ID: 919969732

View in Genome Browser
Species Human (GRCh38)
Location 1:202567251-202567273
Sequence CTGCTGCTCTAAAAGAAAAA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 504
Summary {0: 1, 1: 0, 2: 3, 3: 45, 4: 455}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
919969731_919969732 -10 Left 919969731 1:202567238-202567260 CCACATATGAAAACTGCTGCTCT 0: 1
1: 0
2: 3
3: 42
4: 264
Right 919969732 1:202567251-202567273 CTGCTGCTCTAAAAGAAAAATGG 0: 1
1: 0
2: 3
3: 45
4: 455
919969729_919969732 -6 Left 919969729 1:202567234-202567256 CCACCCACATATGAAAACTGCTG 0: 1
1: 0
2: 0
3: 20
4: 153
Right 919969732 1:202567251-202567273 CTGCTGCTCTAAAAGAAAAATGG 0: 1
1: 0
2: 3
3: 45
4: 455
919969728_919969732 -5 Left 919969728 1:202567233-202567255 CCCACCCACATATGAAAACTGCT 0: 1
1: 0
2: 7
3: 103
4: 607
Right 919969732 1:202567251-202567273 CTGCTGCTCTAAAAGAAAAATGG 0: 1
1: 0
2: 3
3: 45
4: 455
919969724_919969732 13 Left 919969724 1:202567215-202567237 CCTAAGAACCCCTTAAAGCCCAC 0: 1
1: 0
2: 0
3: 13
4: 150
Right 919969732 1:202567251-202567273 CTGCTGCTCTAAAAGAAAAATGG 0: 1
1: 0
2: 3
3: 45
4: 455
919969723_919969732 26 Left 919969723 1:202567202-202567224 CCATGAATGGACTCCTAAGAACC 0: 1
1: 0
2: 1
3: 3
4: 95
Right 919969732 1:202567251-202567273 CTGCTGCTCTAAAAGAAAAATGG 0: 1
1: 0
2: 3
3: 45
4: 455
919969726_919969732 4 Left 919969726 1:202567224-202567246 CCCTTAAAGCCCACCCACATATG 0: 1
1: 0
2: 1
3: 3
4: 86
Right 919969732 1:202567251-202567273 CTGCTGCTCTAAAAGAAAAATGG 0: 1
1: 0
2: 3
3: 45
4: 455
919969725_919969732 5 Left 919969725 1:202567223-202567245 CCCCTTAAAGCCCACCCACATAT 0: 1
1: 0
2: 0
3: 4
4: 124
Right 919969732 1:202567251-202567273 CTGCTGCTCTAAAAGAAAAATGG 0: 1
1: 0
2: 3
3: 45
4: 455
919969730_919969732 -9 Left 919969730 1:202567237-202567259 CCCACATATGAAAACTGCTGCTC 0: 1
1: 0
2: 0
3: 18
4: 229
Right 919969732 1:202567251-202567273 CTGCTGCTCTAAAAGAAAAATGG 0: 1
1: 0
2: 3
3: 45
4: 455
919969727_919969732 3 Left 919969727 1:202567225-202567247 CCTTAAAGCCCACCCACATATGA 0: 1
1: 0
2: 0
3: 12
4: 139
Right 919969732 1:202567251-202567273 CTGCTGCTCTAAAAGAAAAATGG 0: 1
1: 0
2: 3
3: 45
4: 455

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
919969732 Original CRISPR CTGCTGCTCTAAAAGAAAAA TGG Intronic
901955288 1:12779836-12779858 TTACTGCTCTAAAAGATAAATGG - Intergenic
902113158 1:14099757-14099779 TTTCTGCTCTAAAAGTGAAATGG + Intergenic
904058913 1:27691249-27691271 CTGCTGCTCAAAAGAAAAGAGGG - Intergenic
904069166 1:27779789-27779811 CTCTTTCTCTAAAAAAAAAAAGG - Intronic
904262129 1:29294175-29294197 CTGCTGCTAGGAAAGAAAACAGG - Intronic
904512293 1:31022163-31022185 CTGCTCATCTAAAAAAAAATGGG + Intronic
904859809 1:33527376-33527398 CTCCTGGTCTAAAAAAAATAAGG - Intronic
905328478 1:37175309-37175331 CTGAGGATCAAAAAGAAAAAGGG - Intergenic
906422563 1:45683098-45683120 CTGTTGGTCTAAAAGATGAAAGG - Intronic
907786471 1:57617819-57617841 CTCCTGCCATAAAAGACAAAAGG + Intronic
908364460 1:63404331-63404353 CTGTTGCTTTATAAGAGAAATGG + Intronic
908632212 1:66121572-66121594 CTGTTGTTCCAAAAGGAAAATGG + Intronic
909255402 1:73414384-73414406 CAGCTGCTCTAAGAGATTAATGG - Intergenic
909276777 1:73696871-73696893 CTGGACCTCTAAATGAAAAAGGG - Intergenic
909527193 1:76638681-76638703 CTTCTGCTGCAATAGAAAAATGG - Intergenic
909912514 1:81278376-81278398 CTCCGTCTCAAAAAGAAAAAAGG - Intergenic
910138118 1:83996866-83996888 CTGCTGTTAAAAAAAAAAAAAGG - Intronic
911493579 1:98600710-98600732 CTGGTGCAGTAAGAGAAAAAGGG + Intergenic
911862786 1:102975035-102975057 GTGCTAATCTAAAAGTAAAATGG + Intronic
913001530 1:114585358-114585380 AGGCTGCTATAAAAAAAAAATGG + Exonic
914976330 1:152366915-152366937 CTGCTGCCCTAAAAGTAAGTGGG - Intergenic
915961304 1:160269147-160269169 CTGCTGCTGTGAATGTAAAATGG - Intergenic
916483873 1:165240352-165240374 CTGCTTCTTAAAAAGAAGAATGG + Intronic
916772222 1:167921534-167921556 ATGCTGATGTTAAAGAAAAATGG - Intronic
916945907 1:169727300-169727322 CTGGTGATTAAAAAGAAAAAGGG - Intronic
917327858 1:173851537-173851559 CTGCTGTTCTTGAGGAAAAAGGG - Intronic
917818601 1:178737250-178737272 CTTCATCTCAAAAAGAAAAAAGG - Intronic
918285064 1:183044829-183044851 CTGCTACCCTAAAAAAAGAAAGG - Intronic
918742030 1:188143882-188143904 CTTTTGATCTGAAAGAAAAAGGG - Intergenic
919969732 1:202567251-202567273 CTGCTGCTCTAAAAGAAAAATGG + Intronic
920099111 1:203505827-203505849 CTGCTGCTCTGAAAGTCAAGGGG - Intronic
920633025 1:207670647-207670669 CTTCTTCTCTAAAAGAGTAAGGG + Intronic
920866207 1:209756131-209756153 CTGCTGTGCAAAAAGAAAGACGG + Intronic
921805118 1:219445443-219445465 CTGCAGTTGTAAGAGAAAAAAGG + Intergenic
922302603 1:224315622-224315644 CTGCTAATGTAAAAGTAAAATGG + Intronic
