ID: 919971345

View in Genome Browser
Species Human (GRCh38)
Location 1:202581463-202581485
Sequence CTTTGAAGGGGGAAGATAAG TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 363
Summary {0: 1, 1: 0, 2: 1, 3: 39, 4: 322}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
919971345_919971350 2 Left 919971345 1:202581463-202581485 CCACTTATCTTCCCCCTTCAAAG 0: 1
1: 0
2: 1
3: 39
4: 322
Right 919971350 1:202581488-202581510 ATTTTCTTTATAAGAAAATTTGG 0: 1
1: 1
2: 7
3: 181
4: 1615
919971345_919971351 3 Left 919971345 1:202581463-202581485 CCACTTATCTTCCCCCTTCAAAG 0: 1
1: 0
2: 1
3: 39
4: 322
Right 919971351 1:202581489-202581511 TTTTCTTTATAAGAAAATTTGGG 0: 1
1: 0
2: 16
3: 204
4: 1670

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
919971345 Original CRISPR CTTTGAAGGGGGAAGATAAG TGG (reversed) Exonic
900569192 1:3350019-3350041 CTTTGAGGGGGGAAGAGGACAGG + Intronic
900811525 1:4805267-4805289 CTAAGGAGGGGGAAGAGAAGAGG - Intergenic
901253106 1:7796667-7796689 CTTTGGAGGGGGAAGAAGGGAGG + Intronic
902278600 1:15358029-15358051 CCTTGAAGGTGGGGGATAAGGGG + Intronic
903864197 1:26386309-26386331 TTTGGAAGGTGGAAGAAAAGAGG + Intergenic
903904312 1:26672985-26673007 CTTTGAAGGGAGAAGGTGGGAGG - Intergenic
904492433 1:30869373-30869395 CTTTGATGGGGGAAGATGGCTGG + Intergenic
906636073 1:47411572-47411594 CTTTTATGGGGGAAGTTCAGGGG + Intergenic
906712161 1:47938855-47938877 CTTGGCAGGAGGAGGATAAGAGG + Intronic
908257596 1:62315852-62315874 CTCTGCAGGGGGAAGGGAAGAGG - Intronic
908293735 1:62692594-62692616 TTTTGCAGGGGGAAATTAAGGGG + Intergenic
908808205 1:67952370-67952392 CTTTGAAGCTGGAAGACAAAAGG - Intergenic
909018336 1:70403968-70403990 GTTTGTAGGGGGAACAAAAGAGG - Intergenic
909174829 1:72344067-72344089 TTTTGAAGGAGAAAGATCAGGGG - Intergenic
909552897 1:76919088-76919110 ATTTGAAGGGGTAAAATCAGAGG - Intronic
910719439 1:90269782-90269804 CTTTGTGTGGGGAAGAAAAGAGG + Intergenic
911503720 1:98722416-98722438 AATTGCAGGGGAAAGATAAGAGG - Intronic
913692288 1:121290578-121290600 CTTTGAGAGGGTAAGATAGGAGG + Intronic
913976996 1:143467767-143467789 TTTTGAAGAGTGAATATAAGCGG - Intergenic
914071400 1:144293394-144293416 TTTTGAAGAGTGAATATAAGTGG - Intergenic
914107755 1:144672962-144672984 TTTTGAAGAGTGAATATAAGCGG + Intergenic
914145267 1:144989536-144989558 CTTTGAGAGGGTAAGATAGGAGG - Intronic
914887520 1:151597593-151597615 CCTTCAAGGGGAAAGGTAAGTGG + Intergenic
915536400 1:156538696-156538718 CTTTGAAGGTGGCATATAAATGG - Intronic
915746733 1:158166705-158166727 GTTTGTAGGGGGAGGATATGTGG - Intergenic
916679979 1:167094968-167094990 CTGTGAGGGTGGGAGATAAGTGG - Intronic
917691578 1:177475236-177475258 CTTTGAGTGGGGAAAATAGGTGG + Intergenic
918332845 1:183475737-183475759 CTTTTAATGGGGAAGATCAGTGG + Intronic
919971345 1:202581463-202581485 CTTTGAAGGGGGAAGATAAGTGG - Exonic
920479612 1:206308927-206308949 CTTTGAGAGGGTAAGATAGGAGG + Intronic
920596924 1:207281204-207281226 CTGTGGAGGGGGAAGATCATTGG + Intergenic
920703953 1:208238296-208238318 CTTTGAGGGTGAAAGATAAAAGG - Intronic
921363257 1:214350149-214350171 CTAGGAAGGGGAAAGATTAGCGG - Exonic
921986229 1:221315899-221315921 CTTTGAACGGGGTAGAAATGTGG - Intergenic
922321482 1:224491996-224492018 CTTTGAGAGGCCAAGATAAGAGG - Intronic
