ID: 919972163

View in Genome Browser
Species Human (GRCh38)
Location 1:202588117-202588139
Sequence CAGGGCAAAGACAAGGAGGA AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 850
Summary {0: 1, 1: 1, 2: 9, 3: 79, 4: 760}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
919972163_919972172 14 Left 919972163 1:202588117-202588139 CCTTCCTCCTTGTCTTTGCCCTG 0: 1
1: 1
2: 9
3: 79
4: 760
Right 919972172 1:202588154-202588176 GGGTGAAAAGAACCACCCTGAGG 0: 1
1: 0
2: 0
3: 10
4: 174
919972163_919972167 -7 Left 919972163 1:202588117-202588139 CCTTCCTCCTTGTCTTTGCCCTG 0: 1
1: 1
2: 9
3: 79
4: 760
Right 919972167 1:202588133-202588155 TGCCCTGACCTTGATCAACAGGG 0: 1
1: 0
2: 2
3: 11
4: 116
919972163_919972168 -6 Left 919972163 1:202588117-202588139 CCTTCCTCCTTGTCTTTGCCCTG 0: 1
1: 1
2: 9
3: 79
4: 760
Right 919972168 1:202588134-202588156 GCCCTGACCTTGATCAACAGGGG 0: 1
1: 0
2: 0
3: 9
4: 73
919972163_919972166 -8 Left 919972163 1:202588117-202588139 CCTTCCTCCTTGTCTTTGCCCTG 0: 1
1: 1
2: 9
3: 79
4: 760
Right 919972166 1:202588132-202588154 TTGCCCTGACCTTGATCAACAGG 0: 1
1: 0
2: 0
3: 13
4: 106

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
919972163 Original CRISPR CAGGGCAAAGACAAGGAGGA AGG (reversed) Exonic
900175242 1:1288622-1288644 CGGGGCAGAGACACGGGGGACGG - Intronic
900175526 1:1289818-1289840 CGGGGCAGAGACACGGGGGACGG - Intronic
900177002 1:1295395-1295417 CAGGGCAGGGCCAAGGAGGCTGG - Intronic
900270171 1:1782966-1782988 CAGGCCAAAGCCAAGGGGAAGGG + Intergenic
900613688 1:3554955-3554977 CAGGGAAAAGACAGGGCGGCTGG + Intronic
900751864 1:4402948-4402970 CAGGGACAAGACAAGCAGGGTGG + Intergenic
900971308 1:5993631-5993653 CAGGACAAATGCCAGGAGGAGGG - Intronic
901052775 1:6433794-6433816 CTGGGCAAAGACTTGGAGGAAGG - Intronic
901276987 1:7999581-7999603 CAAGGTCAAGGCAAGGAGGATGG - Intergenic
901922623 1:12547853-12547875 CAGGGCAAATGCCAGGTGGATGG - Intergenic
901945811 1:12702640-12702662 CAGGGCAAACAGCAGGTGGAGGG - Intergenic
902481463 1:16714254-16714276 CTGGGCAAAGACTTGCAGGAAGG + Intergenic
903049217 1:20588596-20588618 TAGGGCAAAGAGAAGTTGGAAGG + Intergenic
903269201 1:22177232-22177254 CAGGGGAGGGACAAGGAGCAAGG + Intergenic
903657081 1:24956098-24956120 CAGGGCAGAGCCAAGGAGGCAGG + Intronic
904052425 1:27647768-27647790 CAGGGCCGGGAGAAGGAGGAGGG + Intergenic
904357151 1:29947734-29947756 CAAGGAAAAGAAGAGGAGGAAGG - Intergenic
904376832 1:30086840-30086862 CAGGGGAAAGACGATGAGAAGGG + Intergenic
904431266 1:30466090-30466112 CAGGGCAGAGGCGAGGAAGATGG - Intergenic
905543062 1:38775467-38775489 TAGGGTAAAGAAGAGGAGGAAGG - Intergenic
905898309 1:41563439-41563461 CAGGAAAAAGTCAGGGAGGAGGG - Intronic
906472097 1:46139671-46139693 AAGAGGAAAGACGAGGAGGATGG - Intronic
907048363 1:51313663-51313685 CTGGGCAAAGGCCTGGAGGAGGG - Intronic
907099057 1:51811176-51811198 CAGGGAAAGGTAAAGGAGGAAGG - Intronic
907520154 1:55018561-55018583 CAGGGCTATGACAAGGAGGAAGG + Intergenic
907702728 1:56804991-56805013 CCAGGCAAAGAAAAGCAGGAAGG - Intronic
907909252 1:58812875-58812897 CAGGGAAAAGAGGAGGATGATGG - Intergenic
908280196 1:62525422-62525444 CAGGTCAAAAACAAGGATGTTGG - Intronic
908641029 1:66223711-66223733 CAGTGCATAGAGAAAGAGGAGGG + Intronic
908852042 1:68386489-68386511 TAGAGCAAAGAGCAGGAGGATGG - Intergenic
909415402 1:75400706-75400728 CAGGCCAAAGCCAAGCAGGTGGG - Intronic
909480545 1:76125269-76125291 CAGGGAACAGGTAAGGAGGAGGG - Intronic
909574821 1:77161944-77161966 TATGGCATAGACAAGGAAGAGGG - Intronic
909688994 1:78384490-78384512 CAGTGCAAACTCATGGAGGAAGG + Intronic
909906660 1:81204319-81204341 TATGGCAAAGACCCGGAGGAGGG - Intergenic
910049072 1:82955774-82955796 CAGAGCAAAGAGCAGGAGGACGG - Intergenic
910144152 1:84058844-84058866 CGGAGCAAAGAGCAGGAGGACGG + Intergenic
910843702 1:91585689-91585711 AAGGGCAGAGAAAAAGAGGAAGG + Intergenic
911040277 1:93585716-93585738 CAGGGCAATTGCAAGGAGGGAGG - Intronic
911449128 1:98043134-98043156 GAGGGCACAGTAAAGGAGGAGGG - Intergenic
913242278 1:116839411-116839433 CAGTCAAAAGACCAGGAGGATGG + Intergenic
914224362 1:145707863-145707885 CAGGGCAGAGGGAAGCAGGATGG - Intronic
914666335 1:149835860-149835882 GAGGGCAGAGGCAAGGAGGAGGG + Intergenic
914669432 1:149857938-149857960 GAGGGCAGAGGCAAGGAGGAGGG - Intronic
915118747 1:153615724-153615746 CAGGGCAAGGCCAAGGTGAAGGG + Intronic
915346707 1:155201249-155201271 CAGGGAAAATATAGGGAGGAGGG - Intronic
915702285 1:157807304-157807326 CAGGGGTAAGATAAGGAGGGAGG - Intronic
915929340 1:160049433-160049455 ATAGGTAAAGACAAGGAGGAAGG - Intronic
915984337 1:160448749-160448771 GAGGGCAAGGAGGAGGAGGAGGG - Intergenic
916451402 1:164923945-164923967 GAGGGGGAAGACAAGGAGCAGGG + Intergenic
916475184 1:165162335-165162357 TAGGGCAAAGAGGAGTAGGAAGG + Intergenic
916890319 1:169106836-169106858 CGCGGGAAAGCCAAGGAGGAGGG + Exonic
916935081 1:169619357-169619379 CAGGGCAATGAGAAGCAAGAAGG - Intronic
916961568 1:169894267-169894289 CAGGGCGGAGAAAAGGAGTACGG + Intronic
917041242 1:170808474-170808496 CAGAGGAGAGACAGGGAGGAGGG + Intergenic
917243695 1:172976818-172976840 CAGGTCAAGGACAAGGTGGAGGG + Intergenic
917253072 1:173083608-173083630 CAGGGTAGAGAGTAGGAGGAGGG + Intergenic
917929411 1:179813312-179813334 CAGGCGTAAGTCAAGGAGGATGG + Intronic
917931331 1:179824660-179824682 CAAGGCAAAGCCCAGGAGGGCGG - Intergenic
917975833 1:180237089-180237111 CAGGGGAAGGAGAAGGAGGGAGG - Intronic
917983501 1:180290620-180290642 CACTGCAAAGGCAGGGAGGAAGG + Intronic
918039968 1:180908028-180908050 CTGGGCAAAGGCAAGGAGACAGG + Intergenic
918077340 1:181180685-181180707 CAGGGCAGAAACAATGGGGAAGG - Intergenic
918105592 1:181413098-181413120 GAGGGCAGAGACAAGGAGTGGGG - Intronic
918283539 1:183029268-183029290 TAAGGCAGAGACAAAGAGGACGG - Intronic
918546210 1:185687452-185687474 GAGAGAAAAGAAAAGGAGGAAGG - Intergenic
918714690 1:187770692-187770714 CAGAGCAAAGAGCAGGAGGACGG + Intergenic
918796451 1:188904013-188904035 CAAGGGAAAGAAAAGAAGGAAGG + Intergenic
919911351 1:202112920-202112942 CAGGGCAGAGCCAAAGAGGAGGG - Intergenic
919972163 1:202588117-202588139 CAGGGCAAAGACAAGGAGGAAGG - Exonic
920129300 1:203719317-203719339 CAAGGCAAAGGCAATGAGGGTGG - Intronic
920308773 1:205035769-205035791 CAGAGCTAAGACTGGGAGGAAGG + Intergenic
920704254 1:208240283-208240305 GAGGGCTAAGCCCAGGAGGACGG + Intronic
920742889 1:208598150-208598172 CTGGGAAAAGAGATGGAGGAGGG + Intergenic
921599110 1:217088755-217088777 AAGGGAAAAGAAAGGGAGGAGGG + Intronic
921687026 1:218101735-218101757 CAGGGGAAGGAAAAGGAGAAAGG + Intergenic
921884153 1:220287639-220287661 CAGTGAAAAGTGAAGGAGGATGG - Intergenic
921945641 1:220884258-220884280 AAGGACAAGGACAAGGAGGCTGG + Exonic
921975592 1:221199536-221199558 GAGGACAAAGAGTAGGAGGAGGG + Intergenic
922154365 1:223029628-223029650 CGGAGCAAAGAGCAGGAGGACGG + Intergenic
922213263 1:223501200-223501222 GAGGGAAAGGAAAAGGAGGAGGG - Intergenic
922323881 1:224510863-224510885 GAGGACAAAGCCAGGGAGGAAGG - Intronic
922535821 1:226379921-226379943 AAGGGCCAGGTCAAGGAGGAAGG - Exonic
923112467 1:230902875-230902897 AAGGGCGAAGGCAAGGAGGCTGG + Intergenic
923143323 1:231179911-231179933 CTGGGCAAAGAGTAGGAGAAGGG + Intronic
924680008 1:246221452-246221474 GTGGGCAAAGAGAAGGAGAAAGG + Intronic
1062898667 10:1125051-1125073 CAGGGCACAGTGGAGGAGGACGG + Intronic
1063937025 10:11088753-11088775 CAGGGCACAGAGATGGTGGATGG + Intronic
1063956855 10:11275183-11275205 GAGGGCAAAGACAAGAAGCAGGG + Intronic
1064317931 10:14275510-14275532 CAGTGCAAAGAAAGGGAGAAAGG + Intronic
1064502454 10:15989070-15989092 CAGGGTAAACACCAGGAGGCAGG + Intergenic
1064689964 10:17906388-17906410 AAGAGGAAAGACAAAGAGGAAGG - Intronic
