ID: 919972949

View in Genome Browser
Species Human (GRCh38)
Location 1:202592383-202592405
Sequence CCACCCCTGCCTCCTCCCAT CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 616
Summary {0: 1, 1: 0, 2: 3, 3: 57, 4: 555}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
919972949_919972956 17 Left 919972949 1:202592383-202592405 CCGATGGGAGGAGGCAGGGGTGG 0: 1
1: 0
2: 3
3: 57
4: 555
Right 919972956 1:202592423-202592445 TTTACACGACATAAAATCAAAGG 0: 1
1: 0
2: 1
3: 12
4: 226

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
919972949 Original CRISPR CCACCCCTGCCTCCTCCCAT CGG (reversed) Exonic
900131657 1:1089775-1089797 CCTCCCCTGGCTGCTCCCACTGG + Intronic
900410096 1:2508476-2508498 CCCCTCCCGACTCCTCCCATGGG - Intergenic
900412672 1:2520026-2520048 CCGCGCGTGCCTCCTGCCATGGG - Intronic
900414960 1:2530621-2530643 CCTCCCCTGCCTCTCCCCAGCGG + Intergenic
900572575 1:3365796-3365818 CCACCCCAACCTCCTCCAAACGG - Intronic
900600843 1:3502085-3502107 CCCCCCGCGCCTCCTCACATGGG + Intronic
900637209 1:3671825-3671847 CCACCCCTCACTCCTTCCAGAGG - Intronic
900683061 1:3928467-3928489 CCACTCCTGGCTCCCCCAATGGG + Intergenic
900690298 1:3976795-3976817 CCTCCCCTGCCTCCTAACAGTGG - Intergenic
900978726 1:6034328-6034350 CCACCTTTGCCACCTCCCAGGGG - Intronic
900998340 1:6134726-6134748 CCACCCCTACCTCTTCCCTGTGG - Exonic
901703840 1:11059497-11059519 CCACCCCGGCCTCCACCCGGCGG - Intronic
901813722 1:11782130-11782152 TCACCCCAGCCTCTCCCCATGGG - Intronic
901961144 1:12827607-12827629 CCTCACCTGCCTCCTTCTATGGG - Exonic
901967739 1:12882212-12882234 CCTCACCTGCCTCCTTCTATGGG - Exonic
901975540 1:12941342-12941364 CCTCACCTGCCTCCTTCTATGGG - Exonic
901985878 1:13074860-13074882 CCTCACCTGCCTCCTTCTATGGG + Exonic
901995931 1:13151907-13151929 CCTCACCTGCCTCCTTCTATGGG - Intergenic
902009635 1:13260423-13260445 CCTCACCTGCCTCCTTCTATGGG + Exonic
902145187 1:14392731-14392753 CCACACCCGCCTCCGCCCAGGGG - Intergenic
902375687 1:16029013-16029035 CCTCCCCTGCCACTTCCCAGCGG - Intronic
902439752 1:16421649-16421671 CCACCCCAGCCTCATCCCCTTGG + Intronic
902458191 1:16551289-16551311 CCAAACCTGCCTCCTCTCAAAGG - Intergenic
902461069 1:16577284-16577306 GCCCCCCTGCCTGCCCCCATGGG + Intronic
902462630 1:16589866-16589888 GCTCCCCTGCCTGCCCCCATGGG + Intronic
902475497 1:16682304-16682326 CCAAACCTGCCTCCTCTCAAAGG - Intergenic
902493968 1:16856630-16856652 CCAAACCTGCCTCCTCTCAAAGG + Intronic
903151377 1:21412049-21412071 CCAAACCTGCCTCCTCTCAAAGG - Intergenic
903188114 1:21640767-21640789 CCACCCCTGCCTGCTCCTACAGG + Intronic