922865038 1:228852447-228852469 CTTTGAAGGGTGAGAAAAAGTGG - Intergenic
923765852 1:236891724-236891746 CCTTGAAAGGGGAAGACAGGTGG + Intronic
1063827725 10:9917166-9917188 CTATGAATGAGGAAGAGAAGAGG + Intergenic
1064334180 10:14423452-14423474 CTTTGAAGGGTGAGAATAAATGG - Intronic
1064506235 10:16033586-16033608 CTTTGGCTGGAGAAGATAAGAGG - Intergenic
1065221962 10:23505301-23505323 TTTTGAAAGGGGAACTTAAGCGG + Intergenic
1065421455 10:25549259-25549281 CTTAGGAGGGGGAAGACAAATGG - Intronic
1066553291 10:36583216-36583238 CTGTGAAGAGGGAAGAAAATTGG - Intergenic
1067741375 10:48898205-48898227 CTGTGAAGTGGGATGAGAAGTGG - Intronic
1069120955 10:64568196-64568218 CTTTGGAAGGTCAAGATAAGAGG - Intergenic
1070584021 10:77747602-77747624 CTTTCAAAGGAGAAGATAAATGG - Intergenic
1070642151 10:78177863-78177885 CTTTGAGAGGGGAAGACAACTGG + Intergenic
1070682820 10:78461134-78461156 CTTTGTAGCGGGTGGATAAGAGG + Intergenic
1071353141 10:84766972-84766994 ATGTGAAGGCGGAAGATACGTGG + Intergenic
1071679099 10:87686446-87686468 CCTTGGAGGGGGAAGAGAAGGGG - Intronic
1071906731 10:90182438-90182460 CTTTGATAGGGGAAGAGAAAAGG + Intergenic
1071959089 10:90791557-90791579 CATTGAAGGGGGAAGAGGAGCGG + Intronic
1072144643 10:92624038-92624060 CTTTGAGGGTGGAGGGTAAGAGG - Intronic
1072343591 10:94480277-94480299 CTTTGAATGAGGAAGATGATGGG - Intronic
1078387161 11:10902763-10902785 CTATAAAGGGGGAAGCTGAGTGG + Intergenic
1079494728 11:21029164-21029186 CATTAAAGGGGGAAGAGAAAGGG + Intronic
1079777712 11:24554867-24554889 CTTTGCAAGTGGAAGATTAGGGG + Intronic
1080374233 11:31688862-31688884 ATTTGAGGGGGGAAAATCAGGGG + Intronic
1080635110 11:34117044-34117066 CTTTTAAGAGGGAACATATGAGG + Intronic
1080661513 11:34300037-34300059 CTTGGTGGGGGGAAGATGAGGGG + Intronic
1083020096 11:59497802-59497824 TTTTGAAGCCAGAAGATAAGGGG + Intergenic
1083061879 11:59881560-59881582 CTTTGGTGGAGGAAGAAAAGTGG + Intergenic
1085828971 11:79879273-79879295 CTATGATGGGGGAAGCTTAGAGG + Intergenic
1086091305 11:83007823-83007845 CTTGGAAGGGGGTCGATGAGTGG - Intronic
1086190104 11:84069093-84069115 CTCTGGAGGGGGAAGCTCAGTGG - Intronic
1088488626 11:110365689-110365711 CTTTGAGAGGGCAAGATAGGTGG - Intergenic
1089012623 11:115143307-115143329 CCTTGAAGGGGAAAGATTAGGGG - Intergenic
1089184617 11:116606380-116606402 CTTTGAGGGTGGGAGATGAGTGG - Intergenic
1089314644 11:117583259-117583281 CTTGGAAGGGGGAACACCAGAGG - Intronic
1089634522 11:119803800-119803822 CTTTGAAGGAGGAAGGTGACAGG - Intergenic
1090045694 11:123330859-123330881 CTTTGAACCTGGAAGTTAAGAGG - Intergenic
1090885278 11:130870608-130870630 GCTTGAAGGGTGAAGATATGTGG - Intergenic
1091452048 12:578559-578581 CTTTGAGGGTGCAAGATGAGAGG - Intronic
1092570480 12:9715995-9716017 CTTTGAAGGCAGAAGATACAAGG - Intronic
1093107669 12:15109046-15109068 TTTTGAAAGGGGAACAGAAGGGG + Exonic
1093245098 12:16726616-16726638 CTATGAAGGAGGCAGATATGGGG + Intergenic
1093288926 12:17299262-17299284 CCCTGAAGGGGCAAAATAAGGGG + Intergenic
1093549445 12:20390166-20390188 ATTTTAAGAGGTAAGATAAGGGG + Intronic
1093650006 12:21632323-21632345 CATTGAAGGGGAAATAGAAGTGG - Intergenic
1095162495 12:38934274-38934296 AGCTGGAGGGGGAAGATAAGGGG + Intergenic
1099098929 12:78412188-78412210 CTTTGAGGGTGGAAGGTGAGAGG + Intergenic
1099349759 12:81550781-81550803 CATTTAAGGGGGAAGACCAGTGG + Intronic