922508762 1:226144039-226144061 CTCCTGCTCCAAAAGATAGATGG + Intergenic
923474696 1:234321458-234321480 CAGCTGGTAAAAAAGAAAAATGG + Intronic
923824931 1:237489649-237489671 CTCCATCTCAAAAAGAAAAAAGG + Intronic
1063111459 10:3041548-3041570 CTGCTGGTGGAAATGAAAAATGG + Intergenic
1063597146 10:7445759-7445781 CTGTTGTTCTAGAAGAAAAAAGG - Intergenic
1064739859 10:18421815-18421837 CAGCCACTCTAAAAGGAAAAAGG - Intronic
1065997055 10:31069194-31069216 CTGCTTCTCTACAAGGTAAAGGG + Intergenic
1066015965 10:31243865-31243887 ATGATGCTCTCAATGAAAAATGG - Intergenic
1066024859 10:31345651-31345673 CTGATACTCTAAAAGGAGAATGG + Intronic
1066129410 10:32377706-32377728 CAGTTTCACTAAAAGAAAAAAGG - Intronic
1066314674 10:34232705-34232727 CTTTGTCTCTAAAAGAAAAAAGG - Intronic
1066356617 10:34690748-34690770 CTGCGTCTGTAAAAGTAAAAAGG + Intronic
1067243148 10:44513416-44513438 CATGTGCTGTAAAAGAAAAAGGG + Intergenic
1068272426 10:54746304-54746326 ATACTGCTCAAAAAGAAAGAGGG + Intronic
1068978892 10:63039855-63039877 CTCTGTCTCTAAAAGAAAAAAGG + Intergenic
1068995890 10:63203398-63203420 TAGCTGCTCTAACAGAAAACTGG + Intronic
1068999216 10:63244798-63244820 CTCCTTCTCTTAAAAAAAAAGGG + Intronic
1069528313 10:69194356-69194378 CTCCAGCTCAAAAAAAAAAAAGG - Intronic
1069681905 10:70291525-70291547 CTGCTGCTGTGCAAGAGAAAGGG - Intergenic
1070387009 10:75934821-75934843 AAACTGTTCTAAAAGAAAAAGGG - Intronic
1073056250 10:100704653-100704675 CTGCTGGTAAAAAAGAAAAAGGG + Intergenic
1074487924 10:113906339-113906361 CTGCTACTATATAATAAAAATGG - Intronic
1074943677 10:118259640-118259662 CAGCTGCTCCAAAAATAAAAGGG + Intergenic
1075189249 10:120291280-120291302 CTGGTGACCTTAAAGAAAAATGG + Intergenic
1075250187 10:120861955-120861977 CTGATGCTTGAGAAGAAAAAGGG + Intronic
1075348060 10:121698920-121698942 CTGCTGGGCTAAAAGTAACAAGG - Intergenic
1075364457 10:121872479-121872501 CTGATGCTCTAAAAGAGAGAAGG - Intronic
1075600413 10:123763538-123763560 CTTTTGATCTAAAAAAAAAAAGG + Intronic
1076199125 10:128544341-128544363 GTGCTGTTTTAAAAGAAAAAAGG - Intergenic
1076374467 10:129973817-129973839 CTGCTGCTCTGGAAAAGAAAAGG + Intergenic
1077757754 11:5053489-5053511 ATGCTGCTCTTAAAGATAAGTGG - Intergenic
1078925541 11:15871535-15871557 CGGCTTCACTAAAAAAAAAAGGG + Intergenic
1079001401 11:16760136-16760158 CTGTGTCTCGAAAAGAAAAAAGG - Intergenic
1080428952 11:32181215-32181237 CTGCTTTTGTAAAAGGAAAAAGG + Intergenic
1081312851 11:41594274-41594296 CTGCTGCACTAAATGGAAACAGG - Intergenic
1081739412 11:45427687-45427709 CTGCTGCTCTAAAAGATTAGGGG - Intergenic
1081892405 11:46554595-46554617 CTGTTGCTTTAAAAGGATAAGGG + Intronic
1083967861 11:66053674-66053696 TTGCTTCTTTAAAAAAAAAAGGG + Intronic
1084121719 11:67072871-67072893 CTCCTTCTCAAAAAAAAAAAAGG + Intergenic
1084544802 11:69809836-69809858 CTGCTGCTTTAAGAGGAAGACGG - Intergenic
1085094826 11:73751630-73751652 ATGCTGCTGAGAAAGAAAAACGG + Intronic
1085382246 11:76130630-76130652 TTGTTACTTTAAAAGAAAAATGG - Intronic
1086211048 11:84319222-84319244 CTATTGATCTAAAATAAAAAGGG - Intronic
1086338054 11:85819237-85819259 CTGCATCTTTAAAAGACAAATGG + Intergenic
1086496757 11:87411966-87411988 CTACTGCCCTAAGAGAAGAAGGG + Intergenic
1086777797 11:90861036-90861058 CTGCTGGTGAAAAAGTAAAATGG + Intergenic
1088588795 11:111383190-111383212 CTGCTGATCAACAAGAAAAAGGG - Intronic
1088802228 11:113316692-113316714 CTGCAGCTCTAAAACAGAAATGG - Intronic
1089022881 11:115235226-115235248 CTGCTTTTCTGAAAAAAAAAGGG + Intronic
1089193904 11:116679871-116679893 CTGTGTCTCTAAAAGAAATATGG - Intergenic
1089210535 11:116797912-116797934 CTGCTGCTGGAAAGGTAAAATGG + Intergenic
1090565058 11:127981152-127981174 CTGCTTCTCTAAAATAGAGAAGG - Intergenic
1090663031 11:128895276-128895298 CTGCTGCTCAGAAAGGAAAATGG + Intronic
1090718205 11:129449269-129449291 CTGCTGCTCTTGAAGGAAAGAGG + Intronic
1092217647 12:6694264-6694286 CTGCTGCACTACATGAGAAAGGG - Exonic
1092384827 12:8027851-8027873 CTGCTACTTTAAAAGATAATGGG - Intergenic
1092586980 12:9909945-9909967 TTACTGCTCTGAAAGAGAAAAGG - Intronic
1093000285 12:13988542-13988564 ATGCTACTCTAGAAGATAAAAGG - Intergenic
1093433821 12:19113050-19113072 CTGTTGCTGTAAAGGAACAACGG + Intergenic
1093860485 12:24160346-24160368 CTGATGTACTAAAAGAAGAATGG + Intergenic
1094029688 12:25997061-25997083 CACATGCTGTAAAAGAAAAATGG - Intronic
1094086975 12:26604499-26604521 CTGCTGTTTTACAAGAAACAGGG - Intronic
1094090844 12:26647408-26647430 ATGCTGTTGTAAAAGAAAAAAGG + Intronic
1094778977 12:33767699-33767721 CTGCTGCTCTCAAAAAAGAAGGG + Intergenic
1095107200 12:38248876-38248898 TTGATGCTGTAAAAAAAAAAAGG - Intergenic
1095280666 12:40348999-40349021 TTGTAGCTCTAAAAGAAAGATGG - Intronic