903218084 1:21854175-21854197 CCACACCTGGCTCCTCACCTGGG + Exonic
903670942 1:25034927-25034949 CTACCCCTGCCTCCCCCCATTGG + Intergenic
904410179 1:30320385-30320407 CCAGCCCTGCCACCGACCATGGG - Intergenic
904455734 1:30647004-30647026 CCACCCCTACCTGCTCCCCAAGG - Intergenic
905328631 1:37176211-37176233 ACTCTCCAGCCTCCTCCCATTGG - Intergenic
905354182 1:37369605-37369627 CCACCCCTGCCATCGCCCACTGG + Intergenic
905449249 1:38046499-38046521 CCGCCGCCGCCTCCTCCCGTGGG + Exonic
905449353 1:38046853-38046875 CCACCCCGCCCGCCGCCCATTGG + Intergenic
905734608 1:40316757-40316779 CCGCCCCCGCCGCCTCCCAGGGG - Intronic
907674552 1:56506580-56506602 CCTCCCCTGACCCCTCCCAGGGG + Intronic
908474255 1:64472115-64472137 CCACTCCTTCCACCTCCCACCGG + Intronic
909582046 1:77247539-77247561 CCACTTCTGCCCCATCCCATGGG + Intergenic
910944864 1:92579352-92579374 CCACACTGGCCTCCTTCCATTGG - Intronic
913407491 1:118511928-118511950 CCACCCCTGCCCCCTACCCCAGG + Intergenic
913611988 1:120517412-120517434 CCAAACCTGCCTCCTCTCAAAGG - Intergenic
913640453 1:120807720-120807742 GCCCCCCTGCCTGCCCCCATGGG - Intronic
913641226 1:120814004-120814026 GCCCCCCTGCCTGCCCCCATGGG - Intronic
914084189 1:144437912-144437934 GCCCCCCTGCCTGCCCCCATGGG + Intronic
914212062 1:145588904-145588926 GCCCCCCTGCCTGCCCCCATGGG + Intergenic
914277258 1:146136320-146136342 GCGCCCCTGCCTGCCCCCATGGG + Intronic
914364024 1:146962274-146962296 ACCCGCCTGCCTCCCCCCATGGG - Intronic
914364782 1:146968561-146968583 GCCCCCCTGCCTGCCCCCATGGG - Intronic
914486897 1:148118587-148118609 GCCCCCCTGCCTGCCCCCATGGG + Intronic
914538304 1:148587268-148587290 GCCCCCCTGCCTGCCCCCATGGG + Intronic
914579202 1:149004827-149004849 CCAAACCTGCCTCCTCTCAAAGG + Intronic
914587230 1:149073735-149073757 GCCCCCCTGCCTGCCCCCATGGG + Intronic
915824813 1:159064333-159064355 CCACCCTGGCCTCCTCCTAAAGG - Intronic
916285437 1:163100343-163100365 CCACCCCTGTCATCTCCCAGTGG + Intergenic
916360457 1:163962063-163962085 CCACCCCTCCCTCATCTCCTGGG + Intergenic
916552021 1:165858680-165858702 GCAACTCTCCCTCCTCCCATGGG - Intronic
916599119 1:166275696-166275718 CCTCCTCTTCTTCCTCCCATTGG + Intergenic
916728907 1:167549195-167549217 CAACCCCAGGCTCCTCCCGTAGG - Intronic
917217889 1:172696952-172696974 CCACCCCTGCCATTTCCCCTAGG + Intergenic
918468199 1:184843185-184843207 GAACCCCTTCCTCCTCCCTTCGG + Intronic
919951526 1:202368581-202368603 CCACCCCTTCATCCTCCCCCAGG + Intronic
919972949 1:202592383-202592405 CCACCCCTGCCTCCTCCCATCGG - Exonic
920281519 1:204847118-204847140 CCACCCATGTGTCCTCCCACTGG - Intronic
920713345 1:208316505-208316527 ACACCCCTTCCTCCTCTCCTTGG - Intergenic