1099569817 12:84302996-84303018 ATTTGAAGGGGGAAAATAGAGGG - Intergenic
1102647589 12:114413943-114413965 CTTTGAGGGAGGAAGATGGGTGG + Intergenic
1103947109 12:124532776-124532798 CTTTGAAGTTGGAAGGAAAGCGG - Intronic
1105222231 13:18342049-18342071 TTTTGAAGAGTGAATATAAGTGG + Intergenic
1105654404 13:22420360-22420382 TTTTGAGGAGGGAAGATAATTGG + Intergenic
1106095967 13:26644129-26644151 CTTTGAAGATGGAAGAAGAGGGG + Intronic
1106225552 13:27783712-27783734 CTTTCAAGGTGGAAGAGAAAAGG + Intergenic
1106730693 13:32538685-32538707 CTGTGAAGGTGAAAGAAAAGCGG + Intronic
1107188798 13:37555109-37555131 CTTGGAAGGGTGAAGATTGGGGG + Intergenic
1107813136 13:44219190-44219212 GTTTGAAGGGGGCAGTTGAGAGG + Intergenic
1109283116 13:60379961-60379983 CTTTCCAGAGGGAAGAAAAGAGG - Intergenic
1109981407 13:69913185-69913207 GTTTGAAGGGGGAGCATAGGGGG - Intronic
1110209621 13:72956313-72956335 CTTTGAAGGGGGTACTAAAGAGG - Intronic
1111767594 13:92552468-92552490 CTTTGTAAGGGGAAGATAAATGG + Intronic
1111826037 13:93268964-93268986 CTTTAAAAGGGGAAGAAAAGAGG - Intronic
1112535665 13:100252745-100252767 GTTTGGATGTGGAAGATAAGGGG - Intronic
1112818421 13:103301073-103301095 CTTCAAAGGGGGAAAAAAAGTGG + Intergenic
1114135950 14:19851062-19851084 TTTTGAATGGGTAAGATATGAGG - Intergenic
1114322347 14:21557622-21557644 ATTTGGAGGGGGAGGGTAAGAGG - Intergenic
1114627627 14:24139615-24139637 CTGTGTAGAGGGAAGATCAGAGG + Intronic
1115195050 14:30788629-30788651 CTCAGAAGGGGGAGGATGAGAGG + Intergenic
1116175630 14:41466541-41466563 CTTTGAAATGGGAAGATAGTAGG - Intergenic
1116406930 14:44578303-44578325 CCTTGCAGGGGGATGATCAGTGG - Intergenic
1117603172 14:57396637-57396659 TTTCGACGGGGGAAGATAATGGG - Intronic
1118519169 14:66561939-66561961 CTTTGAAGAAGGAAGAAAAGAGG - Intronic
1120319809 14:82945124-82945146 CTGAGAAGGAGGAAGAGAAGGGG + Intergenic
1120400398 14:84023448-84023470 TTTTGAAGATGGAAGATAGGAGG - Intergenic
1121680590 14:95789836-95789858 CCTGGAAGGGGGAAGATTCGAGG - Intergenic
1121693721 14:95895790-95895812 ATCTGAAGGAGGAAGAGAAGCGG - Intergenic
1125290771 15:38143933-38143955 CTTGGAATGGGGAGGATACGGGG - Intergenic
1125482754 15:40091808-40091830 CTTTGAATGGAGAAGAGAACAGG - Exonic
1127384946 15:58459842-58459864 CTGTGAAGGAGGAAGCTGAGAGG - Intronic
1128284583 15:66425823-66425845 CTTGCAGGGGGGAAGAAAAGGGG + Intronic
1128661523 15:69504671-69504693 ATTTGAGGGGGGAAGAAAAGAGG + Intergenic
1130536454 15:84788739-84788761 CTTGGGAGGAGGAAGATAAATGG - Intronic
1130542191 15:84828326-84828348 CCTTGGAAGGGGAAGATAATGGG + Intronic
1130940241 15:88502071-88502093 CTTGGAAGGGGCAGGATTAGAGG - Intergenic
1131548811 15:93338721-93338743 CTGTGAAGGATGGAGATAAGTGG + Intergenic
1131967764 15:97862633-97862655 TTGTGAAGGGGGCAGGTAAGAGG - Intergenic
1132672352 16:1107018-1107040 CTTTGAAGGGCGGTGAGAAGAGG - Intergenic
1133889754 16:9867961-9867983 TTTTTACGGTGGAAGATAAGAGG - Intronic
1134651768 16:15914977-15914999 CTCAGAAGGGGGAGGATGAGAGG + Intergenic
1137377902 16:47969799-47969821 CTCTGAGGTGGGAATATAAGAGG - Intergenic
1137711543 16:50570431-50570453 GTATGAAGAGGGAAGATAATGGG + Intronic
1137817383 16:51411407-51411429 CTTTGTAGGTGGAAGAGAACTGG + Intergenic
1140026130 16:71291956-71291978 CTTTTAAGGGTGAAGTTACGTGG + Intergenic