1064844670 10:19638310-19638332 CAGGGAAAACAAAAGGAGGTGGG + Intronic
1065695301 10:28374272-28374294 CTGGGCAAAGAGAGGGTGGATGG - Intergenic
1065742027 10:28805672-28805694 CAGGGCAAGAAAAAGGAGTAGGG - Intergenic
1066275617 10:33865639-33865661 CAGGGAAAAGAAAGGAAGGAAGG - Intergenic
1066390058 10:34971318-34971340 GAGGCCCCAGACAAGGAGGAAGG + Intergenic
1066518846 10:36194046-36194068 CAGGGAAAAGGCAATGAGAAAGG - Intergenic
1066700553 10:38123122-38123144 CAGGGCAAAGAGAGGGGGGAAGG + Exonic
1066784423 10:38987439-38987461 CAGGGGAAAGGCTGGGAGGAGGG - Intergenic
1066798612 10:39156374-39156396 CAGGCTAAAAACAAGAAGGAAGG + Intergenic
1066803636 10:39219083-39219105 CAGGATAAAAACAAGAAGGAAGG + Intergenic
1067046907 10:42990149-42990171 CAGGCCACAGACAAGGGGCAGGG + Intergenic
1067226316 10:44378543-44378565 AAGGGCAAAGACGTGGGGGAGGG - Intronic
1067473373 10:46551356-46551378 CAAGGCTAGGCCAAGGAGGATGG - Intronic
1067512349 10:46906497-46906519 GAGAGCAAAGAGAAAGAGGATGG + Intergenic
1067649894 10:48145325-48145347 GAGAGCAAAGAGAAAGAGGATGG - Intergenic
1067837883 10:49652791-49652813 CAGGGCAAAGGTCAGGAGGCAGG - Intronic
1068214321 10:53964046-53964068 CTTGGCAAAGCCAAGGAGGCAGG - Intronic
1068516327 10:58030415-58030437 TGGGGCTGAGACAAGGAGGAGGG - Intergenic
1069102159 10:64335378-64335400 CAAGGCAAGGAAAAGGAGAAGGG + Intergenic
1069489367 10:68848237-68848259 CAGGGCAGAGGCAAGGAGCCTGG + Intronic
1070476810 10:76836841-76836863 GAGGGCAAAGAGGATGAGGAAGG - Intergenic
1070511638 10:77166591-77166613 GAGGGGAAGGACATGGAGGAGGG + Intronic
1070592841 10:77812611-77812633 CAGGCCAAAGACACAGAGAACGG + Intronic
1071147093 10:82588352-82588374 CAGGGGCAAGAGAAGGAGGCAGG - Intronic
1072000695 10:91193108-91193130 CATGGCAAACGCAAGAAGGAAGG + Intronic
1072436168 10:95416218-95416240 CAGGGAAAAAAGAAAGAGGAGGG + Intronic
1072543267 10:96414451-96414473 CAGGGAGAAGACAGTGAGGAGGG - Intronic
1072712381 10:97724414-97724436 CAGGGCCACGAGAGGGAGGAGGG - Intergenic
1072789571 10:98308495-98308517 AAGGGCAAAGAAAAAAAGGAGGG + Intergenic
1072805163 10:98419384-98419406 AAGGGAAAAGACAGAGAGGAGGG + Intronic
1073959076 10:108905082-108905104 GAGGCCAGAGAAAAGGAGGAGGG + Intergenic
1074188131 10:111114485-111114507 ATGGGCAGAGACAAGGAGGGAGG - Intergenic
1074614545 10:115054103-115054125 GAGGGCAAAGAGGAAGAGGAGGG - Intergenic
1075076303 10:119352935-119352957 CAGGGGAGAGAGAGGGAGGACGG - Intronic
1075248435 10:120845451-120845473 CGGAGCAAAGAGCAGGAGGACGG - Intergenic
1076181509 10:128412587-128412609 CAGGGAAAAGCCAGGGAGGGTGG - Intergenic
1076493610 10:130881783-130881805 AAGGGTGAAGACAAGCAGGAAGG - Intergenic
1077010468 11:377047-377069 GAGGGCGAAGAGGAGGAGGAAGG + Exonic
1077358952 11:2131266-2131288 CAGGGCACAGACAGGGCCGAGGG + Intronic
1077515933 11:3002189-3002211 AAGGGGAAAGCCAAGGTGGAGGG + Intronic
1077795628 11:5488846-5488868 CATGGCAATGACCAGGATGAGGG - Exonic
1078183319 11:9030455-9030477 CAGGGCACTGAGATGGAGGAGGG + Intronic
1078654832 11:13229029-13229051 CAGAGCAAAGAGAAGGAGACTGG + Intergenic
1078987346 11:16608409-16608431 CAGGGAGAAGACAAGAAGGGTGG + Intronic
1079300675 11:19276387-19276409 TAGGGCAAACATAATGAGGATGG + Intergenic
1081576946 11:44324750-44324772 CAGGGCAAAGCCAGGGATCAGGG + Intergenic
1082308277 11:50611534-50611556 CAGGACAAAAACTAGAAGGAAGG - Intergenic
1082310377 11:50638759-50638781 CAGGGCAAAATCTAGAAGGAAGG + Intergenic
1082881407 11:58041529-58041551 CAGGGCAAGGAGAAAGAGCAGGG + Intronic
1083138694 11:60703846-60703868 TAGGGCACAGGCATGGAGGAAGG - Intronic
1083198690 11:61106376-61106398 CAGGGCAAAGGCAAGGGGGAAGG + Intronic
1083495457 11:63048005-63048027 GTGGGCAAAGGCATGGAGGAGGG + Intergenic
1083613029 11:64013436-64013458 CAGGGCAAAGGCCCGGAGGCAGG + Intronic
1083627951 11:64081589-64081611 CAGGCCAAAGACAGGGAGCAAGG + Intronic
1083670080 11:64294887-64294909 CAGGGCAGAGAGAGGGAGGGAGG + Intronic
1083840380 11:65301145-65301167 CAAGGCAAAGAGAGGGAGGGAGG + Intronic
1083887495 11:65580050-65580072 CAGGGGAGAGACCAGGAGAAGGG - Intronic
1083890806 11:65595014-65595036 GAGGGCACAGACAGGGATGAGGG - Intronic
1084014200 11:66369139-66369161 CAGGGCAAAGAGCAGCAGTATGG + Exonic
1084018770 11:66404378-66404400 GAAGGCAAAGAGAAGGTGGAGGG + Intergenic
1084463784 11:69310514-69310536 GTGGGAAAAGACTAGGAGGACGG + Intronic
1084489246 11:69469407-69469429 CAGGGGGAAGACATGAAGGAAGG + Intergenic
1084912734 11:72404265-72404287 CAGTGCCAAGAAAGGGAGGAGGG + Intronic
1084942957 11:72623648-72623670 ATGGGCAAAGGCAAGGGGGAGGG - Intronic
1085029369 11:73260330-73260352 CTCTGCAAAGACAAAGAGGATGG - Intergenic
1085237640 11:75027369-75027391 TTGGGCTAAGACAGGGAGGAAGG - Intergenic
1085498600 11:76996121-76996143 AGGGGGAAAGACAAGGATGATGG - Intronic
1085722115 11:78921654-78921676 CAGGACCAAGGCAAGGAGGGAGG + Intronic
1085801433 11:79593644-79593666 CAGGGAAGGGTCAAGGAGGAAGG - Intergenic
1086354469 11:85980234-85980256 CAGAGGATAGAGAAGGAGGATGG + Intronic
1086399635 11:86449964-86449986 TAGGGCCATGACAAGGAGGTGGG + Exonic
1086469641 11:87094514-87094536 CAGAGGAAAGACTAGGCGGAGGG - Intronic
1087196594 11:95309940-95309962 CGGAGCAAAGAGCAGGAGGACGG - Intergenic
1087499690 11:98933963-98933985 CAGGGCAAGAACATGGAGAAAGG + Intergenic
1087673159 11:101129112-101129134 GAGGGAAAAGGGAAGGAGGAGGG + Exonic
1087761762 11:102110469-102110491 CAGGGAAAAGAAAGGGAGGAAGG + Exonic
1088489745 11:110375386-110375408 ATGGGCAAAGACATGGAGTAGGG - Intergenic
1088551631 11:111019364-111019386 CAGGTCAAAGACAGTGAGGAAGG - Intergenic
1088796527 11:113270358-113270380 AAGGGCAAGGACATGGAGGAGGG + Exonic
1088880622 11:113970789-113970811 CAGGGCAAAGAAGACCAGGAAGG + Intergenic
1089495007 11:118903327-118903349 CAGGCCGAAGGCCAGGAGGAGGG + Exonic
1089558868 11:119333414-119333436 CAGGGCAGACTGAAGGAGGACGG + Intergenic
1089685692 11:120145305-120145327 GAGGGCAAAGTCAGAGAGGATGG + Intronic
1089982230 11:122781673-122781695 CAGGGCAAAGACATGGTGGCCGG - Intronic
1090096828 11:123750569-123750591 CAGATCCAAGAAAAGGAGGAAGG - Intergenic
1090529377 11:127574839-127574861 CAGGGAAAAGACCAGAAAGACGG + Intergenic
1090716099 11:129432879-129432901 CCGGCCAAAGACACTGAGGAGGG - Intronic
1091267555 11:134282630-134282652 CAAGGCAAAGAAAAGCAAGAGGG - Intronic
1091386062 12:95570-95592 CAGGGAAAAAACATGGAGGTAGG - Intronic
1091406837 12:214433-214455 AAGGGCAAGGAGGAGGAGGAGGG - Intronic
1091446547 12:546977-546999 GAGGGCAAGGACTGGGAGGAAGG - Intronic
1091842300 12:3629835-3629857 CAAGGAAAAGACAAGGGGGGGGG + Intronic
1092227350 12:6756434-6756456 GAGGGAAAAGACAAGAGGGATGG - Intronic
1092387912 12:8050410-8050432 CAGGGAAGAGAGAAGGAGGATGG + Intronic
1093268289 12:17026861-17026883 CAGAGCAAAGAGCAGGAGGACGG + Intergenic
1093411824 12:18877126-18877148 CAGGGCATAGGGATGGAGGAAGG + Intergenic
1093584787 12:20822113-20822135 CGGAGCAAAGAGCAGGAGGACGG + Intronic
1093592966 12:20928379-20928401 CAAAGCAAAGTCAAAGAGGAGGG - Intergenic
1093691189 12:22111197-22111219 CAGGGCAAAGAAAAAGAGTCAGG - Intronic
1093925221 12:24902826-24902848 GAGGGCAAGGCGAAGGAGGATGG + Intronic
1093957066 12:25232541-25232563 TGGAGCAAAGACAAGGATGAAGG + Intronic
1094171261 12:27494813-27494835 AAGGCCAAAGGGAAGGAGGAAGG - Intronic
1094863129 12:34493860-34493882 CAGGATAAAAACAAGAAGGAAGG - Intergenic
1095242870 12:39881641-39881663 CAGGGCACAGAAAAAGAGTATGG - Intronic
1096260425 12:50086618-50086640 CAGTGCAAAGAAAAAGAAGATGG + Exonic
1096587976 12:52636127-52636149 CAGGGGAAAGAAGAGAAGGAGGG - Intergenic
1096716326 12:53493472-53493494 CAGGGCACAGAAAAGGCGAAAGG + Intronic
1096837194 12:54358436-54358458 AATGGGAAAGACCAGGAGGAAGG - Intergenic