1095379806 12:41577216-41577238 CTGGAGCTTTTAAAGAAAAAAGG - Intergenic
1095421643 12:42030530-42030552 CTGATGAGCTAAAAAAAAAAAGG - Intergenic
1095690154 12:45079330-45079352 CTCCTTCTCAAAAAAAAAAAGGG - Intergenic
1097408407 12:59220810-59220832 CTGCTGCAGAGAAAGAAAAAAGG + Intergenic
1097824105 12:64157007-64157029 CTGCACTTCTAAAAAAAAAAGGG + Exonic
1099566124 12:84248719-84248741 CTGTTGTTGGAAAAGAAAAAAGG - Intergenic
1099992877 12:89744477-89744499 TTGCTACTATATAAGAAAAATGG + Intergenic
1100278203 12:93091858-93091880 CTGCAGTTCTCAAAGAACAAGGG + Intergenic
1101010546 12:100444784-100444806 ATGCTGCTGTAAAAAAAGAATGG - Intergenic
1101587038 12:106094112-106094134 CTGTTGATTTAAAAAAAAAAAGG + Intronic
1101636362 12:106545763-106545785 CTACTTCTCAAAAAAAAAAAAGG + Intronic
1102262859 12:111455426-111455448 GGGCTGCTCTTAAAGAAAAATGG + Intronic
1104446876 12:128841613-128841635 TTAATGCTCTAAAGGAAAAAAGG + Intergenic
1104996539 12:132661312-132661334 CTGCTTCTCTAAAAGGAAAATGG + Intronic
1105010871 12:132755846-132755868 CTCCGTCTCAAAAAGAAAAAAGG - Intronic
1105343689 13:19553334-19553356 CTGCTGCTGGGAAAGTAAAATGG + Intergenic
1105568857 13:21580091-21580113 CAACTGTTGTAAAAGAAAAATGG - Intronic
1107223210 13:38012094-38012116 CTGCTGATTTGAAAGAGAAAAGG + Intergenic
1107532558 13:41298025-41298047 CTCCTTCTCTCAAAAAAAAAGGG - Intergenic
1108065850 13:46577029-46577051 CTGCTGGCCTGAAAGAAAAAAGG - Intronic
1108645769 13:52426059-52426081 CTGATGGTCTATAATAAAAAAGG + Exonic
1108697141 13:52912538-52912560 CTGCTGCTCTAGAGAAATAAGGG - Intergenic
1109439240 13:62347859-62347881 TTACAGCTCTAAAATAAAAATGG - Intergenic
1109589706 13:64462606-64462628 CTGCGGCCCTAAATGAAAATAGG + Intergenic
1110581198 13:77129596-77129618 CTGCTGTTTTATAATAAAAATGG + Intronic
1111199924 13:84921737-84921759 CTGCTGATAGAAAAGTAAAATGG - Intergenic
1112203885 13:97304990-97305012 CTGCTGCTTAAAAAAAATAAAGG + Intronic
1113373097 13:109740429-109740451 CTGCTGTTATAAAGGAAAAGAGG + Intergenic
1114507712 14:23231563-23231585 CTTCTACTCTGAAAGGAAAATGG - Intronic
1115036992 14:28869703-28869725 CTCCAGCTCAAAAAAAAAAAGGG + Intergenic
1115659350 14:35476567-35476589 CTTCTGAAATAAAAGAAAAAAGG - Intergenic
1115676204 14:35677902-35677924 CTGACGCCCTAAAAGAAAAAAGG + Intronic
1115775754 14:36713166-36713188 CTGCTGCTCTAAAACTTAGATGG - Intronic
1115849806 14:37582469-37582491 ATGCTGCTCTATAAGACAAAGGG + Intergenic
1116614063 14:47111386-47111408 CTGCCTCTCTAACAGAAAGAAGG + Intronic
1116945609 14:50831904-50831926 CTGCAGCTCAAAAAGAACCATGG - Intergenic
1118707574 14:68494314-68494336 GTACTGCTCTATTAGAAAAAGGG + Intronic
1119664592 14:76475821-76475843 ATGCTGCTGGAAAAGTAAAATGG - Intronic
1120314139 14:82870753-82870775 GTGCTGTTGCAAAAGAAAAATGG - Intergenic
1120340091 14:83208447-83208469 CTGCTGCTCTGAAATGAAAGAGG - Intergenic
1122666865 14:103335638-103335660 CAACAGCTCTGAAAGAAAAAGGG - Exonic
1122837942 14:104439920-104439942 CTACTGCTCAGAAAAAAAAAAGG - Intergenic
1123898355 15:24850798-24850820 CTCCTGTCCTAAAAGCAAAAGGG + Intronic
1124132368 15:27002499-27002521 ATGCTGCACTAAAAGTAGAATGG - Intronic
1124508348 15:30298761-30298783 CTGCTGGTGTGAATGAAAAATGG - Intergenic
1124735209 15:32239895-32239917 CTGCTGGTGTGAATGAAAAATGG + Intergenic
1124803408 15:32857347-32857369 CTGGATCTCTAGAAGAAAAATGG - Intronic
1125073968 15:35591002-35591024 TTGTTGCTCAAAAAAAAAAAAGG + Intergenic
1125631966 15:41154541-41154563 CTGCTGCCCTGAAAGGAAACTGG - Intergenic
1126027183 15:44458120-44458142 CTGAGGCTCAAAATGAAAAAAGG - Intronic
1127148897 15:56053723-56053745 CTGCAGCTCTAGATGATAAAAGG + Intergenic
1127698661 15:61475680-61475702 CTGCTCCCATAAAAGAGAAAGGG + Intergenic
1127986479 15:64076009-64076031 ATCCTTCTCTAAAAAAAAAAAGG + Intronic
1128628421 15:69236618-69236640 TAACCGCTCTAAAAGAAAAATGG + Intronic
1129023371 15:72545153-72545175 TTGCTGCTTTAAAAAACAAATGG - Intronic
1130092915 15:80836255-80836277 CTGCTTCTCTAAGAGCGAAAAGG + Intronic
1130812428 15:87393929-87393951 CTGCTGCTGTACAAGAAGCATGG + Intergenic
1131791288 15:95968445-95968467 CAGTTTCTCTAAGAGAAAAATGG - Intergenic
1132126825 15:99234885-99234907 CTGTTGCTGTAAATGTAAAATGG + Intronic
1133456836 16:5949683-5949705 CTGCTGTTCTACAAAACAAATGG - Intergenic
1133658180 16:7887493-7887515 CAGCTGCACTAAAAGGAAGAGGG + Intergenic
1133891086 16:9879610-9879632 CTGCTTCTTTAAAAGGAAAATGG - Intronic
1134515556 16:14883890-14883912 CAGCTTCTCTTAAAAAAAAAAGG - Intronic
1134515570 16:14884061-14884083 CAGCTTCTCTTAAAAAAAAAAGG - Intronic
1134610328 16:15603314-15603336 AGGCTGCTGAAAAAGAAAAAAGG - Intronic
1135007329 16:18838022-18838044 CAGCTACTCTAGAAGAAAACAGG + Exonic
1135179679 16:20261851-20261873 CTCCATCTCAAAAAGAAAAAAGG + Intergenic