1140434864 16:74938486-74938508 CATTGAAGTGGGAAGAAACGAGG - Intronic
1141198373 16:81878534-81878556 CTTTAAAGGGGGCAGATAAATGG - Intronic
1142856318 17:2732310-2732332 ATGAGAAGGGAGAAGATAAGGGG - Intergenic
1143769235 17:9157497-9157519 TTTTGATGGGGGAAGAAAATAGG + Intronic
1144403770 17:14932867-14932889 CTTTGAAGAGAGAAAATGAGAGG + Intergenic
1144420047 17:15088190-15088212 GCTTGAAGGGCGAAGATAAGAGG - Intergenic
1145192358 17:20854043-20854065 CTTTGAATGGGGAAGAGACTGGG + Intronic
1145402875 17:22557091-22557113 CTTTGAATGGGGAAGAGACTGGG + Intergenic
1146083446 17:29804864-29804886 TTTTGAAGGGGGAAGAGATGAGG + Intronic
1146140482 17:30363603-30363625 CTTTGAGAGGTGAAGGTAAGAGG + Intergenic
1146698223 17:34928714-34928736 ATTTGAGGGGGAAAGAAAAGGGG - Intronic
1148286054 17:46392903-46392925 TTTTGAAAGGGGAAGAAAAAGGG - Intergenic
1148308221 17:46610493-46610515 TTTTGAAAGGGGAAGAAAAAGGG - Intronic
1148517296 17:48232054-48232076 GTTTGTAGGGTGAAGAAAAGGGG - Intronic
1149817592 17:59741294-59741316 GATTGAAGGTGGAAGAGAAGAGG + Intronic
1152297491 17:79476594-79476616 CCTTGAAGGGGAAAGGAAAGAGG + Intronic
1153728793 18:7986059-7986081 CTTTGAAGTTTGAAGATAAAAGG + Intronic
1156286123 18:35697925-35697947 ATTTCAAGGGGAAAGATCAGTGG - Intronic
1157014164 18:43689906-43689928 CATTAAAGGTGGAAGAAAAGGGG + Intergenic
1158338054 18:56434884-56434906 CTCAGAAGGGGGAGGATAGGAGG - Intergenic
1158408898 18:57186955-57186977 CTTTGCAGGGAAAAGCTAAGTGG - Intergenic
1159139239 18:64372437-64372459 CTTTAAAGTGGGAATATAAGAGG - Intergenic
1160928816 19:1560133-1560155 CTGTGAAAGGGGAAGGTAACAGG + Intronic
1161066141 19:2238795-2238817 ATTTGGAGGAGGAGGATAAGGGG - Intronic
1165863913 19:38924375-38924397 CTGTGAAGTGGGATGATAACAGG + Intronic
1165983443 19:39746594-39746616 CTTTCATGGGGGATGATCAGTGG - Intergenic
1165983916 19:39750971-39750993 CTTTGCAGGGGTATGATCAGTGG - Intergenic
1167643869 19:50695474-50695496 CTTGGAGGGGGGAGGAGAAGGGG + Intronic
925234133 2:2263250-2263272 CTTTGAAAATGGAAGAGAAGGGG + Intronic
925899002 2:8495186-8495208 CTTGGAAGGAGGAAGACAGGAGG + Intergenic
927006577 2:18856432-18856454 ACTTGACGGGGGAGGATAAGAGG - Intergenic
928161172 2:28926431-28926453 TTTTTAAAGGGGAAGATGAGAGG - Intronic
929945408 2:46367821-46367843 TTTTGAAGTGGGCAGAGAAGAGG - Intronic
931947115 2:67322563-67322585 CTTTGAAAATGAAAGATAAGAGG - Intergenic
932094177 2:68832242-68832264 CTTACAAGGGGGAAGGGAAGGGG - Intergenic
933280181 2:80324243-80324265 CTTTGAAGGGGGTCGACAAAGGG + Intronic
933663705 2:84947656-84947678 TTTTGGAGGGGGAGGAGAAGGGG - Intergenic
933840119 2:86279705-86279727 CTCTGAAGGAGGAAGAGAAAGGG + Intronic
934181700 2:89628745-89628767 TTTTGAAGAGTGAATATAAGCGG - Intergenic
934292001 2:91702964-91702986 TTTTGAAGAGTGAATATAAGCGG - Intergenic
936578640 2:113676235-113676257 CTTTGAAGGGTGAGAATAAATGG - Intergenic
937399207 2:121567054-121567076 CTTTAATAGGTGAAGATAAGTGG - Intronic
939245272 2:139615575-139615597 TTTTGAAATGGGAAGATGAGTGG + Intergenic
940261576 2:151785396-151785418 CTTTGCAGGGCCAAGATCAGTGG + Intergenic
940336181 2:152529934-152529956 TTTAGAAGGAGCAAGATAAGTGG + Intronic
941399026 2:165007879-165007901 TTTTGATGGGGGGAGAAAAGGGG + Intergenic
941995711 2:171600359-171600381 CTTTGTAGGAGTAAGCTAAGTGG + Intergenic