1097398248 12:59102127-59102149 CGGAGCAAAGAGCAGGAGGACGG - Intergenic
1098177853 12:67811702-67811724 CAGGAGAAAGACAATGAGAATGG + Intergenic
1098840470 12:75471530-75471552 AAGGGCAAAGAGAAGCAGCATGG + Intergenic
1098852749 12:75616962-75616984 CAGGGGAATGAGTAGGAGGAGGG + Intergenic
1099111258 12:78564459-78564481 CAGGGCAAACACCAGGAGAGTGG + Intergenic
1099141155 12:78977142-78977164 AAGGGCAAAGAAAGTGAGGAAGG + Intronic
1099337462 12:81381525-81381547 CAGGGCCAAGAGAATGAAGATGG + Intronic
1099345771 12:81497980-81498002 AAAGACACAGACAAGGAGGAGGG + Intronic
1099868076 12:88309543-88309565 GAGGAGAAAGAGAAGGAGGAGGG - Intergenic
1100122825 12:91388613-91388635 CTGTACAAACACAAGGAGGAAGG + Intergenic
1100423082 12:94456718-94456740 CAGGGAAGAGACCAGGTGGAGGG - Intronic
1100659652 12:96682958-96682980 CAAGGGAAAGACAAGGAAAATGG - Intronic
1100722513 12:97373860-97373882 CCGGGCAAAGAGACTGAGGAGGG + Intergenic
1101177877 12:102174967-102174989 GAGGGAAGAGACAGGGAGGAAGG - Intronic
1101408918 12:104453332-104453354 CCTGGGAAAGAGAAGGAGGAAGG - Intergenic
1101645934 12:106630956-106630978 CAGAGCAAAGACAAGGACCCAGG - Intronic
1101850415 12:108397457-108397479 CAGTGCAAAGGCCAGGAGGCAGG + Intergenic
1103134262 12:118493976-118493998 CAGGGAAAAGGCAGGGAGAAGGG + Intergenic
1103612646 12:122133535-122133557 CATGGTGAAGACAGGGAGGAAGG - Exonic
1103643450 12:122371675-122371697 CAGGACACAGGCGAGGAGGATGG + Intronic
1103851872 12:123938634-123938656 CAGGGGCCAGGCAAGGAGGATGG - Intronic
1104073761 12:125371367-125371389 CTGGGAAGAGACAGGGAGGAAGG + Intronic
1104332136 12:127856818-127856840 CTGGGAAAACACAAGGAGGGAGG + Intergenic
1104869348 12:131983518-131983540 CAGGGCACTGACAGGGAGGCCGG + Intronic
1104962203 12:132493642-132493664 CAGGGCACAGAAAAGGGGCAGGG - Intronic
1105206366 13:18228904-18228926 CATGACAAAGAAAAGGAGGCCGG + Intergenic
1105579165 13:21677319-21677341 AAGAGCAAAGAAAAGAAGGAAGG - Intronic
1105633485 13:22195011-22195033 TAAGCCAAAGATAAGGAGGAAGG + Intergenic
1105900171 13:24746438-24746460 CACAGCAAGGACCAGGAGGACGG - Intergenic
1106077540 13:26474392-26474414 TAGGGCGAAGACAAGAGGGAAGG + Intergenic
1106666863 13:31860433-31860455 CAGAAGAAAGAAAAGGAGGATGG - Intergenic
1107954957 13:45502772-45502794 CGGGGCAAAGACTGGGAGGCAGG - Intronic
1108128968 13:47276557-47276579 CAAGGCATGGAGAAGGAGGAAGG + Intergenic
1109158862 13:58947340-58947362 CTGGGCAGAGATAAGGAGGGTGG - Intergenic
1109709947 13:66146533-66146555 CAGAGCAAAAAGGAGGAGGACGG + Intergenic
1110076087 13:71244913-71244935 TAAGGAAAAGAAAAGGAGGAAGG - Intergenic
1110281402 13:73698193-73698215 GAGGGGAAAGGGAAGGAGGAGGG + Intronic
1111394677 13:87649757-87649779 CTGGGCATAGATAAGGTGGATGG - Intergenic
1111714482 13:91862967-91862989 AAGGGGAAAGAGAAGGAGAAAGG - Intronic
1112492234 13:99877379-99877401 CAGGGCAAGGAAAATGAGGGTGG - Intronic
1112786126 13:102953510-102953532 CAGGGGACAGACACGGAAGATGG + Intergenic
1112813438 13:103246055-103246077 AAGTGCAAAGTCAAGGAAGAGGG - Intergenic
1113433318 13:110268834-110268856 CAGGTGAGACACAAGGAGGAGGG + Intronic
1113520675 13:110938273-110938295 AAGGGCCAGGTCAAGGAGGAAGG + Intergenic
1113564319 13:111309644-111309666 CAAGGCAAGGAAAAGGGGGAGGG + Intergenic
1113842682 13:113369357-113369379 CAGGGCAAAGGGAAGGCGGGAGG - Intergenic
1114170029 14:20262884-20262906 AAGGGCAAAGGGAAGGAGGGAGG + Intronic
1114657353 14:24324077-24324099 CATGGCAAAGACAAGGAGGATGG + Exonic
1115297341 14:31843716-31843738 CTGGGCAAAAACAAGGAAAAGGG - Intronic
1115762536 14:36589874-36589896 CAGGGTGAAGGGAAGGAGGAAGG + Intergenic
1115779637 14:36755439-36755461 CAGGGCACTGACAGGGATGAAGG - Intronic
1116179111 14:41513345-41513367 CAGGGCAAAGTCCAGTGGGAAGG - Intergenic
1116573189 14:46544519-46544541 CGGAGCAAAGAGCAGGAGGACGG - Intergenic
1116922315 14:50592477-50592499 CAGGGTAAACAGAAGGAGGAAGG + Intronic
1117118848 14:52547282-52547304 CAGGGCAAAGCCAAGGACCACGG + Intronic
1117206623 14:53450075-53450097 CAGGGCAAAGAGGAGATGGATGG + Intergenic
1117480562 14:56140020-56140042 CAGGAAAAAGAGAAGGGGGAAGG - Intronic
1118294575 14:64557408-64557430 AAGGGGAAAGAGAAGGAGAAGGG + Intronic
1118523288 14:66611787-66611809 CAGGGCAATGATAGGGAGAATGG - Intronic
1118657192 14:67965344-67965366 CAGGGCAATGGCTAGGAGAATGG - Intronic
1118837624 14:69487814-69487836 CAGTGCCAGGACAAAGAGGAAGG + Intronic
1118889435 14:69895687-69895709 CAGGGAGAAGACAAGAAGTATGG - Intronic
1119140316 14:72261377-72261399 CAGGTCATACAAAAGGAGGAGGG + Intronic
1119316864 14:73703820-73703842 CAGAGCAAAGAGCAGGAGGACGG - Intergenic
1119318882 14:73717912-73717934 CAGAGCAGAGGCAAGGAGGCTGG + Exonic
1119422639 14:74516718-74516740 CAGGGCAGAGACAAGCCAGAAGG + Intronic
1119536844 14:75409648-75409670 GAGGGCAGAGACAGGGAAGAGGG - Intergenic
1120579623 14:86230005-86230027 CAGGGCAAAGTCAGGGAAGTGGG + Intergenic
1121120957 14:91375663-91375685 CATGGCCAAGCCAAGCAGGATGG + Intronic
1121242574 14:92440905-92440927 CCAGGCAAAGGCAGGGAGGAGGG + Intronic
1121315978 14:92961238-92961260 CAGGGCAAAGACAAGGCCCCAGG + Intronic
1121497343 14:94402983-94403005 CAGGGGAAAGAAAGGAAGGAAGG - Intergenic
1121706684 14:96001704-96001726 GAGAGCAAAGAGAAGCAGGATGG + Intergenic
1122004710 14:98692636-98692658 CAGGGGAAGGACAAGAGGGAGGG - Intergenic
1122149422 14:99716970-99716992 CAGGTGAAAGGCATGGAGGAAGG + Intronic
1122234748 14:100325293-100325315 CTGGGCAAAGGCCAGGAGGAGGG - Intronic
1122353788 14:101111894-101111916 AAGGGCAAGGACAAGGAGCGGGG - Intergenic
1122595606 14:102888332-102888354 CAGGGCAGAGTCAAGGTGGTAGG - Intronic
1122627979 14:103093979-103094001 CAGGGAAAATCCAAGGAGAACGG - Intergenic
1122667130 14:103338377-103338399 AAGGGCAAAGACAAGGAAAATGG + Exonic
1123450488 15:20356806-20356828 CAGGGCGAAGGCCCGGAGGAGGG - Intergenic
1123988387 15:25665198-25665220 CAGGGCAAAGACAAGGACCAAGG + Intergenic
1124594720 15:31083030-31083052 CTGGACGGAGACAAGGAGGAAGG + Intronic
1125045436 15:35239112-35239134 CGGAGCAAAGAGCAGGAGGACGG - Intronic
1125212466 15:37233235-37233257 CAGGTCAAAGACAGTGAGGCAGG + Intergenic
1125285421 15:38087754-38087776 CAGGGCACAGACACGGAGTTCGG - Intergenic
1125306205 15:38318577-38318599 CAGGGGAAAGAGAAGGAGGGAGG - Intronic
1125511840 15:40296408-40296430 GAGGGCAAAGAAGAGGAGGATGG + Intronic
1127687925 15:61366550-61366572 CAGGGTGAAGACTAGGATGAGGG + Intergenic
1128818183 15:70629551-70629573 CAGGGCTAGGGCAGGGAGGAGGG - Intergenic
1128883310 15:71263109-71263131 GAGGGCAGAGACTGGGAGGAGGG - Intronic
1129497344 15:75997728-75997750 CAGGGCCAAGAGATGGAGAAGGG - Intronic
1130022273 15:80241574-80241596 CAGAGCAAAGCAAAGGAGAATGG - Intergenic
1130112725 15:80979283-80979305 AAGGGCAAAAAAAAGAAGGAAGG - Exonic
1131511555 15:93051939-93051961 CAGGGCAGAGACAAAGGGCAGGG + Intronic
1131846582 15:96495345-96495367 TAGGGCACAGAGAAGGAGGAGGG + Intergenic
1132110651 15:99099888-99099910 CAGGGCGAGGGCATGGAGGAAGG + Intronic
1132709487 16:1260060-1260082 CAGGGCAGAGAAGAGGTGGAAGG - Intergenic
1132770761 16:1561666-1561688 CGGGGAAAAGGCAAGGGGGAAGG + Intronic
1132799929 16:1747004-1747026 AAGGCCAAACACAGGGAGGAGGG - Intronic
1132884340 16:2176006-2176028 CAGGTCAAAGACACTGAGCAAGG - Intronic
1132959080 16:2612309-2612331 CAGGGCCAAGCCCAGGAGGCAGG + Intergenic
1132972140 16:2694284-2694306 CAGGGCCAAGCCCAGGAGGCAGG + Intronic
1133118631 16:3592721-3592743 CAGAGCTAAGGCCAGGAGGAAGG + Exonic
1133172907 16:3992772-3992794 CAGGGCACAGGCAAGGTGGATGG + Intronic
1133410933 16:5568265-5568287 TTGGGCAAAGGCAAGGAGGTGGG - Intergenic
1133420385 16:5641676-5641698 CAGGGCAAAGGCCTGGAGGCGGG + Intergenic