920986848 1:210898655-210898677 CCACGCCTGCCCCCTCCAAGGGG - Intronic
921942216 1:220853889-220853911 CCTGCCCTGCCTCATCTCATAGG - Intergenic
922235084 1:223716635-223716657 ACACGCCTGCCTCCACCCAACGG - Intronic
922744747 1:228037621-228037643 CGACCCCTGACCCCCCCCATCGG + Intronic
923681721 1:236123990-236124012 CCTCCCCTGGGTCCTCACATGGG - Intergenic
924111284 1:240702422-240702444 CCACCCGTTACTCCTCCTATTGG - Intergenic
1062958879 10:1558217-1558239 CCACCTCTGCCCCCCTCCATGGG + Intronic
1063366917 10:5496601-5496623 ACACCCCAGCCTCCTCCCTCAGG - Intergenic
1063408815 10:5820774-5820796 CCACCCCTGCCCCCATCCTTCGG + Intronic
1063950840 10:11221958-11221980 CCCTTCCTGCCTCCTCCGATTGG - Intronic
1063952543 10:11237398-11237420 ACACTCCTGCCTCACCCCATAGG - Intronic
1064018345 10:11790166-11790188 CCACCCCTGCCTGCTCTGCTGGG + Intergenic
1064408971 10:15088845-15088867 CCGGCCCGGCCGCCTCCCATTGG + Intergenic
1066061058 10:31723989-31724011 CCACCTCTGCCTCCAACCCTAGG + Intergenic
1067047042 10:42990717-42990739 CCACCCCTGTCTCCTTCCTCTGG - Intergenic
1067433956 10:46264441-46264463 CCACCCCTGCCTCCTGGCCCAGG + Intergenic
1067439737 10:46301868-46301890 CCACCCCTGCCTCCTGGCCCAGG - Intronic
1068938608 10:62659027-62659049 CCACCTCTGCCTTATCACATTGG + Intronic
1069710297 10:70483560-70483582 CCACCCCTCTCCCCTCCCATGGG - Intronic
1070158840 10:73853320-73853342 CCACCCCTGCCCCATCCTGTCGG + Intronic
1071435091 10:85641533-85641555 CCACTCGTGCCTCTTCCCATGGG - Intronic
1071515027 10:86291491-86291513 CCAGCCCTGCCTCAGCCCAGGGG + Intronic
1071863583 10:89701441-89701463 CCACGCCTGCTTCCGCCCATTGG + Intergenic
1072706301 10:97683605-97683627 CCACCCCTGCCTCCACCAGGTGG - Intronic
1073141992 10:101254225-101254247 CCACCCCTCCCCCATCCCCTAGG - Intergenic
1074235553 10:111581288-111581310 CCACCCCTGCCATCGCCCAATGG - Intergenic
1074542882 10:114379972-114379994 CCGCCCCTGCCGCCTCACAAAGG - Intronic
1074713745 10:116199314-116199336 CCAAACCTGCCTCCTCCTCTGGG + Intronic
1074765531 10:116697303-116697325 CCACTCGTGTCTCCTCCCACAGG - Intronic
1075022151 10:118959870-118959892 CCACTCCTGTATCCTCTCATGGG - Intergenic
1076607721 10:131700344-131700366 CCACCTCTGCCTGCTCCCAGGGG + Intergenic
1076683054 10:132185207-132185229 CCACCCCTTCGTCCTCCTCTGGG - Intergenic
1076700654 10:132270995-132271017 TCACCCCTGGCTCCTCCCTTAGG - Intronic
1076755789 10:132570999-132571021 CCACCACAGCCTACTCCCGTGGG + Intronic
1076898142 10:133324451-133324473 CCACCCCAGCCCCCGACCATTGG - Intronic
1076992837 11:284636-284658 CCACCCCTGCCTCCACCTGAGGG - Exonic