942654354 2:178199319-178199341 GGTTTAAGGGGGAAGAGAAGAGG - Intronic
942819425 2:180094085-180094107 ACTTGAAGGTGGAAGATAAGAGG - Intergenic
943393742 2:187305799-187305821 TATAGAAGGGGGAAGATAAGTGG - Intergenic
944063295 2:195592150-195592172 CTTTGAAGAGGTGAGATTAGGGG - Intronic
944840827 2:203622037-203622059 GTATGAGGTGGGAAGATAAGTGG + Intergenic
945838553 2:214861088-214861110 CCTTGCAGGGGGACAATAAGTGG - Intergenic
945842545 2:214905233-214905255 ATTTGGAGGGGGAAGAGAAAAGG + Intergenic
947437702 2:230086977-230086999 CTTTGAAGTGTGAAGAAAAGAGG - Intergenic
948001419 2:234570906-234570928 CTTTGAGAGGAGAAGATAAGGGG + Intergenic
948027564 2:234790207-234790229 CTATGCTGGGGGAAGATGAGAGG - Intergenic
948029638 2:234806653-234806675 CTGTGCTGGGGGAAGATGAGAGG + Intergenic
1168738650 20:168691-168713 ATTAGAAGGGGGAAGAGAAAAGG + Intergenic
1168876557 20:1176027-1176049 CTTTGAAGGGGCAGGAGTAGAGG - Intronic
1169167322 20:3435348-3435370 TTTTAAAGGGGGTAGAAAAGAGG - Intergenic
1169217038 20:3800097-3800119 TTGGGGAGGGGGAAGATAAGAGG - Intronic
1169439402 20:5621532-5621554 TTTAGATGGGGGAAGATTAGAGG + Intergenic
1171469226 20:25356615-25356637 CTTTGACGGGGGAGGAAGAGAGG + Intronic
1172173405 20:32958337-32958359 CCTTGAAGGGAGAGGATAAGGGG + Intronic
1172636545 20:36414001-36414023 CCTTAAAGGGGGAAGAGAACAGG - Intronic
1172640828 20:36439547-36439569 CTTTCAAGGAGGAAGGAAAGGGG + Intronic
1172706151 20:36883507-36883529 CTTTGATGGGGGAAGATAGCAGG - Intronic
1172833105 20:37853348-37853370 CTTTGATGAGGGAAGATATAAGG + Intronic
1173178526 20:40783819-40783841 GTTTGAGGGAGGAAGATGAGTGG - Intergenic
1174564894 20:51457490-51457512 CTTTGAAGGGGGAAGCAACGAGG - Intronic
1174637951 20:52018011-52018033 CATTGAAGTGGGCAGATCAGTGG + Intergenic
1174811620 20:53650472-53650494 CTTTGAAGGGTCAAGATAGGAGG - Intergenic
1175560579 20:59925616-59925638 TTTTGAAGGTGGAAGGTCAGAGG - Intronic
1176082707 20:63282024-63282046 CTGTGACGGGGGAAGACACGGGG - Intronic
1176082720 20:63282082-63282104 CTGTGACGGGGGAAGACACGGGG - Intronic
1176238301 20:64064338-64064360 CTTTGAAGGGGCCAGGTCAGTGG + Intronic
1176730780 21:10494472-10494494 TTTTGAAGAGTGAATATAAGTGG + Intergenic
1176904562 21:14483840-14483862 CTGTGAAGGGGGAAGAATAGAGG + Intergenic
1177769293 21:25497049-25497071 CTTTGGAGGGAGAAGGTCAGGGG - Intergenic
1178277574 21:31252885-31252907 CTTTGAAAGGGCAAGGTAATTGG - Intronic
1178288376 21:31344876-31344898 CTTTCCAGGGGGAAGGAAAGAGG - Intronic
1178574788 21:33776306-33776328 CTTTGAGAGGGCAAGGTAAGAGG + Intronic
1178826046 21:36017810-36017832 CTCTGAAAGGGGAAGAAGAGAGG - Intergenic
1178832082 21:36064549-36064571 CTTTGAAGGGGGAGGCTTTGAGG - Intronic
1178847486 21:36185813-36185835 CTCTGACGGGGAAAAATAAGGGG + Intronic
1180556590 22:16583138-16583160 CTTTGAAGGGTCAAGATAGGAGG + Intergenic
1181404075 22:22669411-22669433 CTGTGAAGGGGGAACATCACTGG - Intergenic
1184491417 22:44811372-44811394 CATTGAAGGGCGTTGATAAGTGG + Intronic
1184570301 22:45319394-45319416 ATTTGGAAGGGGACGATAAGAGG - Intronic
1184584006 22:45435510-45435532 CTTTCAAGTGGGGAGATAAAGGG + Intergenic
949764506 3:7511352-7511374 CTTTGAAGGGAGAAGGGAATAGG - Intronic
950227935 3:11251118-11251140 AGCTGGAGGGGGAAGATAAGGGG + Intronic
950285025 3:11737915-11737937 GTTTGAATGGAGAAGAAAAGTGG - Intergenic