1133507030 16:6422389-6422411 GAGGGGAAAGACAGGGAGGAGGG - Intronic
1133901482 16:9979388-9979410 CAGTGCGAAGACACTGAGGAGGG - Intronic
1134175169 16:12000029-12000051 GAAGGCTAGGACAAGGAGGATGG + Intronic
1134303563 16:13012648-13012670 CAGGTCACAGAGAAGGAGGTGGG + Intronic
1134610268 16:15602637-15602659 GAGGAGAAAGAAAAGGAGGAGGG + Intronic
1136032559 16:27514267-27514289 CAGGGCAGAGCCAAGAGGGACGG - Intronic
1136074819 16:27809788-27809810 CAGTGGAAAGACAGGGAGGGTGG - Intronic
1136452170 16:30359609-30359631 AAGAGCAAGAACAAGGAGGAGGG + Intronic
1136841638 16:33546241-33546263 CAGGGCAAAGACAAGGGCAGGGG + Intergenic
1137801040 16:51262205-51262227 CAGGAAGAAGACAGGGAGGAAGG - Intergenic
1137936552 16:52640396-52640418 TAGAGCAAAGACAAGGACAATGG + Intergenic
1138062697 16:53908558-53908580 CAGGGCAATATCAAAGAGGATGG - Intronic
1138299266 16:55912630-55912652 CAGGGAAAAGACCAGGAGGAGGG + Intronic
1138835410 16:60428870-60428892 GAAGGGAAAGAGAAGGAGGATGG + Intergenic
1138928979 16:61629159-61629181 CGGGAGAAAGACAAGGAGGAAGG + Intergenic
1139089839 16:63632015-63632037 CAGAGCAAAGACAAGAAAGGAGG + Intergenic
1139328432 16:66169383-66169405 GAGGGGAAAGAAAAGTAGGAAGG + Intergenic
1139478886 16:67217334-67217356 CAGAGCCAGGACTAGGAGGAAGG - Intronic
1139543775 16:67638700-67638722 CAGGGCAAAGAAAATGTCGATGG - Exonic
1140123380 16:72101757-72101779 CAGTGAAGAGACCAGGAGGAAGG - Intronic
1141779993 16:86152957-86152979 CTGGGCAAAGACCTGAAGGATGG + Intergenic
1141934776 16:87229953-87229975 AAGGGCAAGGACAGGGAGGCAGG - Intronic
1203151803 16_KI270728v1_random:1846538-1846560 CAGGGCAAAGACAAGGGCAGGGG + Intergenic
1143014770 17:3885810-3885832 CAGGGCAAAGGCATGGAGGTGGG - Intronic
1143125094 17:4636811-4636833 CAGGTCTCAGACAAGCAGGAGGG - Intronic
1143260410 17:5594443-5594465 CAAGGCTAAGATAGGGAGGAGGG + Intronic
1143403419 17:6660347-6660369 CAGGTCTCAGACAAGCAGGAGGG + Intergenic
1143712284 17:8743226-8743248 CAGTGCAAGGACAAGGATGGAGG + Intronic
1144163333 17:12582602-12582624 CTGGGCAAGGACAGGGAAGAAGG - Intergenic
1144176774 17:12715140-12715162 CAGAGCAAAGTCAAAGAGGGTGG + Intronic
1145030805 17:19503769-19503791 CAGGGCAAGGACTAGGAGTGAGG - Intronic
1145900439 17:28487567-28487589 CTGGCCAGAGACAAGGAGCAGGG - Intronic
1146282728 17:31555635-31555657 CAGGGGAAAGGCAAGCAGGAAGG - Intergenic
1146430649 17:32790763-32790785 CAGGGCAAAGAGAGAGAAGAGGG + Intronic
1146678981 17:34793456-34793478 GAAGGCAAAGCCAAGGAGGCTGG + Intergenic
1146679026 17:34793685-34793707 CTGGGCAAAGGCATGGAGGATGG - Intergenic
1146786242 17:35724460-35724482 CAGGGGAAAGGAAAGGAGTAAGG - Intronic
1146935862 17:36812430-36812452 CAGTGCAAAGGCCTGGAGGAGGG - Intergenic
1147037381 17:37691872-37691894 CAGGGCACTGACAAGGGGGCAGG - Intronic
1147236303 17:39060037-39060059 AAGGGGAAAGACAAGCTGGAAGG + Intergenic
1147890048 17:43710781-43710803 AAGGGCAAAGAGAGGGAGAAAGG + Intergenic
1148150027 17:45391440-45391462 CAGGGGAAAGGGAAGGAGGCAGG + Intergenic
1148204450 17:45771145-45771167 AGGGGCAGAGACAGGGAGGAAGG + Intergenic
1148247127 17:46039954-46039976 CTGGGCAAATTAAAGGAGGATGG - Intronic
1148492537 17:48032603-48032625 CAGGAGAAAAACAGGGAGGAAGG + Intronic
1148564038 17:48622731-48622753 AAGGGCAAAGGAAAGGAGGGAGG + Exonic
1149569401 17:57661799-57661821 GAGGGCAAAGACAAGGACAGAGG - Intronic
1149634489 17:58155837-58155859 CTCGGGAAAGGCAAGGAGGAAGG + Exonic
1150197619 17:63317313-63317335 CAGGGAAATGACAAGGAGGGGGG - Intronic
1150272107 17:63873305-63873327 CAGGGCAAAAGCCAGGAGCAGGG + Exonic
1150275655 17:63896201-63896223 CAGGGCAAAAGCCAGGAGCAGGG + Exonic
1150277787 17:63910890-63910912 CAGGGCAAAAGCCAGGAGCAGGG + Exonic
1151840015 17:76611011-76611033 CACAGCAAAGAGCAGGAGGATGG + Intergenic
1152261586 17:79270119-79270141 AATGGCAAAGGGAAGGAGGACGG - Intronic
1152887108 17:82859005-82859027 CCGAGCAAAGACAATGAGGGTGG - Intronic
1153299910 18:3583362-3583384 AAGGGGAAAGACAAGAAAGAGGG - Intronic
1154092404 18:11378098-11378120 GAGGGCAAAGAGGAGAAGGAGGG + Intergenic
1154120832 18:11651247-11651269 CAGGGCAGAGCCAAGAAGCAGGG + Intergenic
1154345800 18:13542644-13542666 CAGGGAGAAGATAAGGAGGCGGG + Intronic
1154389518 18:13924364-13924386 CAGGGCAAAGACAAGATGCCAGG - Intergenic
1155450415 18:25957520-25957542 CAGGGCAAAGAGAAATAGGAAGG - Intergenic
1156341581 18:36214509-36214531 CAGGGAAGAGACAGGGAGGGTGG - Intronic
1156472597 18:37387198-37387220 CCGGGAAAAGGCAGGGAGGAAGG - Intronic
1156486784 18:37471490-37471512 AGGGGCAAAGGCAAGGAGGAGGG - Intronic
1156812946 18:41274238-41274260 CAGGGGAAAGAGTAGCAGGAGGG + Intergenic
1156961298 18:43034908-43034930 CAAGGCACAGAGGAGGAGGAAGG - Intronic
1156964114 18:43069546-43069568 AAGGACAAAAACAAGGAGGTTGG - Intronic
1157080509 18:44519867-44519889 CTGGGCAAAGAAAATGAGCACGG + Intergenic
1157439131 18:47696878-47696900 CAGGGCAAAGAGGAGGGGGTGGG - Intergenic
1158082893 18:53615422-53615444 CATGGCTAATACAGGGAGGAAGG - Intergenic
1158195825 18:54883947-54883969 CTGGGCACAGACAAGAAAGATGG + Intronic
1158336050 18:56415935-56415957 CGGAGCAAAGAGCAGGAGGACGG - Intergenic
1158852035 18:61504215-61504237 AAGGGCAGAGACTAGGAGCAGGG + Intronic
1159478907 18:68961043-68961065 TGGGGCAAAGACATGGAAGAAGG - Intronic
1159779165 18:72641653-72641675 CAGGGCAAGGACATGAAGAATGG - Intergenic
1159833956 18:73313324-73313346 CATAGAAAAGACAAGGAAGATGG - Intergenic
1160475111 18:79177164-79177186 GGGGGCAAGGACAGGGAGGAAGG - Intronic
1160875438 19:1294432-1294454 CAGGGCAAAGGCCTGGAGGCAGG + Intronic
1161737942 19:6002951-6002973 CAGGGACAACACAGGGAGGAGGG + Intronic
1161761040 19:6173035-6173057 CTGGGAAAAGACATGGAGAAGGG - Intronic
1162343337 19:10105602-10105624 CAGGGGGAAGACGAGGGGGAGGG + Intergenic
1162737522 19:12754816-12754838 CCGGGCAAGGACCAGGTGGAGGG + Intronic
1164587441 19:29484866-29484888 CAGGGAAAAGAAAAGGGGGCTGG - Intergenic
1164713626 19:30376288-30376310 CAGGGCAAAGACACAGATGGAGG - Intronic
1165343004 19:35225571-35225593 AGAGGCAAAGGCAAGGAGGATGG + Intronic
1165439479 19:35816445-35816467 CAGTGAAAAGACAAAGAGGGAGG - Intergenic
1165497276 19:36160506-36160528 CGGAGCAAAGAGCAGGAGGACGG + Intergenic
1165510615 19:36264719-36264741 CGGAGCAAAGAGCAGGAGGATGG + Intergenic
1166363642 19:42267850-42267872 CAGGGCGAATACAAAGTGGAGGG + Intergenic
1167046877 19:47054903-47054925 CAGAGCAAAGAGCAGGAGGATGG + Intergenic
1167109819 19:47453452-47453474 TAGGCCAAAGACTGGGAGGAAGG - Intronic
1167785172 19:51630114-51630136 CAGGGGTAAGAGAAGGAGCAGGG + Intronic
1167787271 19:51646538-51646560 CAGGGGTAAGAGAAGGAGCAGGG + Exonic
1167896842 19:52588575-52588597 AAGGGCAAAGAAAAGGAGCCAGG + Intergenic
1168663732 19:58186643-58186665 CAAGGCAGAAACAAGGAGAAGGG + Intronic
1202715503 1_KI270714v1_random:40165-40187 CTGGGCAAAGACTTGCAGGAAGG + Intergenic
925637112 2:5951165-5951187 CTGGGGAGAGAGAAGGAGGAAGG - Intergenic
925901579 2:8512974-8512996 CAGGGCAAGGGCAGGGAGGGTGG - Intergenic
926407446 2:12570159-12570181 CAGAGCAAAGGGCAGGAGGAAGG - Intergenic
926991138 2:18681645-18681667 CAGGGCAGAGCAAAGGAGGTAGG + Intergenic
927001736 2:18802594-18802616 CAGGGGAAAGAAAAGGATAATGG + Intergenic
927468242 2:23352527-23352549 AAGGGGAAAGAGAGGGAGGATGG + Intergenic
927810855 2:26179566-26179588 GAGGGCAAGGACAAGGAGGAGGG + Intronic
928318242 2:30262691-30262713 GAGGGGAAAGGCAAGGAGAAGGG + Intronic
928613731 2:33016181-33016203 CTGTGCAGAGACAAGGAGGTGGG + Intronic
929392101 2:41481622-41481644 CAGGGGAAAGAGAATGAGGCAGG + Intergenic
929606936 2:43240969-43240991 AAGGGCACAGACAGGGACGAGGG - Intronic
930049738 2:47205752-47205774 CAGGGCAAAGGCGGAGAGGAGGG + Intergenic
930241552 2:48940887-48940909 CAAGGGAAAGAAGAGGAGGAGGG - Intergenic