1077204563 11:1336377-1336399 CCTCCCCTGCCCTCTCCCACCGG + Intergenic
1077315450 11:1917575-1917597 CCTGCCCTGCCTCCTCTCCTTGG + Intergenic
1077403215 11:2369131-2369153 CCACCCCTGGCCCACCCCATGGG + Intergenic
1077508129 11:2941533-2941555 CCACCCCTGCCTCCCACCTCAGG + Intergenic
1078518807 11:12047334-12047356 CCTCCCCTGCCTCTTCCCCAGGG + Intergenic
1078986959 11:16606627-16606649 CCACCTCCGCCTCCCCGCATTGG - Intronic
1079233457 11:18669940-18669962 CTTCCCCTCTCTCCTCCCATTGG - Intergenic
1079777818 11:24556174-24556196 CCACCCCTGCCATCTCACACAGG + Intronic
1080445181 11:32331700-32331722 CCACCCCTGCCTTTTCTCCTGGG - Intergenic
1080684832 11:34506332-34506354 CCTTCCCTGCCTCCTCCCTCTGG - Intronic
1081581723 11:44356697-44356719 GCATCCCTGCCTTCTCCCACTGG + Intergenic
1081651732 11:44828434-44828456 GCACCCCTTCATCCTCCTATAGG - Intronic
1082217339 11:49587910-49587932 CCACACTTTCCTCCTCCAATTGG + Intergenic
1083629417 11:64088061-64088083 CCTCCCCTGGCTCTTCCCATAGG + Intronic
1083789733 11:64976788-64976810 CAACCCCTACCACCTCCCTTTGG + Intergenic
1083889784 11:65589970-65589992 CCAGCCCAGCCTCCTCCCCTGGG - Exonic
1084045670 11:66566488-66566510 CCACCCCTACCTGCTCCCCGGGG - Intronic
1084112033 11:67020570-67020592 GCACCCCAGCATCCTCCCGTAGG + Intronic
1085276089 11:75301328-75301350 CCAGCCCAGCCTCTTCCCCTGGG - Intronic
1086246821 11:84762876-84762898 TTCACCCTGCCTCCTCCCATAGG - Intronic
1086632214 11:89036224-89036246 CCACGCTTTCCTCCTCCAATTGG - Intronic
1086834227 11:91601191-91601213 CCACCCCTGTCAGCTCCCAATGG + Intergenic
1087373908 11:97319592-97319614 CCACCCCTGCATTCTGGCATTGG - Intergenic
1088269498 11:108019189-108019211 CCACCCCCACCCCCACCCATCGG - Intronic
1088407509 11:109497866-109497888 CCACCCCTGCCATCACCCAATGG - Intergenic
1089080627 11:115773575-115773597 GCACCCATGCCTCCTTCCTTGGG - Intergenic
1089096969 11:115927410-115927432 CCTCCCTTGCCCCCTTCCATGGG + Intergenic
1089399402 11:118155816-118155838 CCACCCCTGCCCTCCCCCAAGGG - Intergenic
1090199324 11:124843154-124843176 CCAACCCCGCCTCCTCCCGCTGG + Intergenic
1090983579 11:131746025-131746047 ACACCCCTGCCTCCCCTCACAGG - Intronic
1091051854 11:132379552-132379574 CCACCCCTGTCATCTCCCAGTGG + Intergenic
1091296305 11:134476154-134476176 GCGCCCCTGCCTCCTCCAGTGGG - Intergenic
1091387614 12:104814-104836 CCTCTCCTGCCTCTTTCCATCGG + Intronic
1091634430 12:2186370-2186392 CCACCTCTGCATCCTCCTAGGGG + Intronic
1091750506 12:3018954-3018976 CCGCCCCTGCCGACTCCCCTGGG - Intronic
1094082156 12:26548716-26548738 GCAGCCCTGCCTCCACCCAAGGG + Intronic
1094426469 12:30321640-30321662 CCACACCATCCTCTTCCCATTGG + Intergenic