1137330455 16:47489838-47489860 GTCCTGCTGCAAAAGAAAAATGG + Intronic
1138582392 16:57950141-57950163 CTTCTGTACAAAAAGAAAAAAGG + Intronic
1138701793 16:58871070-58871092 CTGCTTCTCTAAAACTAAGATGG + Intergenic
1138728705 16:59170245-59170267 CGGCTGCTCAAAATGATAAAGGG - Intergenic
1139907061 16:70373491-70373513 CTGTTTTTGTAAAAGAAAAATGG - Intergenic
1140505374 16:75468602-75468624 CTCCATCTCAAAAAGAAAAAAGG + Intergenic
1140546194 16:75811937-75811959 CTGCAGTTCTAAAATAGAAACGG - Intergenic
1140719892 16:77762033-77762055 CTACTGGTCGAAATGAAAAATGG - Intergenic
1141988217 16:87593788-87593810 CTGCGCCTCAAAAAAAAAAAAGG + Intergenic
1142506727 17:369057-369079 CTGCGTCTCAAAAAAAAAAAAGG - Intronic
1142682732 17:1559998-1560020 CTGCTGTTCTTGAAGATAAAAGG - Intronic
1143763784 17:9124153-9124175 CTGCTGATTTTTAAGAAAAATGG - Intronic
1144586285 17:16489823-16489845 CTGCTGCTTTCACAGAAAAGGGG + Intronic
1146989217 17:37252420-37252442 CTGATAATCTCAAAGAAAAACGG + Intronic
1147126435 17:38372804-38372826 CTGTTGTAATAAAAGAAAAAAGG + Intronic
1147298079 17:39500731-39500753 CTCCTTCTCAAAAAAAAAAAAGG - Intronic
1148473396 17:47910443-47910465 CTACCACTCTAAAGGAAAAATGG + Intronic
1148587315 17:48790318-48790340 CTGATGCTCCCAAAGAAGAAAGG - Intronic
1149127284 17:53250541-53250563 TTTCTGCTCAAAAAGAGAAAAGG + Intergenic
1149396907 17:56254580-56254602 CTGATTCTCTGAAAGAAACAAGG + Intronic
1149706429 17:58698914-58698936 CTCCTTCTCAAAAAAAAAAAAGG + Intronic
1150543288 17:66125917-66125939 CTGATGGTTTAAAAGAAAAATGG - Intronic
1152489857 17:80623334-80623356 TTGCTGATATATAAGAAAAATGG - Intronic
1152503872 17:80733951-80733973 CAGAAGCTGTAAAAGAAAAAAGG - Intronic
1152602711 17:81272915-81272937 GTATTGCTCTAAAAGCAAAAAGG - Intronic
1152609999 17:81310696-81310718 CTGCTGCTCTAAATGAAGGCAGG + Intergenic
1153471640 18:5452917-5452939 CTCCTGCTCTATTAGAAAAGGGG - Intronic
1153987498 18:10366642-10366664 CTGATGCCCTAAAACAAAAAAGG + Intergenic
1155143496 18:23064405-23064427 TTTCTGCTCTAAAAGCAAAGTGG + Intergenic
1156547693 18:37981420-37981442 CGGCTGCTCTAACTGTAAAAGGG - Intergenic
1156565648 18:38186509-38186531 CTGCTGAACTTAAAGAAATATGG - Intergenic
1156616048 18:38785535-38785557 GTGCTGCTAGAGAAGAAAAAGGG + Intergenic
1156902658 18:42319498-42319520 CTGCTGATCTAGAAGAGAAGAGG + Intergenic
1158218103 18:55121592-55121614 TGTCTGGTCTAAAAGAAAAAAGG + Intergenic
1158473393 18:57758695-57758717 CTACTTTTGTAAAAGAAAAAAGG - Intronic
1159294094 18:66459257-66459279 CTCATAATCTAAAAGAAAAATGG + Intergenic
1159611520 18:70531046-70531068 CTGATGCTATAGAAAAAAAATGG - Intergenic
1159881114 18:73859333-73859355 ATGTTGCTTTAAAAAAAAAATGG + Intergenic
1160093130 18:75845676-75845698 CAGCTGCTCAGAAAGAGAAAAGG - Intergenic
1160157660 18:76445902-76445924 CTGCTGCTCTGAAAGAAGGCAGG - Intronic
1161490690 19:4559618-4559640 CTGCTGCTCAGACAGGAAAATGG - Exonic
1161652172 19:5492144-5492166 CTCCATCTCAAAAAGAAAAAAGG + Intergenic
1163299567 19:16435361-16435383 CTGCTGTTCTGAAAGACATAGGG + Intronic
1163314003 19:16530649-16530671 CTGCAGCTCTGGGAGAAAAACGG - Exonic
1164691682 19:30215545-30215567 CTATTGCTCTAAAAGAGAAGGGG - Intergenic
1166496091 19:43304342-43304364 CTGCTGCCTTAACAGAAAAGAGG - Intergenic
1167007741 19:46786824-46786846 GGGCTGATCTAAAAGATAAAGGG + Intronic
1168723435 19:58567836-58567858 CTGCTGTTCTCAGAGAAATAAGG + Intronic
925297655 2:2788744-2788766 TTTCTGATCTAAAAAAAAAATGG - Intergenic
925692042 2:6535387-6535409 CATCTGCTTAAAAAGAAAAAGGG - Intergenic
926521079 2:13914683-13914705 CTGCTGGTCTGAATGTAAAATGG + Intergenic
926779580 2:16456595-16456617 CTCCATCTCAAAAAGAAAAAAGG + Intergenic
926844680 2:17123379-17123401 TTTCTGCTCCAAAAGCAAAATGG - Intergenic
927224262 2:20747214-20747236 TTGCTGCTCTCCCAGAAAAATGG - Intronic
928712732 2:34025481-34025503 AGCCTTCTCTAAAAGAAAAAAGG + Intergenic
929299838 2:40290250-40290272 CTGCAGCTGAAAAAAAAAAAAGG + Intronic
929560798 2:42955221-42955243 CTCCATCTCAAAAAGAAAAAAGG - Intergenic
930539211 2:52683268-52683290 CTGCTGCTAAAAGAAAAAAAAGG + Intergenic
930764235 2:55068658-55068680 ATGGTGCTCTACAAAAAAAAAGG + Intronic
930863532 2:56099762-56099784 TTCCTGCTATGAAAGAAAAAAGG + Intergenic
930965758 2:57323612-57323634 TTTCTGCTCTAAAACACAAATGG - Intergenic
931202428 2:60111333-60111355 ATGCTGCTCTGAAACAAGAAAGG + Intergenic
932052776 2:68415722-68415744 CTGCTGGTGGAAAAGTAAAATGG + Intergenic
932177563 2:69616739-69616761 CTACTGGTCTAAATGGAAAAAGG + Intronic
934103446 2:88674986-88675008 CTCCAGCTCAAAAAAAAAAAAGG - Intergenic
934154944 2:89189660-89189682 CTGCTGGTGGAAATGAAAAATGG + Intergenic
934212370 2:89993064-89993086 CTGCTGGTGGAAATGAAAAATGG - Intergenic