931722487 2:65077429-65077451 CAGAGCAAAGACATGGAGGGAGG + Intronic
932411073 2:71548203-71548225 CAGGGCAAAGACAGCAAGGAGGG - Intronic
932734405 2:74244495-74244517 AAGGGGAAAGAAAAGAAGGAAGG - Intronic
932974266 2:76579180-76579202 CGGAGCAAAGAACAGGAGGACGG + Intergenic
933161119 2:79026213-79026235 CAGAGCCAAGAAAAGGAGGAAGG + Intronic
933552653 2:83793999-83794021 CAGAGCAAAGAACAGGAGGATGG + Intergenic
933730920 2:85455805-85455827 CAGGGGACAGACAAGCAGGAAGG + Intergenic
933895373 2:86806437-86806459 CAGGCCAAGGACAAGGAGGAAGG - Intronic
934737274 2:96695912-96695934 CTGGGGAAAGGCACGGAGGAAGG - Intergenic
934767268 2:96886654-96886676 CCTGGCAAAGACAGGGAAGAAGG + Intronic
935580347 2:104750739-104750761 CAGGGTGAAGACAGGGAGGTGGG - Intergenic
937264484 2:120607292-120607314 CAGGGCATAGAGCAGGAGGATGG + Intergenic
937825380 2:126363538-126363560 CATGGCAGAGGCAGGGAGGAAGG - Intergenic
938099708 2:128490439-128490461 CAGGCAAAGGAGAAGGAGGAAGG + Intergenic
938308145 2:130268333-130268355 CAGGGAAGTGAAAAGGAGGAGGG - Intergenic
938447186 2:131388503-131388525 CAGGGAAGTGAAAAGGAGGAGGG + Intergenic
939307254 2:140427339-140427361 AAGGGTAAAGACACGGAGAAGGG - Intronic
939589875 2:144051808-144051830 AAGGGCAAAGAAAAGGCGGAGGG + Intronic
939771593 2:146326719-146326741 GAGAGGAAAGACATGGAGGAGGG + Intergenic
940865961 2:158817978-158818000 AAAGGCCATGACAAGGAGGAGGG + Intronic
940919840 2:159294555-159294577 CAGGGCACAGACAAGCAAAAAGG - Intergenic
941318690 2:164027324-164027346 CAGGATGAAGAAAAGGAGGATGG + Intergenic
941336739 2:164254975-164254997 CTGGGCAAACTCAAGGAGGTAGG + Intergenic
942103332 2:172607762-172607784 CAGGGGAAGGAAAAGGAGCAGGG + Intronic
943441630 2:187933593-187933615 CATGGCATAGACAAGGACTAGGG - Intergenic
944094058 2:195946726-195946748 CCGGGTGAAGAGAAGGAGGAAGG - Intronic
945143761 2:206715065-206715087 CTGGGCAAAGGCATGGAGGATGG + Intronic
945923064 2:215776139-215776161 CAGGGCAGATTAAAGGAGGAAGG + Intergenic
946076128 2:217075181-217075203 CAGGGTAGAGAAAAGCAGGAAGG - Intergenic
946422668 2:219573513-219573535 GAGGGGGAAGAGAAGGAGGAGGG - Intronic
946451118 2:219780309-219780331 CAGGGCAAATATCAGGAGAAAGG + Intergenic
946858316 2:223975676-223975698 GAGGGAAAAAACAAGCAGGATGG - Exonic
946876842 2:224138004-224138026 GAGGGCAAAGAGAAGGAAGAGGG - Intergenic
947082030 2:226409700-226409722 GAAGGCAAAGAGAAGGAGGCAGG + Intergenic
947248341 2:228074976-228074998 GAGGAAAAAGAGAAGGAGGAAGG + Intronic
947321826 2:228927601-228927623 TATGGGAAAGAAAAGGAGGAAGG + Intronic
947351675 2:229252870-229252892 TAGAGAAAAGACAAGGAGGTGGG + Intronic
947584447 2:231344986-231345008 CACGGGGAAGACAAGGCGGAAGG + Exonic
947678304 2:232005642-232005664 CAGGGTAAACAAAGGGAGGAAGG - Intronic
947874195 2:233457718-233457740 CAGGGCAGGCACATGGAGGATGG + Intronic
948087714 2:235265480-235265502 CAGGGTGAAGACAGGGAGGCTGG - Intergenic
948109532 2:235443682-235443704 CAGGGGAGGGACAAGAAGGAGGG - Intergenic
948209595 2:236183052-236183074 AAGGAGGAAGACAAGGAGGAGGG - Intergenic
948336402 2:237210817-237210839 AAGGGCAAGGACATGGAGGAAGG + Intergenic
948462515 2:238137200-238137222 CAGGGGAAAGAGCAGGAGCAGGG + Intergenic
948599779 2:239101613-239101635 CAGGGCAAAGGCACAGAAGATGG + Intronic
948618406 2:239216676-239216698 CAGGGCAGAGTGAAGGCGGAGGG - Intronic
948881644 2:240860798-240860820 CAGAACAAGGACAAGGATGAGGG + Intergenic
948952458 2:241263072-241263094 CAGCCGAAAGACAAGGAGAAAGG + Intronic
1169087736 20:2837882-2837904 GAGTGGAAAGACAGGGAGGAAGG - Intronic
1169217067 20:3800178-3800200 AAGGGCAAAGACAAGGGCCAAGG - Intronic
1169289042 20:4332942-4332964 CAGGCCAGAGACAAGGATTAGGG + Intergenic
1169827640 20:9787334-9787356 CAGTGCAAAGACCTGGAGGTGGG - Intronic
1169945695 20:10985685-10985707 CAGGGAAAAGAAATAGAGGACGG - Intergenic
1170069146 20:12345434-12345456 CGGAGCAAAGAGCAGGAGGATGG + Intergenic
1170165583 20:13358382-13358404 CGGAGCAAAGAGCAGGAGGACGG - Intergenic
1171304269 20:24091899-24091921 CAGGGAAAGGAGAGGGAGGAGGG - Intergenic
1171362729 20:24600466-24600488 AAGGGCAGCGATAAGGAGGAAGG - Intronic
1171408189 20:24928065-24928087 CAGGCCCCAGACAAGGAGGATGG + Intergenic
1172306219 20:33882583-33882605 TAGGGCAGAGACAAGGAGGTGGG - Intergenic
1172839361 20:37892879-37892901 CAGGGCACAGACAAGTAACATGG + Intergenic
1173410437 20:42804780-42804802 GAAGGCAGAGATAAGGAGGAGGG - Intronic
1174095690 20:48087940-48087962 CAGGGCTGAGAGATGGAGGAGGG - Intergenic
1175128995 20:56775112-56775134 CAGGAGAAAGAGAAGGGGGAGGG - Intergenic
1175402541 20:58708720-58708742 CTGGGCAGAGGCAAGGAGGAGGG - Intronic
1175550050 20:59811640-59811662 CAGGGCAAAGACAGGGGGGTTGG + Intronic
1175746803 20:61462700-61462722 CAGGCCAATGACAAGGATGGAGG - Intronic
1176866494 21:14057423-14057445 CAGGGCCAGGACAGGCAGGATGG + Intergenic
1177091826 21:16779001-16779023 CAGCATAAAGTCAAGGAGGAAGG + Intergenic
1177402699 21:20626077-20626099 CAAGGAAAAGACAAAGAGGAAGG + Intergenic
1178156182 21:29856803-29856825 CAGCACAAAGAACAGGAGGATGG + Intronic
1178749219 21:35284498-35284520 CAGGGCAAAGACCCTGAGGTGGG - Intronic
1179400397 21:41077451-41077473 CATTGCAAAGCCAAGGAGGGGGG - Intergenic
1179409781 21:41153798-41153820 CTGGGCCAAGGCAGGGAGGAAGG + Intergenic
1180560608 22:16611797-16611819 CGGAGCAAAGAGCAGGAGGACGG - Intergenic
1181103222 22:20555352-20555374 CAGGGCTAGGAGGAGGAGGAGGG - Intronic
1181313868 22:21959842-21959864 TAGGGCAGAGGCCAGGAGGACGG - Intronic
1181409852 22:22711214-22711236 CAGAGCAAAGGCAGGGAGGTGGG - Intergenic
1181513888 22:23400852-23400874 CAGGGCAACCACAGGGAGGAGGG + Intergenic
1181660200 22:24341167-24341189 CAGGGCAGATACTGGGAGGAGGG + Intronic
1181718329 22:24752333-24752355 CATGGCAGGGACAAGGAGAAGGG - Intronic
1182603379 22:31484942-31484964 CAGTACATAGACAAGGAAGAAGG + Intronic
1183718929 22:39550937-39550959 CAGAGAAACGCCAAGGAGGAAGG + Intergenic
1184031376 22:41896855-41896877 CAGCCCAGAGACACGGAGGAAGG + Intronic
1184225846 22:43128477-43128499 CAGGCTATAGACAAAGAGGATGG - Exonic
1184449718 22:44575775-44575797 AAGGGGAAAGAAGAGGAGGAGGG + Intergenic
1184610342 22:45599273-45599295 CAGGGCAGTCAAAAGGAGGATGG - Intronic
1184916887 22:47575427-47575449 CAAGGGAAGGACAGGGAGGAGGG - Intergenic
1185105968 22:48870055-48870077 CAGGGCAGAGAGAAGGGGAATGG - Intergenic
1185330907 22:50251634-50251656 CAGGGCAAAGGCCACGAGGCGGG + Intronic
1203231036 22_KI270731v1_random:110659-110681 CAGGGCATCGCCAACGAGGACGG - Intergenic
1203231133 22_KI270731v1_random:111037-111059 CAGGGCATCGCCAACGAGGACGG - Intergenic
1203231146 22_KI270731v1_random:111091-111113 CAGGGCATCGCCAACGAGGACGG - Intergenic
949166311 3:945700-945722 CAGAGCAAAGACAAGAATGCTGG + Intergenic
949483740 3:4518160-4518182 CTGTGCACAGTCAAGGAGGAGGG - Intronic
949838756 3:8297637-8297659 CATGGCAAAGAGAGGGAGGGGGG + Intergenic
949991453 3:9582695-9582717 CAGGACAAAGACAAACAAGAAGG + Intergenic
950387461 3:12671351-12671373 CAGGGCAAAGTCATGGAACAGGG + Intergenic
950399702 3:12760457-12760479 CAGGGCAAAGGCCCTGAGGAGGG - Intronic
950475441 3:13211722-13211744 CAGGGCAAAGGCCTGGAGGCTGG - Intergenic
950723738 3:14902389-14902411 CTGGGCAAAGACATGGAGGTTGG + Intronic
950921351 3:16697846-16697868 CAGGGGGAAGAAAAGGAGGCAGG + Intergenic
951881178 3:27483380-27483402 CAGGCCAAGTAGAAGGAGGAGGG - Intronic
952845040 3:37681245-37681267 CAGAGCATAGACAAGAAGGCTGG + Intronic
953443128 3:42936760-42936782 CGGGTCAAAGACAAGGGGGCTGG - Intronic
953784046 3:45897098-45897120 CAGGACACAGACAGGCAGGATGG + Intronic
954085423 3:48240360-48240382 CAGGGCAAAGAAAAGGACGGCGG + Intergenic
954382954 3:50229314-50229336 AAGGACAAAGAAAAGGAGGGAGG + Intronic