951736029 3:25865511-25865533 CTTTGGATGGGGAAGAAATGGGG + Intronic
952629208 3:35444346-35444368 CTTTGGAGGGTGAAGATCAGGGG + Intergenic
953096948 3:39787081-39787103 GTTGGGAGGGGGAAGAGAAGAGG - Intergenic
953156692 3:40381693-40381715 CTTTGAAGGGGGCAGAAAAGAGG + Intergenic
953285478 3:41602390-41602412 ATTGGAAGGGGGAAGGGAAGGGG + Intronic
954197326 3:49004527-49004549 CTGTGACGGGGTCAGATAAGGGG - Intronic
955292346 3:57704061-57704083 CTTTGATGTGGGAAGAGAAGAGG + Intergenic
956013851 3:64860267-64860289 TTTGGAAGGGGGATAATAAGGGG + Intergenic
957458817 3:80490159-80490181 TTCTGAAGTGGGAAGATTAGAGG + Intergenic
962020456 3:131494996-131495018 TTTTGAATGAGGAAGTTAAGTGG - Intronic
962544098 3:136414533-136414555 CTTTGAGGGGTTAAGACAAGTGG - Intronic
962631222 3:137278034-137278056 GTTTGAAGGGAGAGGAAAAGGGG + Intergenic
963402833 3:144823052-144823074 CTTTGTAGAGGCAAGATAACTGG + Intergenic
964525630 3:157613081-157613103 CTTAGAAGGGGCCAGTTAAGGGG + Intronic
965829707 3:172771688-172771710 CTTTGAAGGAGGAATTCAAGAGG + Intronic
968123672 3:196143368-196143390 CTTTGAAGGGCGAGGATGGGCGG + Intergenic
970071847 4:12168670-12168692 CTTTGAAAGGCCAAGACAAGAGG + Intergenic
970189527 4:13500183-13500205 ATTTAAAGGGGGAAAAAAAGAGG - Intergenic
971326420 4:25647998-25648020 CTGAGACCGGGGAAGATAAGAGG - Intergenic
972961997 4:44464367-44464389 CATTGAAGGGAGAAGACAAGGGG - Intergenic
973841106 4:54861563-54861585 CTTGGAATGGGGAAGAAAAGAGG - Intergenic
974742611 4:66025557-66025579 ATTTGATGGTGGAAGATGAGAGG + Intergenic
974864708 4:67565905-67565927 GGTTGAGGGGGGAAGAGAAGTGG - Intronic
979891488 4:126101821-126101843 CTTCAAAGTGTGAAGATAAGAGG - Intergenic
981491145 4:145340661-145340683 CTTTGAAGGGTGAGGAAAAATGG - Intergenic
981802692 4:148676964-148676986 TTTTTAAGGGGAAAGAAAAGAGG + Intergenic
984726905 4:183030356-183030378 GTTTCTAGGGGAAAGATAAGTGG - Intergenic
988299548 5:29404354-29404376 CTTTGGAAAGGGAAGGTAAGAGG + Intergenic
988572703 5:32386551-32386573 CAATGAAGGGGGAAAATAAAAGG - Intronic
989534427 5:42547671-42547693 CTTTGAAGGGATGAGATGAGGGG + Intronic
990398599 5:55411997-55412019 CTTTGAAGAGGGAATATAATTGG - Intronic
990738729 5:58890979-58891001 CTCTTAAGGGGGAAGAAAGGGGG + Intergenic
991246804 5:64517183-64517205 CATAGAAGGAGGAAGAAAAGAGG + Intronic
993977536 5:94500521-94500543 CTTAGACTGGGGAAGAGAAGCGG + Intronic
995081435 5:108054878-108054900 CTCTAAATGGGGAAGAGAAGAGG - Intronic
995260965 5:110104087-110104109 CTTTGAAGGGTGAGAATAAATGG + Intergenic
995269975 5:110208897-110208919 CCTTGAAGGGGGAGGATGGGAGG - Intergenic
995567654 5:113448288-113448310 CTTTGAAGGAAGAACATATGTGG + Intronic
995580937 5:113601464-113601486 TTGTGTAGGGGGAAGAGAAGAGG - Intergenic
996348961 5:122517611-122517633 CTTTGAGGGGTGAACAAAAGTGG - Intergenic
996479717 5:123961409-123961431 CTTTCAAGGGTAAAGATAAGGGG - Intergenic
996549798 5:124718096-124718118 CTTTGAAAGAAGAAGAGAAGAGG - Intronic
999784907 5:154882254-154882276 AGTGGAAGGGGGAAGATGAGGGG - Intergenic
1000070928 5:157740508-157740530 CTCTGAAGGGGGAAGGTAGTGGG + Exonic
1000198958 5:158988598-158988620 CTTTGAAGGGAGGAGTTGAGGGG + Intronic
1000790988 5:165607051-165607073 ATTTGAAGGAGGAAGGTGAGAGG - Intergenic
1001574245 5:172751536-172751558 CTCTGAAGGGGAAACAGAAGAGG + Intergenic