936039617 2:109140385-109140407 CTCCGTCTCTAAAAAAAAAAAGG - Intronic
937290737 2:120780342-120780364 CTGCTTCTCTGCAAGAAAGAGGG - Intronic
938056071 2:128215646-128215668 CTGCTGGTGGAAATGAAAAATGG - Intergenic
938870743 2:135473750-135473772 CTGGGGGTCTAAAAGAAAGATGG - Intronic
939171662 2:138703105-138703127 CTGACGATATAAAAGAAAAATGG - Intronic
940088099 2:149884797-149884819 CTGCTTCAAAAAAAGAAAAAAGG - Intergenic
940230877 2:151450155-151450177 CTGGTGCTATTAAAAAAAAAAGG - Intronic
940337532 2:152544841-152544863 CAGCTGATCTAAAGGAAAATTGG - Intronic
940768678 2:157817673-157817695 AAACTGCTCTAAAAGAAATAAGG + Intronic
941237536 2:162994164-162994186 CTGATACTCCAAAAGAAATATGG + Intergenic
941677822 2:168362865-168362887 CTTTTGCCCTAAAAGAATAAAGG - Intergenic
941901983 2:170687578-170687600 CTGCTATTCTGAAAGTAAAATGG - Intergenic
942930222 2:181482782-181482804 CTGATGCTCTAAAAATTAAATGG + Intronic
943715419 2:191146750-191146772 CTGCCTCCCTAAAAAAAAAAAGG + Exonic
943955497 2:194183872-194183894 CTGCTGATAAAAAAAAAAAAAGG - Intergenic
944183380 2:196921559-196921581 CTACTGTACTAAAAGAATAATGG - Intronic
944207404 2:197171106-197171128 TTGCTTCTCTAAAAGCAAACAGG + Intronic
944400370 2:199319407-199319429 CTGCTGGGATAAAAGAAAAAGGG - Intronic
945426226 2:209707138-209707160 TTGTTGCTATAAAAGCAAAATGG + Intronic
945880649 2:215321576-215321598 CTGCTGCTGGAAATGTAAAATGG - Intronic
946350576 2:219148887-219148909 CTCCTTCTCAAAAAAAAAAAAGG - Intronic
946933632 2:224696757-224696779 TTCCTGTTCTAACAGAAAAAGGG + Intergenic
948181241 2:235982628-235982650 GTGCTGCTCGAAAAGAAACAGGG - Intronic
1169425345 20:5492580-5492602 GTGCTGCCCTTAAAGAGAAACGG - Intergenic
1170231825 20:14056449-14056471 CTTTTGCACAAAAAGAAAAATGG - Intronic
1170621031 20:17996196-17996218 ATGCTGTTCCAAAAAAAAAATGG - Intronic
1170814216 20:19698957-19698979 TTGCTGCTGTAGCAGAAAAACGG + Intronic
1171949029 20:31404583-31404605 GTGCTGGTCTAGAAGAAAACAGG + Intergenic
1171953310 20:31440539-31440561 CTGCTGACCTAAATGACAAAGGG + Exonic
1173083491 20:39892200-39892222 CTGCAGCTCTAGAAGAAGCATGG + Intergenic
1173933522 20:46841491-46841513 TTGCTGCATTAAAAAAAAAAGGG - Intergenic
1174196865 20:48778581-48778603 CTCCGTCTCTAAAAAAAAAAAGG + Intronic
1175173679 20:57096676-57096698 CTGCTTCTCCAACAGAAATAGGG + Intergenic
1175506692 20:59491035-59491057 CTTTTTCTCTAAAAGAAAATCGG - Intergenic
1175678595 20:60967844-60967866 CCACTGCTCTAAAGGAAACAAGG + Intergenic
1176383235 21:6124178-6124200 CTGCTGCTTTATGAGAACAAAGG + Intergenic
1176512359 21:7758533-7758555 CTGCGTCTCCAAAAAAAAAAAGG + Intronic
1177277680 21:18935312-18935334 CTGTTTCTCTAAAGGGAAAAGGG - Intergenic
1177791487 21:25726959-25726981 GTGCTAATCTAAAAGAAAATTGG - Intronic
1178396829 21:32250362-32250384 CAGCTGCTCAAAAGGGAAAATGG - Intergenic
1178646471 21:34389057-34389079 CTGCGTCTCCAAAAAAAAAAAGG + Exonic
1179074584 21:38107979-38108001 CTGCTGCTATGAATGTAAAATGG + Intronic
1179740232 21:43414061-43414083 CTGCTGCTTTATGAGAACAAAGG - Intergenic
1182395609 22:30033823-30033845 CTGCTGCTCCAAAAGTAAGGGGG - Intergenic
1183797951 22:40135925-40135947 CAGCTTCTCTAAAAGAAAAGAGG + Intronic
1183918123 22:41140169-41140191 CTGCTGCTTTAAAAGACAGACGG + Exonic
949426853 3:3926949-3926971 TTGCTGTTTTAAAAGGAAAAAGG - Intronic
949521415 3:4858021-4858043 ATGCTGTTCTAGAAGAAAACAGG - Intronic
949843301 3:8343546-8343568 CTGGTGTTCTGGAAGAAAAATGG + Intergenic
949977565 3:9474985-9475007 CTGGTGATTTAAATGAAAAATGG + Intronic
950298968 3:11857448-11857470 CTGCTGCTGGAAATGCAAAAAGG - Intergenic
951464059 3:22982921-22982943 CTGCTCCACTTAAAAAAAAATGG - Intergenic
951603164 3:24399350-24399372 CTGTTGGTTGAAAAGAAAAAAGG - Intronic
952324847 3:32311963-32311985 CTTCAGCTTTTAAAGAAAAAAGG + Intronic
954333769 3:49904354-49904376 CTCCTTCTCAAAAAAAAAAAAGG - Intronic
955510570 3:59676565-59676587 CTGATGAGCTAAAAAAAAAATGG + Intergenic
955605367 3:60696096-60696118 ATGCTGCTTTAAAAGAAGAAAGG + Intronic
955613109 3:60778731-60778753 GTCCTGCTGCAAAAGAAAAATGG - Intronic
955861359 3:63333747-63333769 CTGGTGCTATGAATGAAAAAGGG - Intronic
956657862 3:71569432-71569454 GTGCTGCCCTCAAAGAAAGAAGG + Intronic
956879021 3:73491592-73491614 CTGCTTCTTAAAAAAAAAAAAGG - Intronic
957645237 3:82913759-82913781 CTGCTGCTGAAAAAAAAAAATGG - Intergenic
958151213 3:89696962-89696984 CTGTTTCTCTAAAATAATAATGG + Intergenic
959071504 3:101706072-101706094 CTCCTTCTCAAAAAAAAAAAAGG - Intergenic
959770368 3:110088061-110088083 CTGCTGATTTCAAAGAAAAAGGG - Intergenic
960104279 3:113777260-113777282 GTGTTCCACTAAAAGAAAAAAGG + Intronic
961020185 3:123498717-123498739 CTGCTGCTCTAAAAGACAGCTGG + Intronic
962293975 3:134163603-134163625 ATGCTGCACTAAAAGAAAAAAGG - Intronic