954453168 3:50582631-50582653 GAGGGCAGACACAGGGAGGAAGG + Exonic
954856216 3:53646095-53646117 GACGGCAAAGACATGGAGGTGGG + Intronic
954886314 3:53877382-53877404 CAAGGCCTAGAAAAGGAGGAGGG + Exonic
955033862 3:55247612-55247634 CAAGGTAAAGAGAAGGAGAAAGG - Intergenic
955896440 3:63705697-63705719 GTGAGCAAAGGCAAGGAGGAAGG + Intergenic
956050710 3:65245285-65245307 CAAAGCAAAGACAAGGAAGTTGG + Intergenic
957733602 3:84177521-84177543 GAGGGCAGAGAGTAGGAGGAAGG + Intergenic
957957142 3:87202049-87202071 CAGGGAAAAGCCACTGAGGAGGG + Intergenic
958056179 3:88415385-88415407 CAGGGTTAAAACAATGAGGATGG + Intergenic
958144712 3:89609268-89609290 CACGTCAAAGACAGAGAGGATGG + Intergenic
958648325 3:96902117-96902139 CATGGAAAGGACAAGGACGATGG + Intronic
958675660 3:97265529-97265551 CAGAGCAAGGACCAGGAGTAGGG + Intronic
958709571 3:97700963-97700985 CAGGCCAAAGTCCAGGAGGCAGG + Intronic
958914341 3:100031707-100031729 GAAGGCAAAGACAGGGAGGGAGG + Intronic
959140197 3:102476825-102476847 CAGGGCATGGACAAGCAGAATGG + Intronic
959667833 3:108941516-108941538 CAGGGGAATGAAATGGAGGAGGG - Intronic
959833662 3:110893272-110893294 AAGGACAAAAAGAAGGAGGAAGG - Exonic
959972563 3:112422840-112422862 CGGAGCAAAGAGCAGGAGGACGG + Intergenic
960714995 3:120566317-120566339 CAGGAGAAAGGCAAGAAGGAAGG + Intergenic
960884111 3:122376810-122376832 AAGGGCAAGGGTAAGGAGGAAGG + Intronic
960942027 3:122941164-122941186 CAGGCAGAAGAAAAGGAGGAAGG + Intronic
960972372 3:123149069-123149091 GAGGACAAAGACAGGGAGGAAGG + Intronic
961153443 3:124659042-124659064 CAGGGCAAAGGCAGGGAAAAGGG - Intronic
961730292 3:128960301-128960323 CGGAGCAAAGAGCAGGAGGACGG - Intronic
961788021 3:129359131-129359153 CAGGGCAAAGGCCCGGAGGCTGG + Intergenic
961919062 3:130407144-130407166 CAAGGCAAAGATGTGGAGGAAGG + Intronic
962188080 3:133281198-133281220 CAGGGCAAAAAAAGAGAGGATGG + Intronic
962800839 3:138889255-138889277 CATGGCAAAGAGGATGAGGAAGG + Intergenic
963255421 3:143139976-143139998 AGCGGAAAAGACAAGGAGGAAGG - Intergenic
963602192 3:147388350-147388372 GAGGGGAAAGAAAAGGAGAAAGG - Exonic
965716144 3:171605259-171605281 CAGTGAAAAGAAACGGAGGAGGG + Intronic
967808111 3:193732807-193732829 AAGGTGAAAGACAAGCAGGATGG - Intergenic
968653674 4:1769767-1769789 CAGGGATGAGACAAGGAGGCAGG - Intergenic
969119753 4:4899491-4899513 CAGGGCCAAGGCACAGAGGAAGG - Intergenic
969489485 4:7490994-7491016 CAGGGCAGGGACAGAGAGGAGGG - Intronic
969675159 4:8610425-8610447 CAGGGCAAGGGCAGGGAGGAGGG + Intronic
970099144 4:12501336-12501358 GAAGGCAAAGAAAAGGAGAAGGG + Intergenic
971180275 4:24323767-24323789 CAGAGCAAAGAGCAGGAGGATGG - Intergenic
971199826 4:24501477-24501499 CGGAGCAAAGAGCAGGAGGACGG - Intergenic
971454980 4:26835708-26835730 CAGGGCAAAGAATAGGGTGAAGG - Intergenic
971483411 4:27134705-27134727 AAAGACAAAGACAAGGAGGCCGG + Intergenic
972665242 4:41158935-41158957 CAGGTCATAGACTAGGAGGCAGG - Intronic
973013281 4:45104360-45104382 AAAAGCAATGACAAGGAGGATGG + Intergenic
973669365 4:53199908-53199930 CATGGCAGAGAGAAGGAGGGAGG + Intronic
974026466 4:56737459-56737481 AAGGCCACAGACAAGGAAGAAGG - Intergenic
974359980 4:60865053-60865075 CAGGGAAAGGACAAGAAGAAGGG - Intergenic
975940962 4:79645111-79645133 GACTGCAAAGAAAAGGAGGATGG + Intergenic
976870579 4:89788498-89788520 CATGGCAAGAACAAGGGGGAAGG + Intronic
976941559 4:90707760-90707782 GAGTGCAAATACAAGGAGGTAGG + Intronic
977041710 4:92026292-92026314 CGGAGCAAAGAGCAGGAGGACGG - Intergenic
978001411 4:103558969-103558991 CAGAGCAAAGTGTAGGAGGACGG + Intergenic
978102337 4:104857551-104857573 CAGGGGAAAGATAAGGGGGTGGG + Intergenic
978224303 4:106315953-106315975 AAGCACAAAGACAAGGGGGATGG + Intronic
978999867 4:115203143-115203165 GAGGGCAAAGAGAAGAGGGAAGG - Intergenic
980312216 4:131145783-131145805 CAGGGCAAAGAGTGGGAGGGGGG + Intergenic
980533694 4:134087797-134087819 GAGGGAAAAGGCCAGGAGGAAGG - Intergenic
980575925 4:134683072-134683094 CAGAGCAAAGAGCAGGAGGACGG + Intergenic
980698652 4:136394932-136394954 CAAGCCAAAGAAAAGGAGGGTGG + Intergenic
981157070 4:141450820-141450842 CAGGACAAAGAAGAGGAGGAAGG - Intergenic
981242329 4:142492708-142492730 CAAAGCATAGAAAAGGAGGAAGG + Intronic
981604646 4:146528445-146528467 GAGGTCCCAGACAAGGAGGAAGG + Intergenic
982174048 4:152688740-152688762 CAGGGCACGGAGGAGGAGGAGGG + Intronic
982430499 4:155316394-155316416 CAGTGGAAAGACAGGGTGGAAGG + Intergenic
982529664 4:156523295-156523317 CAGGTCAAAGACAATGAAGCAGG - Intergenic
983360086 4:166716627-166716649 CGGAGCAAAGAACAGGAGGACGG - Intergenic
983495973 4:168442572-168442594 CAGGGCACAGACAAAGAAAAAGG + Intronic
983659288 4:170116889-170116911 CAGAACAAAGAGTAGGAGGACGG - Intergenic
984703495 4:182833193-182833215 GAGGGGAGAGAGAAGGAGGAGGG - Intergenic
984858669 4:184217778-184217800 CAGGGCAAGGGCCAGCAGGAGGG + Exonic
984944878 4:184963025-184963047 CAGGGAAAACTGAAGGAGGATGG - Intergenic
985231799 4:187826804-187826826 CAGGGCAGAGCCACGGAGGGGGG - Intergenic
985825995 5:2192055-2192077 CAGGGCAGAGGCCAGGTGGAAGG - Intergenic
985988930 5:3539166-3539188 CAGGGCAAGGGCAAGGACAAGGG - Intergenic
986303222 5:6495056-6495078 CTGGGCAAAGGGAAGGAGAAGGG + Intergenic
986919895 5:12667810-12667832 CAGAGCAAAGAACAGGAGGACGG + Intergenic
987747965 5:22001631-22001653 GAGGGCAGAGGGAAGGAGGAGGG - Intronic
988232057 5:28492026-28492048 CAGGGCAAAAGGTAGGAGGAGGG + Intergenic
988874037 5:35424267-35424289 CAGGGCCAAAAGAAAGAGGAAGG - Intergenic
989677866 5:43993495-43993517 CAGGTCAAGGACAAGGGTGAAGG - Intergenic
989795929 5:45472494-45472516 AAGGGGAAAGACAAGATGGAGGG + Intronic
989844540 5:46124651-46124673 CAAGGTAAAAACAAGAAGGAAGG - Intergenic
990822527 5:59858426-59858448 GAGGGCAAAGACAAGCAGTGGGG - Intronic
990846735 5:60148943-60148965 CAGGGCAAAGTAAAGGGAGATGG + Intronic
991768143 5:70011435-70011457 GAGGGCAGAGGGAAGGAGGAGGG - Intergenic
991847381 5:70886517-70886539 GAGGGCAGAGGGAAGGAGGAGGG - Intergenic
992109786 5:73482080-73482102 CTGGGCAATGACAAGGTGGCTGG + Intergenic
992180557 5:74193244-74193266 AAGGGAAAAGGCAAGGAGAAAGG + Intergenic
992962563 5:81971164-81971186 CAGGGCAAAGGGCTGGAGGAAGG - Intergenic
993060499 5:83032898-83032920 CAGGGCAAACTTAAGGAGTAGGG - Intergenic
993221112 5:85098330-85098352 AAAGGCAATGACAAAGAGGAGGG + Intergenic
993954456 5:94215365-94215387 CAGGGCAAAGAAAAGGCCAATGG + Intronic
994030526 5:95136530-95136552 CAGGGAAAATTCAAGGGGGAGGG + Intronic
994057456 5:95434348-95434370 CATGGAAAACACAAGAAGGAAGG - Intronic
994764222 5:103896585-103896607 CAGAGCAAAAACAAGGAGCTAGG - Intergenic
995337427 5:111016137-111016159 CATTCCAAAGGCAAGGAGGAAGG + Intergenic
996449765 5:123607583-123607605 CAGGGCAGGGAAGAGGAGGATGG + Intronic
996583293 5:125055784-125055806 CAGGGCAGAGACTAGGTTGAAGG + Intergenic
996635099 5:125679597-125679619 CATGTTAAAGACAAGGAGTATGG + Intergenic
996926716 5:128835691-128835713 CAGAGCAAAGGCAAGAAAGAGGG - Intronic
997423524 5:133787527-133787549 AAGAGCAAAGACAGGAAGGAAGG + Intergenic
997590669 5:135070224-135070246 CAGTCCAAAGACCAGGAGCAGGG - Intronic
997681096 5:135751232-135751254 CAGGCCCAGGAGAAGGAGGAGGG - Intergenic
998146667 5:139733196-139733218 CAGGTCCGAGGCAAGGAGGACGG + Intergenic
998199428 5:140107864-140107886 CAGGGGAAGGAGGAGGAGGAGGG + Intronic
998288264 5:140884593-140884615 CAGAACCCAGACAAGGAGGAAGG - Exonic
998809882 5:145955659-145955681 CAGGACAAAGACAGGGAGAGTGG - Intronic
999111428 5:149124912-149124934 CAGTGCAAAGACACAGAGGCGGG + Intergenic
999258185 5:150221559-150221581 CAGGGCAGAGAGGAGGAGGGAGG - Intronic
999477342 5:151912664-151912686 CAGAGCCAATAGAAGGAGGATGG + Intronic
1000332556 5:160217387-160217409 CAGAGAAAAGACAAGAAGAAGGG + Intronic