1002802960 6:543800-543822 TTTTGAAGGAGGAAGATGACTGG + Intronic
1003920172 6:10825480-10825502 CTTTAGAGGGAGAAGAAAAGAGG - Intronic
1004491687 6:16123175-16123197 CTTCCAAGGTGGGAGATAAGAGG - Intergenic
1004581548 6:16958832-16958854 CTTTGAGGAGGCAAGACAAGGGG - Intergenic
1005397570 6:25399049-25399071 CTGTGAGCGGGGAAGAAAAGGGG - Intronic
1005397621 6:25399384-25399406 CTTTGACTGGGGAAGCTAATAGG + Intronic
1006170979 6:32092433-32092455 CTGGGAAGAGGGAAGGTAAGAGG + Intronic
1006508975 6:34511589-34511611 CTTGGGAGGGGGAAGATCGGGGG - Intronic
1007038681 6:38701781-38701803 CTTTAAAAGGGGTAGATAAGTGG - Intronic
1007957986 6:45934420-45934442 ACTTGAAGGGGGAAGAAAAGAGG + Intronic
1008085493 6:47239871-47239893 CTTGGAAGGGGAAAGAGAATTGG - Intronic
1009484475 6:64202747-64202769 CTTTGAAGAGGAAAGAGAAGGGG + Intronic
1013805302 6:113989837-113989859 GTGTGAAGTGGGAAGACAAGAGG + Intronic
1014032377 6:116720280-116720302 CTTAGAAGAGGGGAGAAAAGTGG - Intronic
1014424041 6:121280802-121280824 CATTGATGGGTGAACATAAGAGG + Intronic
1014899887 6:126950058-126950080 CTGGGAAGGGGAAAGAAAAGGGG - Intergenic
1015373387 6:132481324-132481346 CTTTGGAGGGGGAAAAAAACTGG + Intronic
1016836461 6:148482115-148482137 GTTGGAGGGTGGAAGATAAGAGG + Intronic
1017225657 6:152018502-152018524 ATTTGAAGAGGGAATATAAAGGG - Intronic
1017628251 6:156370057-156370079 CTTGGAAGGCAGAAGAGAAGCGG + Intergenic
1019030616 6:169007711-169007733 CTTTGATTGGGTAAAATAAGTGG - Intergenic
1020363020 7:7350078-7350100 ATTTGAAGGAGGAAAATAATTGG + Intergenic
1020491082 7:8785238-8785260 CTCAGAAGGGGGAAGATGAGAGG + Intergenic
1020997881 7:15287066-15287088 CATAGAAGCGGGAAGATGAGAGG + Intronic
1027929438 7:84512268-84512290 CTTTGAAGGAGGAAAATAGTAGG + Intergenic
1028448302 7:90950488-90950510 CTAAGAAGGAGGAAGAAAAGAGG + Intronic
1029912198 7:104164918-104164940 CTTCAAAGGGGAAAGAAAAGAGG + Intronic
1031168080 7:118254940-118254962 CTTGGAAGGTGGGAGTTAAGCGG + Intergenic
1032105749 7:129027747-129027769 ATTTGAAAGTGGAAGACAAGAGG + Intronic
1032329272 7:130962545-130962567 CGATGCAGGAGGAAGATAAGGGG - Intergenic
1033239592 7:139666192-139666214 CTTTGAAGGAGGAACAAAACAGG - Intronic
1033799117 7:144879831-144879853 GGTTCAAAGGGGAAGATAAGTGG + Intergenic
1033933619 7:146555158-146555180 CTTTGAAGGAGAAAGAAAATGGG - Intronic
1035338776 7:158147238-158147260 CATTGAAGGGGAAAGACACGTGG - Intronic
1035338783 7:158147276-158147298 CATTGAAGGGGAAAGACACGTGG - Intronic
1035338799 7:158147352-158147374 CATTGAGGGGGAAAGATACGTGG - Intronic
1035338807 7:158147390-158147412 CATTGAAGGGGAAAGACACGTGG - Intronic
1035338904 7:158147846-158147868 CATTGAAGGGGAAAGACACGTGG - Intronic
1035339022 7:158148416-158148438 CATTGAAGGGGAAAGACACGTGG - Intronic
1035339087 7:158148720-158148742 CATTGAAGGGGAAAGACACGTGG - Intronic
1035339135 7:158148948-158148970 CATTGAAGGGGAAAGACACGTGG - Intronic
1036436639 8:8740709-8740731 TTGTGTATGGGGAAGATAAGGGG - Intergenic
1036478755 8:9119004-9119026 GTGTGAAGGGGGAAGAGAACTGG - Intergenic
1037701361 8:21277116-21277138 ATTAGAAGGGGGAATAGAAGGGG - Intergenic
1037936702 8:22919833-22919855 CTTTGGAGTTGGCAGATAAGTGG - Intronic
1038296550 8:26296750-26296772 TTTTGAAAGGGGAAGAGAAATGG + Intronic
1039608114 8:38899748-38899770 CTTTCAATGAGGAAGAAAAGGGG - Intergenic