962464181 3:135641398-135641420 CTGATGCTTTGAAAGAACAAAGG - Intergenic
962936417 3:140085236-140085258 TTGCTGCACTGAAAGAAAGATGG + Intronic
963326358 3:143867639-143867661 CTGCATCTCAAAAAAAAAAAAGG - Intergenic
964321354 3:155501310-155501332 CTGCTGCTAGAAATGAAAATGGG - Intronic
965084765 3:164080643-164080665 CTGCTGCTCCAAGAGAGAAATGG + Intergenic
965384688 3:168031870-168031892 CTGTTGGTTTAAAAGAAGAAAGG + Intronic
965530555 3:169766207-169766229 CAGATGCTATGAAAGAAAAAGGG - Intergenic
965823406 3:172707508-172707530 CCACTGCTCTATAAGATAAAAGG - Intronic
967189569 3:186973767-186973789 GTGCTGCACTGAAAGAAAACGGG + Intronic
967386797 3:188920024-188920046 CTGCAGCTCAAAAAAAAAAATGG - Intergenic
968233594 3:197018152-197018174 CTCCGTCTCAAAAAGAAAAAGGG - Intronic
968311115 3:197683700-197683722 CAGCTCCTCTAACAGCAAAATGG + Intronic
970018588 4:11540729-11540751 CTGATGAACTAAAAAAAAAAAGG + Intergenic
970219325 4:13794626-13794648 CTTCTGCTCCAAAGGAAAAGGGG - Intergenic
970244740 4:14048672-14048694 CAGCCGTTCAAAAAGAAAAAAGG - Intergenic
970420177 4:15898691-15898713 GTTCTGCTCTAAAAGATGAATGG + Intergenic
970781570 4:19744106-19744128 CTGCTGTTCAGAGAGAAAAATGG - Intergenic
970789906 4:19845077-19845099 CTTCTCCTCTATAAGAAGAAGGG + Intergenic
970948616 4:21725878-21725900 CTTCTGCCCTAAAAGAGAGATGG + Intronic
972172271 4:36361277-36361299 TTCCTGTACTAAAAGAAAAATGG - Intergenic
972608433 4:40635036-40635058 CTGCGTCTCAAAAAAAAAAAAGG - Intergenic
973342398 4:49018590-49018612 CCACTGTTCTAAAAGAGAAAAGG - Intronic
974665501 4:64956168-64956190 GTCCTGCTGCAAAAGAAAAATGG - Intergenic
975355717 4:73401099-73401121 CTTCTTCTCTTAAAGATAAAGGG - Intronic
975837831 4:78442896-78442918 CTGCTGCTCTACAATAATATTGG + Intronic
975853166 4:78594483-78594505 CTGCTGATATGAAAGCAAAATGG - Intronic
976182804 4:82415109-82415131 CACCTGCCCTAAAAAAAAAAGGG - Intergenic
977966773 4:103160143-103160165 CTACTTGTCTAAAAGAAAAATGG - Intronic
978074894 4:104516210-104516232 AAGATGCTCTAAAAGACAAATGG - Intergenic
979286171 4:118927100-118927122 GTGTTGCTTGAAAAGAAAAAAGG - Intronic
979868789 4:125790363-125790385 CTGCTGCCCCAGAAGATAAAGGG + Intergenic
980181994 4:129412691-129412713 CTGCTGAACTAAAAGAAGAAGGG - Intergenic
980301398 4:130999227-130999249 GTGCTGTTGCAAAAGAAAAATGG - Intergenic
981046133 4:140267033-140267055 CTTCTGCTGGAAAAGAGAAAAGG + Intronic
981255685 4:142658635-142658657 ATCCTGCTGCAAAAGAAAAATGG - Intronic
981522721 4:145680392-145680414 GTCCTGCTCTAAAAGAAAATTGG - Exonic
981572325 4:146165825-146165847 CAGCTGTTTTCAAAGAAAAAGGG - Intergenic
981716704 4:147759258-147759280 CTGTTTCTCTAAGAGTAAAATGG - Intronic
981768012 4:148274225-148274247 ATGGTGTTCAAAAAGAAAAATGG + Intronic
982157040 4:152534247-152534269 TTGTTACTCTAAAAAAAAAAAGG + Intronic
982520579 4:156411748-156411770 CTGCTGCTCAGGAAAAAAAAAGG - Intergenic
983293668 4:165838349-165838371 TTGCTGTTAAAAAAGAAAAATGG - Intergenic
983512384 4:168622519-168622541 CTTCTGGGCTGAAAGAAAAAAGG - Intronic
984426000 4:179586416-179586438 GTGTTGCTCTAAAGGAATAATGG + Intergenic
984988494 4:185354354-185354376 CTACTGCTCAAGAGGAAAAAAGG - Intronic
984994480 4:185415715-185415737 CTGTTGCTCCAGAAGAAACATGG - Exonic
985426894 4:189839985-189840007 CTGCTTCCCTGAAAGAAATACGG + Intergenic
986847486 5:11772638-11772660 CTGCTCCTCTGAAATTAAAAGGG - Intronic
986999942 5:13650400-13650422 CTGATGGTTTAAAAAAAAAATGG + Intergenic
987235915 5:15941489-15941511 ATGATGCTCTCAAAGAAAAAAGG - Intergenic
988166166 5:27592100-27592122 ATGATGCTATAAAAGAAATACGG - Intergenic
988413210 5:30913039-30913061 CTGCTGCATTAAAAAAAAATGGG + Intergenic
988727512 5:33938973-33938995 CTGCTGCCCCAAAAGGTAAAAGG + Intergenic
989256284 5:39369069-39369091 TTGCTGCTCTAAAAGTTACAGGG - Intronic
990662797 5:58037122-58037144 GTGCTGCTCTAGAAGAAAATAGG + Intergenic
992131991 5:73702637-73702659 CTGCTGCTGAAAATGTAAAATGG - Intronic
992739695 5:79760946-79760968 CTGTTTCTTTAAAAGAAAATCGG - Intronic
992743466 5:79796223-79796245 CTTCTGCAATAATAGAAAAATGG + Intronic
993153470 5:84191056-84191078 CTGCTAGTGTAAATGAAAAAGGG - Intronic
993857004 5:93088664-93088686 CAGCTGCAACAAAAGAAAAAAGG - Intergenic
994022869 5:95048225-95048247 CTGCTACCATAAAATAAAAATGG + Intronic
994443555 5:99842281-99842303 CTGAGCCTCTAAAAGAAAAATGG - Intergenic
995437976 5:112159274-112159296 CTACTTCTATAAAAGAAAGAAGG - Intronic
995585516 5:113644093-113644115 TTGGTACTCTAAAACAAAAATGG + Intergenic
995589094 5:113679973-113679995 CGGCTACTCAAAAAGAAAATTGG + Intergenic
996057309 5:118995555-118995577 CTGCTGCTCAAACAAAACAAGGG - Intergenic
998761547 5:145437810-145437832 ATGCTGCTATTAAAGAAATATGG + Intergenic