1001128407 5:169042073-169042095 CAGGGCATAGGCAAGGAAAATGG + Intronic
1001251947 5:170153348-170153370 CAGTGCTCAGAAAAGGAGGATGG - Intergenic
1001266432 5:170277840-170277862 AAGAGGAAAGAGAAGGAGGAAGG + Intronic
1001848772 5:174944541-174944563 CAGTAAAAAGACATGGAGGATGG + Intergenic
1002424630 5:179167862-179167884 CACGGCAGAGACAAGGACAAGGG - Intronic
1002950978 6:1810648-1810670 CAGGGAACAGACAGGGAGGAGGG + Intronic
1004091133 6:12503025-12503047 CTGGGCAAAGACTTGGAGGAAGG - Intergenic
1004291548 6:14372144-14372166 GAGGGCAGAGGCAAGGAGGCTGG + Intergenic
1004748668 6:18538573-18538595 CAAGGCAAAGAAAGGGAGGGAGG - Intergenic
1004855373 6:19744140-19744162 CAGGGCAAAGAAAAGTGGGTAGG + Intergenic
1004945601 6:20609326-20609348 GAGGGAAAAGAGAGGGAGGAGGG - Intronic
1005089200 6:22038549-22038571 GAAGAAAAAGACAAGGAGGAGGG - Intergenic
1005167729 6:22944301-22944323 CAGGAGAAAGAGAAGGAGGTGGG + Intergenic
1005677497 6:28170181-28170203 GAGTGCAAGGCCAAGGAGGATGG - Intergenic
1006200644 6:32286893-32286915 CAGGGCAAAGAGATAGAGAATGG + Intergenic
1006201890 6:32300838-32300860 CTGGGCAAAGAGAAGGGGGAAGG - Intronic
1006371924 6:33650146-33650168 AAGGGCAGAGAGAAGGAGGGTGG - Intronic
1006478348 6:34272511-34272533 CAGGGCCAAGGCTAGGGGGAGGG + Intergenic
1006789020 6:36686613-36686635 AAGGGAAAGGACAAGGGGGAGGG - Exonic
1007116886 6:39349225-39349247 CAAGGCCAAGACAAGGTGGAAGG + Intronic
1007220584 6:40275769-40275791 CAGGGTAAAGAAAGGGAGTAGGG - Intergenic
1007233926 6:40377093-40377115 CAGGAGAAAGAGAGGGAGGAGGG + Intergenic
1007491580 6:42227104-42227126 CAGAGCAAAGTCATGGAGGTTGG + Exonic
1007694843 6:43725511-43725533 CGTGGCAAACAGAAGGAGGAAGG - Intergenic
1007921920 6:45617947-45617969 CAGGGAAAAGAAAAAGGGGAGGG - Intronic
1008699311 6:54079815-54079837 CAGGACAAATACAGGGATGATGG - Intronic
1009362624 6:62834378-62834400 GAGGGTAAAGAATAGGAGGAAGG - Intergenic
1009938357 6:70260003-70260025 CAAGGCAAAGACAGGGAGGATGG - Intronic
1010079922 6:71848776-71848798 CCAGGCAGAGACAAGAAGGAAGG + Intergenic
1010244534 6:73651053-73651075 CAGGGAAAAGAAAAGGAGCGGGG + Intronic
1010827206 6:80487635-80487657 CGGAGCAAAGAGCAGGAGGACGG + Intergenic
1010880082 6:81156539-81156561 CAGGCCAATAACAAGTAGGAAGG + Intergenic
1011172602 6:84522500-84522522 CAGAGTAAAGACAAGAAGGGAGG + Intergenic
1012005174 6:93704924-93704946 CAGGGCAAAGGCAAGGCAGAGGG - Intergenic
1012140007 6:95614874-95614896 CAGGGAAAAGAGAAGGAGGAGGG - Intergenic
1012677281 6:102132553-102132575 CAGGACAGAGACATGGAGAAAGG + Intergenic
1012788530 6:103661567-103661589 CAGCAGAAAGAAAAGGAGGAAGG - Intergenic
1013054093 6:106566282-106566304 CAGAGCCAAGACAAGGAGTGAGG - Intronic
1013618247 6:111864729-111864751 CAAAGCAAAGGCAAGGAGGCAGG + Intronic
1013768887 6:113605049-113605071 GAGGGGCAAGAGAAGGAGGAAGG - Intergenic
1013891383 6:115032295-115032317 CGGAGCAAAGAGCAGGAGGACGG - Intergenic
1014530301 6:122551305-122551327 AAGTGCAAAGACAAAGAGAAAGG - Intronic
1014891269 6:126849326-126849348 CGGAGCAAAGAGCAGGAGGACGG - Intergenic
1015304956 6:131697106-131697128 AAGGGTAAAGAGAAGGAGGCAGG + Intronic
1015383401 6:132594933-132594955 CAGGCCAAAGGCAAAAAGGATGG + Intergenic
1015602302 6:134922304-134922326 CAAGGCAAAAACAATAAGGATGG - Intronic
1016154334 6:140784825-140784847 ATGGGAAAAGACAAGGGGGAAGG + Intergenic
1016518505 6:144923658-144923680 CGGAGCAAAGAGCAGGAGGATGG - Intergenic
1016650662 6:146455964-146455986 CAGAGCAAAGAGCAGGAGGACGG + Intergenic
1016832262 6:148445702-148445724 CAGGGCGAAGAGAGGGAAGAAGG + Intronic
1017052327 6:150405236-150405258 CAGGGCAAGGTCAAGGCTGAAGG - Intronic
1018432815 6:163736261-163736283 CAGGCCAAAGCCTAGAAGGAAGG - Intergenic
1018433876 6:163744256-163744278 CAGGGGAGAGGCAAGGAGGGAGG - Intergenic
1018789355 6:167134751-167134773 CAGGGAAAAGAGGAGGAAGATGG + Intronic
1018945493 6:168345080-168345102 CAGAGCTAAGACAAGCAGGTGGG + Intergenic
1018949576 6:168370533-168370555 CCGGGCACAGACAAGGAGAAGGG - Intergenic
1018949593 6:168370593-168370615 CCGGGCGCGGACAAGGAGGAGGG - Intergenic
1019317694 7:397411-397433 CAGCACAGAGCCAAGGAGGATGG + Intergenic
1019479785 7:1261224-1261246 CAGGGGACGGACAGGGAGGATGG + Intergenic
1019877878 7:3831071-3831093 GAGGGCACAAACAAGGGGGATGG + Intronic
1020256713 7:6506492-6506514 CAGGGCAGGGACACTGAGGATGG + Intronic
1020340149 7:7101315-7101337 CTGGTCAAAGACAAACAGGAAGG - Intergenic
1020740933 7:12017383-12017405 CATGGCAGAGGAAAGGAGGATGG + Intergenic
1021516635 7:21496080-21496102 TAGGGCATAAGCAAGGAGGAGGG + Intronic
1021675492 7:23076532-23076554 TAGGGGAAGGACAATGAGGAAGG + Intergenic
1021808849 7:24382998-24383020 CAGGGCAAGTACAAGGAAGCAGG + Intergenic
1021827661 7:24571718-24571740 CAAGGCAGAGACAAAGCGGAAGG - Intergenic
1022095337 7:27137246-27137268 CAGGGGAAAGAGCAGGAGAAAGG + Intronic
1022323151 7:29305803-29305825 GAGGAGAAAGACGAGGAGGAAGG - Intronic
1022468235 7:30665532-30665554 CAGGGCCAGGAAAAGCAGGAAGG + Exonic
1023122796 7:36926159-36926181 CAAGGCAAAGAGGTGGAGGAAGG + Intronic
1023272490 7:38479608-38479630 CAGTGCAAAGGAAAGGAGGTGGG + Intronic
1024178472 7:46864085-46864107 CAGGGCACAGTGAAGGTGGAGGG - Intergenic
1024634365 7:51275320-51275342 GAGGGAAAAAACCAGGAGGATGG - Intronic
1025599644 7:62979633-62979655 CAGGATAAAAACAAGAAGGAAGG + Intergenic
1026379010 7:69780526-69780548 TAGGGCAAAGAGGAGGAGGGCGG + Intronic
1026518311 7:71092410-71092432 GAGGGCAAAGGCTGGGAGGAGGG + Intergenic
1026688497 7:72532983-72533005 CAGTGGAAGGCCAAGGAGGAAGG - Intergenic
1026723731 7:72854874-72854896 CAGTGGAAGGCCAAGGAGGAAGG - Intergenic
1027542966 7:79491731-79491753 CAGTGTGAAGACAAGGAAGATGG - Intergenic
1028637115 7:93001675-93001697 CAAGGCAATGACAATAAGGATGG - Intergenic
1028638928 7:93021763-93021785 CAGGAAAAAGAGAAGGAGAAAGG + Intergenic
1028920949 7:96309554-96309576 CATGGCAAAGTAAAGGGGGAAGG - Intronic
1029254836 7:99262672-99262694 CATGGCAAGGGTAAGGAGGAAGG - Intergenic
1029551616 7:101239740-101239762 CAGGGAAAGGACAGCGAGGATGG + Exonic
1029875047 7:103741676-103741698 AAGGGAAAAGACAGGGAGGGAGG + Intronic
1030111636 7:106031689-106031711 TATGGAAAAGACAAGGAGCAAGG + Intronic
1030321989 7:108178977-108178999 CAGGGAAATGACAAAGAAGATGG - Intronic
1030742976 7:113131610-113131632 TAGGGTAGAGACAATGAGGATGG + Intergenic
1030751800 7:113238766-113238788 CGGAGCAAAGAGCAGGAGGACGG + Intergenic
1031790270 7:126093626-126093648 CATGGCAAGGACATGGTGGAAGG - Intergenic
1031853900 7:126899402-126899424 CAGGACAAAGGCATGGAGTAGGG - Intronic
1032436789 7:131907339-131907361 GAGGGCAAAGGGAAGGAGGGAGG + Intergenic
1032515715 7:132504641-132504663 CAGGGCAAGGCCCAGGAGGTTGG - Intronic
1032653412 7:133903068-133903090 CAGGGCAAAGGCCAGGAGGCAGG + Intronic
1033046487 7:137967098-137967120 CAGGGCAAAGAGGAGTGGGAAGG - Intronic
1033150864 7:138913962-138913984 GAGGGGACAGAAAAGGAGGAGGG + Intronic
1033454330 7:141488947-141488969 GAGGAGAAAGAGAAGGAGGAGGG + Intergenic
1033513676 7:142085426-142085448 CAGGGCTAATACAATGTGGATGG - Intronic
1033787759 7:144754437-144754459 CAGCTCATAGACAAGGAGGGAGG - Intronic
1033808317 7:144979396-144979418 TAAGGCATAGACAAAGAGGAAGG + Intergenic
1034240332 7:149605876-149605898 CAGGGAAAGGCTAAGGAGGAAGG - Intergenic
1034243918 7:149630322-149630344 CAGGGCAAGGTTAAGGAGGAAGG - Intergenic
1034451835 7:151141365-151141387 CATGGCATAGACAGGCAGGAAGG - Intronic
1034471806 7:151258744-151258766 CAGGGCAGAGAGAAGGTGGCGGG - Intronic
1034706565 7:153151107-153151129 AGGGGAAAAGACAAGGAGAAAGG - Intergenic
1034879549 7:154752859-154752881 CAAGGGAAAGACATGGTGGACGG + Intronic
1035046725 7:155972737-155972759 CAGGGAAGAGACAGGGAGGAAGG + Intergenic