1040595406 8:48833360-48833382 ATTTGAAGGGGGAAGCTTCGTGG + Intergenic
1041759192 8:61345725-61345747 CTTTGAAAAGGGAAGAGATGGGG + Intronic
1043997880 8:86842154-86842176 TTTTCAAGGGGGATGATCAGTGG - Intergenic
1044476256 8:92629974-92629996 CTTTGAAGGTGGGAGAGAAGAGG + Intergenic
1044796198 8:95900683-95900705 CTTTAAATGGGGATGATGAGGGG - Intergenic
1044815752 8:96110610-96110632 CTTTGAAGTTGGAAAATAAGGGG - Intergenic
1044941140 8:97345125-97345147 CTTCTAAAGGGGAAGAGAAGAGG + Intergenic
1045009644 8:97946554-97946576 CTGGGAAGGGGAAGGATAAGGGG - Intronic
1045371942 8:101533154-101533176 ATTTGAAGGGGAGAGTTAAGAGG + Intronic
1046094032 8:109537402-109537424 CTTTGAAAGGGGAGAGTAAGTGG + Intergenic
1046807823 8:118499965-118499987 CTCTGATGTGGGAAGAGAAGAGG - Intronic
1047571612 8:126104946-126104968 TTTTGAAGGGTGCAGATAATGGG + Intergenic
1048308206 8:133297912-133297934 CTTAGAACTGGGAAGATGAGGGG - Intronic
1048447344 8:134501663-134501685 CTTTGAAGGGGAAAGGTGAGTGG + Intronic
1055633442 9:78248454-78248476 CTGGGAAGGGGGAAGATCACTGG - Intronic
1055694920 9:78873430-78873452 CTTTGCAGGGGGAAAATCAAAGG + Intergenic
1055758602 9:79582121-79582143 TTTTGAAGGGGGAAGCTGGGAGG + Intronic
1056291780 9:85150756-85150778 ATTTGAAGGGGGAACCTGAGGGG - Intergenic
1057881025 9:98792832-98792854 TTTTTAAGGAGGAAGAAAAGGGG + Intronic
1057894380 9:98895772-98895794 CTTTGAGTGGGGAAAATAAGTGG - Intergenic
1059714091 9:116897023-116897045 CTGTGAAGGGGCAAGAAATGTGG + Intronic
1060307978 9:122433623-122433645 CTTTCGAGGGGGAAGAGAAAAGG - Intergenic
1061802240 9:133119072-133119094 CTTAGAATCGGGAAGATAAGCGG + Intronic
1186209831 X:7238522-7238544 CAGAGAAGGGGGAAAATAAGGGG + Intronic
1187128348 X:16475686-16475708 CTGTGGAGGGGGAAGTTAGGAGG + Intergenic
1189279849 X:39813349-39813371 CTTTGAAGGGGGTAGTTATATGG + Intergenic
1189743575 X:44146546-44146568 TTTTGCAGAGGGAAGAGAAGAGG + Intergenic
1189855646 X:45222658-45222680 CTTTTGAGGGGGATGATTAGAGG + Intergenic
1190927837 X:54924599-54924621 CTTGGAAGGAGGCAGAGAAGAGG - Intronic
1191123638 X:56931773-56931795 CTTTCCAGGGGGATGATCAGTGG - Intergenic
1191212802 X:57907187-57907209 CTTTGAGGAGGGAAAACAAGGGG + Exonic
1192343630 X:70283522-70283544 CTTTTAAGGAGACAGATAAGTGG + Exonic
1193184887 X:78500748-78500770 CTTGCAAGGGGGAAGATTGGTGG - Intergenic
1194717089 X:97299130-97299152 CTATAAAGAGGGAAAATAAGAGG + Intronic
1195160642 X:102167446-102167468 CTTTGAAGAGGGAGGATAGTGGG - Intergenic
1195402977 X:104481486-104481508 CTTTGAAGGGAGAAGGAATGGGG + Intergenic
1195807973 X:108796650-108796672 CTTTTAAGAGGGACGATCAGTGG + Intergenic
1195857458 X:109346616-109346638 CTTGGAAGGGAGAAGAAGAGAGG - Intergenic
1196620969 X:117823183-117823205 CTCTGAAGGGGGAGGATAGGAGG - Intergenic
1198436475 X:136621631-136621653 GTTTGAAAGGTGAAGATAACAGG + Intergenic
1199078097 X:143546963-143546985 CTCAGAAGGGGGAAGGTCAGAGG + Intergenic
1199921099 X:152404928-152404950 CCTTGCAGGGGGACGATCAGTGG - Intronic
1200352598 X:155514266-155514288 CTTTTAAGGGGAAAAATAAAAGG + Intronic
1200695056 Y:6351331-6351353 TTCTGCAGGGGGAAGATTAGAGG + Intergenic
1201040221 Y:9823379-9823401 TTCTGCAGGGGGAAGATTAGAGG - Intergenic
1201228622 Y:11842307-11842329 CTTTGAAGGGGTAAAATCTGAGG - Intergenic
1202592473 Y:26500913-26500935 CTTTGATGGTGGAAGATAAAGGG - Intergenic