998833495 5:146183078-146183100 CTGCGTCTCAAAAAAAAAAAAGG - Intergenic
999645640 5:153714466-153714488 TGGCTGCACTAAAAGAAAGATGG + Intronic
999666521 5:153918235-153918257 TAGCTGCTTTAAAAAAAAAAAGG + Intergenic
1000228672 5:159294659-159294681 CTCCTTCTCAAAAAAAAAAATGG + Intergenic
1001911638 5:175523632-175523654 TTGCAGCACTCAAAGAAAAAAGG - Intronic
1003038426 6:2665228-2665250 CTGCTGCTCTAATGGGGAAAGGG - Exonic
1003971589 6:11305208-11305230 CTCATGCTCAAAATGAAAAAAGG - Intronic
1004202188 6:13559122-13559144 ATGCTGTTCTCAGAGAAAAAGGG - Intergenic
1004474295 6:15956846-15956868 CTGCCTCTCTAAAATAATAATGG - Intergenic
1005268756 6:24140904-24140926 CTGCTGCTGGAAAGGAAAATTGG - Intronic
1005941302 6:30562205-30562227 CTTCTGCTTCAAAAGCAAAAAGG - Intronic
1006061350 6:31422257-31422279 ATGCTGTTCTAAAAGAAAAAAGG + Intergenic
1007334222 6:41140147-41140169 CTGCACCTCTGAAATAAAAAGGG + Intergenic
1008256883 6:49313094-49313116 CTCCAGCTCAAAAAGAAAAAAGG - Intergenic
1008433755 6:51451108-51451130 CCACTGTTCTATAAGAAAAAGGG - Intergenic
1008747293 6:54687582-54687604 CCCCATCTCTAAAAGAAAAAAGG + Intergenic
1009249292 6:61277646-61277668 CAGTTGCTATAAAAGAAACAGGG + Intergenic
1009485304 6:64214496-64214518 CTACTGCTATAAAAGAAAGATGG - Intronic
1009795397 6:68459799-68459821 CTGCATCACTAAAAGTAAAATGG + Intergenic
1009957919 6:70478654-70478676 CTGGTGCTCTAAAAGGAACTAGG - Intronic
1010670680 6:78682642-78682664 GTTCTGCTGCAAAAGAAAAATGG + Intergenic
1010686947 6:78864355-78864377 CTATTTCTCTAATAGAAAAATGG + Intergenic
1011749637 6:90442098-90442120 CTCCTTATTTAAAAGAAAAAAGG - Intergenic
1011887174 6:92110396-92110418 CTGGAGCTTTTAAAGAAAAAAGG + Intergenic
1012609657 6:101200544-101200566 CTGCTGGTCTATTAGATAAATGG + Intergenic
1012896062 6:104950897-104950919 CTGCTGAACTAAATTAAAAATGG + Intergenic
1013011419 6:106124192-106124214 ATACAGCTTTAAAAGAAAAAAGG + Intergenic
1013915417 6:115331968-115331990 TTTCTGCTCTAAAAGCAAGATGG - Intergenic
1015361637 6:132346420-132346442 CTGCTGCTAGAAAAAAAAGATGG - Intronic
1015681254 6:135811315-135811337 CTGCTGCTCTAAAAACAGAAGGG - Intergenic
1016525557 6:144998149-144998171 CTTCTGAGCTTAAAGAAAAAAGG + Intergenic
1016549785 6:145266356-145266378 CTTGTTCCCTAAAAGAAAAATGG - Intergenic
1017523644 6:155223891-155223913 TTACTTCTTTAAAAGAAAAAGGG - Intronic
1017585333 6:155914907-155914929 GTGCTGCTCTACAAGGAATATGG + Intergenic
1017829253 6:158110468-158110490 CTGTTACTCTAAAGAAAAAAAGG + Exonic
1017934307 6:158991352-158991374 CTTGTGCACTAAAACAAAAAGGG - Intronic
1019847450 7:3520253-3520275 CAGCAGCTCTAAAAGAAAGCAGG - Intronic
1020404787 7:7819649-7819671 GTTTTGCTCTGAAAGAAAAATGG + Intronic
1020409944 7:7880835-7880857 TTTCTTCTCTTAAAGAAAAATGG + Intronic
1021331829 7:19347465-19347487 CTGCTCCACTACAAGTAAAAAGG - Intergenic
1021341344 7:19466322-19466344 CTGTGGCACAAAAAGAAAAATGG + Intergenic
1021615110 7:22495361-22495383 CTCTTACTCCAAAAGAAAAATGG - Intronic
1021855539 7:24851214-24851236 CTGCTTCTCTCAAACCAAAATGG + Intronic
1022081185 7:27023615-27023637 CTGTTGCTTTAAAAACAAAAGGG + Intergenic
1022734537 7:33063300-33063322 CTTCTGCTCACACAGAAAAAAGG - Intergenic
1022821389 7:33964735-33964757 TTCCTCCTCTAAAACAAAAAAGG + Intronic
1023248136 7:38229234-38229256 CTGCTGCTTCAAATGTAAAATGG - Intronic
1023430760 7:40088579-40088601 CTCCTGCACTAAGAGTAAAAAGG - Intronic
1023590072 7:41772170-41772192 CTGATGCTGTTAAAGAAAAAAGG + Intergenic
1023719013 7:43073702-43073724 CTGCAGCTCAGAAAGAACAAAGG - Intergenic
1024011390 7:45270002-45270024 TGGCTGCTCCAAAGGAAAAAAGG + Intergenic
1024374575 7:48622354-48622376 CTTCTGCTCCAAGAGGAAAATGG - Intronic
1026547971 7:71340547-71340569 GTCCTGCTCTAAAATAAGAAAGG + Intronic
1027888005 7:83934383-83934405 CTTCAGCTTTAAAAAAAAAAAGG - Intergenic
1028377385 7:90159261-90159283 CTCTTACTCCAAAAGAAAAATGG + Intronic
1028433755 7:90778032-90778054 CTTCTGCTTTAACAGAAAACTGG + Intronic
1029107137 7:98187207-98187229 CTGCTTTTCTAAAGGAAAATGGG - Intronic
1030197578 7:106867850-106867872 CTCCTGCTCTATCAGAAGAAGGG + Exonic
1031109520 7:117590338-117590360 ATACTGCTCTAAAAAGAAAATGG - Exonic
1031540584 7:122990527-122990549 CTGCAGCAATAAAAGAATAATGG - Intergenic
1031845619 7:126802710-126802732 CTGCAGCTCTTAAGGAAAATAGG - Intronic
1031937916 7:127754799-127754821 CTGGTGCTCCAAAAGAATATGGG - Intronic
1032459717 7:132101695-132101717 CTGCTGCAAGAAAAGGAAAATGG - Intergenic
1032637706 7:133728079-133728101 CTGCTGATCAACAAGAAAAGTGG - Intronic
1033483540 7:141765095-141765117 CTGTTACTCTAAGAGAAAATGGG - Exonic
1033683438 7:143618998-143619020 GTGTTGCTCTAATAGAAGAAAGG - Intergenic
1033701175 7:143838640-143838662 GTGTTGCTCTAATAGAAGAAAGG + Intergenic
