772704-29772726 CAGGTTTTAGGGCCCATATGGGG + Intergenic
1183245793 22:36692466-36692488 CAGCTTTTATGGCAAAGCTGGGG + Intronic
1185078929 22:48698711-48698733 GAGCTTTTCTGGCCCTACAGCGG + Intronic
1185136438 22:49076023-49076045 CAGGTGTTATGTCCCAGCTGTGG + Intergenic
954816610 3:53287002-53287024 CAACTTTTAAGGCCCAAATGGGG + Exonic
956694780 3:71908880-71908902 CAGCTTTCATGGCCCATTTAAGG - Intergenic
958951941 3:100426219-100426241 CAGAGTTTATGGCCCCACAGAGG + Intronic
960816331 3:121676986-121677008 CAGATTTTGTGACCCATCTGGGG + Exonic
962866118 3:139449159-139449181 CAGTTTTTATGACCCACCTAGGG + Intergenic
966076307 3:175939746-175939768 TGTCTTTTATGGCCCAAATGTGG - Intergenic
966238762 3:177731290-177731312 CTGCTTTTAACGCCCAACTCAGG + Intergenic
966300611 3:178475570-178475592 GAGCTTTTGTGGCCCAAATATGG - Intronic
967693773 3:192507208-192507230 CAGCTTTTAAGGCTCTTCTGGGG + Intronic
968396641 4:244398-244420 CAGCATTAAAGTCCCAACTGAGG + Intergenic
969393467 4:6906278-6906300 CAGCTTGTGTGGATCAACTGTGG + Intergenic
971540232 4:27807072-27807094 CAGTTTTTTTTGCCCAACTGAGG - Intergenic
977173089 4:93786742-93786764 CAGCTTTGAGGGCTCAGCTGAGG + Intergenic
977309704 4:95370492-95370514 CAGGTCCTAAGGCCCAACTGTGG - Intronic
981222266 4:142251044-142251066 CAGAGTTTATGGCACAACTATGG + Intronic
984891577 4:184498755-184498777 CAGCTTCTCTGGCACGACTGGGG + Intergenic
989427452 5:41313092-41313114 TAGCTATGATTGCCCAACTGTGG + Exonic
989520736 5:42397062-42397084 CAGCTCTTTTGGCCCCACTATGG - Intergenic
995097700 5:108258605-108258627 CAGGTTTTTTGACCCAACTCTGG - Intronic
995736409 5:115304950-115304972 CATCTTTTAAGGCCCATCTTTGG - Intergenic
997413174 5:133705529-133705551 AAGGATTTATGGCCCAACTGAGG - Intergenic
1003644424 6:7902935-7902957 CAGCTGTTATGGCCAGGCTGAGG + Intronic
1007076402 6:39069704-39069726 CACCTTGTATGGCCCATTTGTGG + Intronic
1007348649 6:41252010-41252032 CTGTTTCTCTGGCCCAACTGTGG - Intergenic
1008838003 6:55861242-55861264 CAGCTTCTCTGACCCCACTGGGG - Intronic
1010004545 6:70981172-70981194 CATCTTTTATGGCCTGGCTGTGG + Intergenic
1010004577 6:70981272-70981294 CATCTTTTATGGCCTGGCTGTGG + Intergenic
1010004609 6:70981377-70981399 CATCTTTTATGGCCTGGCTGTGG + Intergenic
1011078627 6:83465090-83465112 CTGCTTCCATGGCCCATCTGAGG + Intergenic
1013611978 6:111804276-111804298 CAGATTTTATGGGGGAACTGGGG + Intronic
1013765490 6:113569703-113569725 CAACTATCATGGCCAAACTGTGG - Intergenic
1016716530 6:147238406-147238428 GATCTTTTATGACCCAAATGAGG + Intronic
1018329048 6:162708299-162708321 CAGATTTTATGTCCCAATTAAGG + Intronic
1018901758 6:168055106-168055128 AAGCTTCTCTGGCCCCACTGGGG - Intergenic
1021395215 7:20139172-20139194 CAGCCTTAATGGCCCTAATGTGG + Exonic
1021477524 7:21079667-21079689 CATCCTCTATGGCCCAACTTAGG - Intergenic
1021999584 7:26213534-26213556 AAACTTTTATTTCCCAACTGTGG - Intergenic
1022739205 7:33105409-33105431 TAGTTTTTATGGCCCACTTGTGG - Intronic
1023230449 7:38022303-38022325 CATCCTTTATCTCCCAACTGAGG + Intronic
1023524974 7:41092673-41092695 TAGCTTTCCTGTCCCAACTGCGG - Intergenic
1025826082 7:65011582-65011604 CATCTTTTATGACCTAACTTTGG - Intergenic
1025913638 7:65848049-65848071 CATCTTTTATGACCTAACTTTGG - Intergenic
1025975983 7:66370318-66370340 CATCTTTTATGACCTAACTTTGG + Intronic
1026045415 7:66903057-66903079 CAGCTCTTCAGGCCCACCTGTGG + Intergenic
1030697079 7:112597350-112597372 CAGGTTTTAAGGACCAACTTGGG - Intergenic
1030982319 7:116200783-116200805 CAGCTGAAATGGCCCAGCTGGGG + Intergenic
1031919972 7:127593329-127593351 CAGCTTTTATGGCCCTTAGGAGG - Intronic
1032190364 7:129761993-129762015 CAACTTTCATAGCCCAAATGAGG - Intergenic
1034102211 7:148459556-148459578 CATCTTTTGTGCCCCAACTTGGG + Intergenic
1035696540 8:1602056-1602078 CAGCTTGCATGGCCCAAGTCTGG - Intronic
1038179386 8:25212400-25212422 CAGCTTTTAAGGACCAACTGTGG + Intronic
1044611308 8:94094995-94095017 GAGCTTTTATGGACCGAATGCGG + Intergenic
1053165774 9:35842600-35842622 CATCTTCTTTGGCCCAAGTGTGG + Exonic
1055697917 9:78908089-78908111 GAGCTTTTATGGACTAATTGGGG + Intergenic
1056801263 9:89693733-89693755 CAGCTTTAGTCTCCCAACTGGGG - Intergenic
1200272649 X:154700424-154700446 CAGCATTAAGGGCCCAATTGAGG + Intronic
1202304240 Y:23451257-23451279 CAGCTTTTATGGCCCAACTGGGG - Intergenic
1202566570 Y:26219334-26219356 CAGCTTTTATGGCCCAACTGGGG + Intergenic