1035521664 8:279479-279501 CAGGGCAGAGACAAACAGTACGG - Intergenic
1036390961 8:8324085-8324107 CAGGGCAAGCACAATGGGGAAGG + Intronic
1036639160 8:10571533-10571555 CAGAGCAAAGAGCAGGAGGACGG - Intergenic
1036906337 8:12711092-12711114 GAGGCCCCAGACAAGGAGGAAGG - Intergenic
1037611541 8:20480390-20480412 CAGATCAAAGGGAAGGAGGATGG + Intergenic
1037689435 8:21170186-21170208 GAGGGAAAAGGGAAGGAGGATGG - Intergenic
1038179828 8:25215560-25215582 GAGGGCACAGATAAGGAGAAAGG + Intronic
1038483747 8:27919182-27919204 GAGGGGAAAGAGGAGGAGGAGGG + Intronic
1038698938 8:29831479-29831501 CAGAGCAAAGACAGAGAAGATGG + Intergenic
1039278019 8:35954078-35954100 CAGGCCTCAGACAAGGATGAAGG + Intergenic
1040023851 8:42763939-42763961 CAGAGCAAAGTCTGGGAGGAAGG + Intronic
1040951488 8:52941669-52941691 AAAGGCAAAGAAAAGGAGTAGGG - Intergenic
1041275697 8:56155650-56155672 CAGGGTAGAGAAAAGGAGTAGGG + Intergenic
1042280590 8:67052187-67052209 CAGGGAAAAGGCAAGGTGTAGGG + Intronic
1042624845 8:70746909-70746931 AAGGGAGAAGACAGGGAGGAGGG - Intronic
1043097902 8:75999191-75999213 ATGGGGAAAGACAAGGTGGAAGG - Intergenic
1043267391 8:78283551-78283573 CAGGGCAAAGAATAGGAAGGAGG - Intergenic
1043617825 8:82149052-82149074 CATGTCAAAGACCAGGTGGAGGG + Intergenic
1044416776 8:91948477-91948499 CGGAGCAAAGAGCAGGAGGACGG - Intergenic
1044991335 8:97798826-97798848 CAGGGCAAGTACAAAGAGAAGGG + Intronic
1045079180 8:98605566-98605588 CAGGGCGAAGACAGAGAGGGAGG - Intronic
1045193726 8:99908760-99908782 CAGAGAGAAGAGAAGGAGGAGGG + Intergenic
1045644484 8:104286391-104286413 CGGAGCAAAGAGCAGGAGGACGG - Intergenic
1047509062 8:125502410-125502432 AAGAGCAAAGACATGGAGGCTGG - Intergenic
1047926285 8:129686091-129686113 CATGGCATAAACAAGGATGATGG + Intergenic
1048512826 8:135078079-135078101 GAGGGCAGAGAGAAGGAAGAGGG - Intergenic
1048525472 8:135198384-135198406 GAGGGAAAAGAAAAGAAGGAAGG + Intergenic
1048957692 8:139550261-139550283 GAGGCCCCAGACAAGGAGGAAGG - Intergenic
1049203551 8:141353050-141353072 CAGGGCAAGGACGTGGAGGTGGG - Intergenic
1049266881 8:141672325-141672347 CAGGGCAAGAGCAAGCAGGAAGG + Intergenic
1049899731 9:147750-147772 CAGGTCACAGACAAGGGGCACGG + Intronic
1050150196 9:2612279-2612301 CAGGGCATCTACAAGGAGGATGG - Intergenic
1050747374 9:8892036-8892058 CAGAGAAAAGAAAAGCAGGAAGG - Intronic
1050760601 9:9065387-9065409 CAGTGCATAGGCAAGGAGGCTGG + Intronic
1051097463 9:13483209-13483231 CATGGAAAAGAGGAGGAGGAAGG - Intergenic
1051251435 9:15162651-15162673 CAAAGGAAAGACAAGCAGGAAGG + Intergenic
1051749964 9:20330538-20330560 CAGTTCAAAGAGAAAGAGGAGGG + Intergenic
1051849596 9:21490973-21490995 CAGAGCAAAGAGCAGGAGGATGG + Intergenic
1052221797 9:26032944-26032966 CAGGGCAAAGAAATAGAGGCAGG - Intergenic
1053008752 9:34621584-34621606 GAGGGCAAAAACAAGCAGGAGGG + Intronic
1054737526 9:68770423-68770445 CAGGGTAAAAATAAGGATGAAGG + Intronic
1055151930 9:73011048-73011070 GAGGAGAAAGACAAGAAGGAAGG - Intronic
1055157155 9:73078373-73078395 CAGCTCAAAGACAATGAGCAGGG - Intronic
1055160081 9:73115727-73115749 CAGTGCAAAGACAAGAGAGAGGG - Intergenic
1055324155 9:75111249-75111271 CAGGGCAAAGGCAGAGAGAAGGG - Intronic
1055343447 9:75309351-75309373 GAGAGCAAAGAAAAGCAGGATGG - Intergenic
1056437571 9:86588514-86588536 CGGAGCAAAGAGCAGGAGGACGG + Intergenic
1056794459 9:89648062-89648084 CACAGCACAGACAAGGGGGAGGG - Intergenic
1057082267 9:92181643-92181665 CAGGGCTCAGACTAGGGGGAAGG + Intergenic
1057164694 9:92916436-92916458 CAGGGCTCAGACAAGCAGGAGGG + Intergenic
1057292462 9:93815355-93815377 CTGGGCACAGATAAGAAGGAGGG - Intergenic
1058596410 9:106620719-106620741 CAATGGAAAGACAAGAAGGAGGG + Intergenic
1058798091 9:108517891-108517913 CAGGGCAATGACATACAGGAGGG - Intergenic
1058915524 9:109560834-109560856 CAGAGCACAGGCAAGCAGGAGGG - Intergenic
1059421376 9:114194553-114194575 CATGGCAAAGGCAGGGAGGTGGG + Intronic
1059574285 9:115473684-115473706 CGGAGCAAAGAGCAGGAGGACGG - Intergenic
1060069929 9:120537363-120537385 GAGGGCAAGGGCAGGGAGGAGGG - Intronic
1060197993 9:121635607-121635629 CAGGGCAACCACAGGAAGGAGGG + Intronic
1060847261 9:126847351-126847373 CAGGTGAGAGACAATGAGGATGG - Intergenic
1060889943 9:127181738-127181760 CAGGCCAAAGAGATGGAGAAAGG - Intronic
1061898924 9:133663035-133663057 CAAGGGCCAGACAAGGAGGAGGG + Intergenic
1062261430 9:135665040-135665062 CAAGCCAATGACAAGGAGGGAGG + Intronic
1062484926 9:136769981-136770003 CAGGGCAAAGAGAGAGAGGAAGG - Intergenic
1062497923 9:136840361-136840383 AAGAGCAAGGACAAGGAGGAGGG + Exonic
1185858882 X:3559656-3559678 CGGAGCAAAGAGCAGGAGGACGG + Intergenic
1186470588 X:9818994-9819016 AAGGGCAAAGACAAGGAAAATGG - Intronic
1186535557 X:10343664-10343686 AAGGGCAAAGACTGGGAAGATGG + Intergenic
1186749723 X:12609168-12609190 CAATGTAAAGACAATGAGGATGG - Intronic
1186763004 X:12742628-12742650 CAGGGCAAAGTCATGGAACAGGG + Intergenic
1187131321 X:16506037-16506059 AAGTGAAAAGACAAGGAAGAAGG + Intergenic
1187204425 X:17168747-17168769 ACAGGCAAAGACAAGGAGAAAGG + Intergenic
1188107935 X:26165283-26165305 CAGGGCAAGGACAATGAGGAAGG + Intergenic
1188111329 X:26198540-26198562 CAGGGCGAGGACCATGAGGAAGG + Intergenic
1188332149 X:28887505-28887527 AAGGGAACAGACAAAGAGGAGGG - Intronic
1189038200 X:37514769-37514791 TAGGGTAGAGACAAGAAGGAGGG - Intronic
1189052927 X:37665336-37665358 AAGGGCAAAGACATGGAGGCAGG - Intronic
1189160354 X:38804017-38804039 CAGGGCAGAGCAGAGGAGGAGGG - Exonic
1189942420 X:46138480-46138502 CAGGACAAGGTCAAGGAGGCAGG - Intergenic
1190197597 X:48332840-48332862 CAGGGCATATACAAGGACTAGGG + Intergenic
1190341962 X:49303987-49304009 AGGGGCCAGGACAAGGAGGAAGG + Intronic
1190664340 X:52683254-52683276 CAGGGCATATACAAGGACTAGGG + Intronic
1190675082 X:52775168-52775190 CAGGGCATATACAAGGACTAGGG - Intronic
1191268452 X:58429515-58429537 CAGGATAAAAACAAGAAGGAAGG - Intergenic
1191269150 X:58440185-58440207 CAGGGTAAAAACTAGAAGGAAGG - Intergenic
1191731212 X:64337624-64337646 CAGGGCAAAAAGAAAGATGAGGG + Intronic
1192239930 X:69320871-69320893 CAGGGGAAAGACCTGGAGGCTGG - Intergenic
1192429698 X:71103617-71103639 AAAGGCAGAGACATGGAGGAGGG + Intergenic
1193956709 X:87872732-87872754 CAGGGCAAAAGAAAGGAGAAAGG - Intergenic
1194070981 X:89325918-89325940 CAGGGAAAAGGTAAAGAGGAAGG - Intergenic
1195068758 X:101260196-101260218 CAGGACAAAGCCATGGAGAAAGG - Intronic
1195248176 X:103015651-103015673 CATGACAACAACAAGGAGGATGG - Intergenic
1195469948 X:105219853-105219875 CAGGGCGAAGCCATGGAGCAGGG + Intronic
1195524366 X:105869482-105869504 AAGGGAAATGCCAAGGAGGAGGG - Intronic
1195681459 X:107550015-107550037 CAGGGAAAGGACAAGGAGACCGG - Intronic
1195803124 X:108734900-108734922 CAGGGCAAAGAAGATCAGGAAGG - Exonic
1196915649 X:120532501-120532523 AAGGGCAAAGACATTGAAGATGG - Exonic
1197064614 X:122222506-122222528 CGGAGCAAAGAGCAGGAGGACGG - Intergenic
1197714426 X:129696141-129696163 CAGGACAAAGGCCAGGAGCAAGG + Intergenic
1197765305 X:130056186-130056208 TCGGGGAAAGACAAGGAGGTGGG - Exonic
1198122487 X:133607809-133607831 GAGGGCAAAGTCAAAGAGGAAGG + Intronic
1198197050 X:134373510-134373532 GCGGGAGAAGACAAGGAGGATGG + Intronic
1198383379 X:136105077-136105099 AAAGGCAAGGAAAAGGAGGAAGG + Intergenic
1198409417 X:136350613-136350635 TAAGGCAAAGACAAGAAAGATGG - Intronic
1198871537 X:141180930-141180952 AAGGGGAAAGAAAATGAGGAAGG - Intergenic
1199417243 X:147599502-147599524 CAGGGCAGAGAGAGGGAGGGAGG - Intergenic
1200613210 Y:5348569-5348591 AAGGGCAAAGACACAGAGGCAGG - Intronic
1200725211 Y:6661659-6661681 CAGGGAAAAGGTAAAGAGGAAGG - Intergenic
1201925051 Y:19275095-19275117 CAGGGGAAAGACATGGGGGGAGG - Intergenic