1033904630 7:146187268-146187290 CTTCTGCTCTAACAGAAGATGGG + Intronic
1034637199 7:152576821-152576843 CTCCTGCCCTTAAGGAAAAAGGG + Intergenic
1035770338 8:2142360-2142382 CAGCAGCTCTAAAAGTTAAAGGG - Exonic
1035771651 8:2152336-2152358 GTGAAGCTCTAAAAGAAAACAGG - Intronic
1036508635 8:9379864-9379886 CTGCAGCTTTAGAAGAACAAAGG - Intergenic
1038374484 8:27024861-27024883 GTGCTGCTCTTTAAGAAATACGG - Intergenic
1039062400 8:33582010-33582032 CTCCACCTCAAAAAGAAAAAAGG - Intergenic
1039344759 8:36691575-36691597 TGGCAGCTCTAAAAGAGAAAAGG - Intergenic
1039677299 8:39683520-39683542 CTGCTGGTGGAAATGAAAAATGG - Intronic
1040839187 8:51766351-51766373 CTTCTGATTTAAAAGAAAACTGG - Intronic
1040993530 8:53377982-53378004 CTGCTTTGCTAACAGAAAAAAGG - Intergenic
1041098240 8:54371334-54371356 TTATTGCTCCAAAAGAAAAATGG + Intergenic
1042152897 8:65808202-65808224 CTGGATCTCTGAAAGAAAAATGG - Intronic
1043589844 8:81817285-81817307 CTACTGCTAGGAAAGAAAAAGGG + Intronic
1044043253 8:87397183-87397205 TTGCAGCTCTGAAAGAAATAGGG - Intronic
1044704083 8:94991806-94991828 GTGCTGCTTTAAAAAAAAAAAGG - Intronic
1044899612 8:96930214-96930236 CTGCTGGACGAAAAGAAACATGG - Intronic
1045043434 8:98249959-98249981 CTGCTTCTGGAAAGGAAAAATGG + Intronic
1046191139 8:110794973-110794995 CTCCTTCTCAAAAAAAAAAAAGG + Intergenic
1046540794 8:115580033-115580055 TTGCTTCTCCAAAAGGAAAAAGG + Intronic
1047042856 8:121017251-121017273 CTGGTGATTTAATAGAAAAATGG + Intergenic
1047287479 8:123500459-123500481 CTGCTGGTCTAAAAGCTAGAAGG - Exonic
1048358015 8:133669418-133669440 CTGCTCCTCTTAAAAAAAAATGG + Intergenic
1050749311 9:8918458-8918480 CTGATGTTCTAAAAGTGAAAGGG - Intronic
1051237707 9:15019282-15019304 TTGTTGCTCTAAAAGACTAAAGG - Intergenic
1051728312 9:20111562-20111584 CTGCTGCTCCATGAGAAGAAAGG - Intergenic
1052627667 9:30998633-30998655 CTGTTGCTGGGAAAGAAAAATGG + Intergenic
1052728271 9:32256535-32256557 TTTCTGCTGGAAAAGAAAAAAGG + Intergenic
1053007895 9:34616106-34616128 CTGCTCCTCTAAAGCAAAAATGG + Exonic
1053546091 9:39024629-39024651 CTGCTCCTGGAAAAAAAAAAAGG + Intergenic
1054877693 9:70113625-70113647 CTGCTTCTCTGCAAGGAAAATGG + Intronic
1054976383 9:71150876-71150898 CTGTTGCACTAAAAGATCAATGG + Intronic
1055045550 9:71920488-71920510 GTGTTTCTCTAAAAGGAAAATGG - Intronic
1056058126 9:82850668-82850690 TGGGTGCTCTAAAAGAGAAAAGG + Intergenic
1056525263 9:87437557-87437579 CTGATGCTCTAAAAATAACAGGG - Intergenic
1057432440 9:95005876-95005898 CTGCTGATCTAAAATAATAATGG - Intronic
1059064158 9:111065054-111065076 CTGTTTCTCTCAAAGAATAAGGG - Intergenic
1059256504 9:112935865-112935887 CAGCAGCTCTAAAAGACAAAAGG + Intergenic
1061126417 9:128679318-128679340 CAGCAGCTCAAAAAGAAGAAAGG + Intergenic
1061532400 9:131225088-131225110 CCCCATCTCTAAAAGAAAAAAGG + Intronic
1187638390 X:21259700-21259722 CTGCTGCTCCAGAAGAAAGATGG + Intergenic
1187937112 X:24346907-24346929 CAGCTGCTCCAAGAGAGAAACGG + Intergenic
1188233513 X:27696876-27696898 CTGCTGCTTTAAAGGACACACGG - Intronic
1188530570 X:31135996-31136018 CTGCTGTTAAAAAAAAAAAAAGG - Intronic
1190258113 X:48779814-48779836 CCGCTGCTTTAGAAGAAAACAGG + Intergenic
1190261470 X:48800417-48800439 CTTCTGATCCAACAGAAAAATGG + Intergenic
1191638066 X:63399790-63399812 CAGCTGCTCCAAGAGAACAATGG + Intergenic
1191786332 X:64920622-64920644 CTGAGGCTCAAAGAGAAAAAGGG + Intronic
1191971647 X:66823656-66823678 GTGCTGATCTAAAAGAAAGAAGG + Intergenic
1192135842 X:68599478-68599500 CTGCTGCTCTAAAGGACCCATGG + Intergenic
1192536664 X:71934290-71934312 CCACTGCTCTACAAGGAAAAGGG - Intergenic
1192545962 X:72014393-72014415 CTTATACTATAAAAGAAAAAAGG - Intergenic
1194212620 X:91087306-91087328 CTGCTGGTCTGAAAGACATAAGG - Intergenic
1194763115 X:97817280-97817302 CTGCAGCTCTAAATGAAGACAGG - Intergenic
1195109700 X:101635036-101635058 CTGTTGCACTAAAGGTAAAAGGG - Intergenic
1195371343 X:104177564-104177586 CTGCTGGTGGAAAAGTAAAATGG - Intronic
1195579569 X:106485714-106485736 CTGCTGATCTGAAAGATTAAGGG + Intergenic
1195806000 X:108766184-108766206 CAGCTGCTGTAAAAAAAAATTGG - Intergenic
1196199301 X:112867429-112867451 CTGGTGATAGAAAAGAAAAAGGG - Intergenic
1196646383 X:118122264-118122286 CTGCTACTGTGAATGAAAAATGG + Intergenic
1197099784 X:122638483-122638505 CTACTGTTGTAAATGAAAAATGG + Intergenic
1197729374 X:129796900-129796922 CTCCTTTTCTAAAATAAAAATGG - Intergenic
1199169651 X:144721178-144721200 CTGCAGCTCAGAAGGAAAAAAGG + Intergenic
1199706628 X:150431749-150431771 ATGCAGCTGTAAAAAAAAAAAGG - Intronic
1200056053 X:153461779-153461801 CTGCTGCTGGAAAAGGAAGATGG + Intronic
1201635833 Y:16122072-16122094 ATCGTGCTCTAAAAGAAATATGG + Intergenic
1201696213 Y:16829275-16829297 CTCCTCCTCCAAAAGAACAATGG - Intergenic