1094471671 12:30807308-30807330 CCATCCCTGCCTCAACCCAAGGG + Intergenic
1094544187 12:31389114-31389136 CAACCTCTGCCTCCTCCCTTGGG - Intronic
1096181704 12:49554740-49554762 CCACCCCTGCCAGCTCTCCTTGG + Intronic
1096518387 12:52170733-52170755 GCATCCCTTCCTCCTCCCATGGG - Exonic
1096532045 12:52248466-52248488 TCACCCCTGCCCCCCTCCATGGG - Intronic
1096669792 12:53191784-53191806 CCAGCCCTGATTCCTCCCACTGG - Exonic
1097194452 12:57235915-57235937 GTACCCCTGCCTCCTGCCCTGGG + Intronic
1097487011 12:60215479-60215501 CAATCCCTGCCTCAACCCATGGG - Intergenic
1097501416 12:60409177-60409199 CAACCCCTCCCTCAACCCATGGG + Intergenic
1098314831 12:69182244-69182266 CCACCCCTGTATGCTGCCATGGG - Intergenic
1099468905 12:83022285-83022307 CCTGCCCTGCCTACTCCCTTAGG + Intronic
1101994955 12:109518627-109518649 CCACCCCAGACTCTTCCCATGGG - Intronic
1102166270 12:110809242-110809264 CCACCCCTCCCTCCCCACATTGG - Intergenic
1102520996 12:113477325-113477347 CCACCCCTGCCGGGTCCCACAGG - Intergenic
1102702140 12:114848709-114848731 AGACCCCTGCCTTCTCACATGGG - Intergenic
1103533705 12:121620315-121620337 CCATCCCTGCCTCCTGCCCCAGG - Intergenic
1103700394 12:122846173-122846195 CAGCCCCTGCCTCCTGCCCTGGG + Intronic
1104160193 12:126171514-126171536 CCACCCTGCCCTCCTCCCCTTGG - Intergenic
1104195263 12:126531129-126531151 GCACCCCTGCCTTCTCTCTTTGG + Intergenic
1104768636 12:131346374-131346396 CCACCCCTTCCTGCTCACATGGG + Intergenic
1104811392 12:131622215-131622237 CCACCCCTTCCTGCTCACGTGGG - Intergenic
1105295472 13:19085366-19085388 CCACTCCTGACTCCAGCCATAGG + Intergenic
1105988256 13:25590845-25590867 CTCCCCCTGCCTCCTGCCCTTGG - Intronic
1106161289 13:27203396-27203418 CCACTCCTGCCTCCACCCCTCGG - Intergenic
1106465876 13:30014120-30014142 CCACCCCAGCCTCCTGGAATGGG + Intergenic
1106694032 13:32150984-32151006 CTGGCCCTGCCCCCTCCCATTGG - Intronic
1108144399 13:47461913-47461935 CCACCTCTGCCACATCCCTTAGG + Intergenic
1109483235 13:62984573-62984595 CCAGGCCTGACTCCTCCCATTGG + Intergenic
1110318273 13:74134543-74134565 CCACCCCTGCCCCCGCCCTCCGG + Intergenic
1111653653 13:91126052-91126074 CTACCCCTGCCTCCAGCCCTTGG + Intergenic
1113523011 13:110953910-110953932 GCACCCCCGCCTCCTGCCCTGGG + Intergenic
1113702358 13:112396899-112396921 GCACCCCCGCCTCCTGCCCTGGG - Intronic
1113755500 13:112808351-112808373 GCACCCCTGCCTCTGCCCAGAGG + Intronic
1114148741 14:20009710-20009732 CCTACCCTTCATCCTCCCATAGG - Intergenic
1114244580 14:20900685-20900707 CCACCACTGTGTCCTCACATAGG + Intergenic
1114266474 14:21075232-21075254 CTCCTCCTGCCCCCTCCCATAGG - Intronic
1114754369 14:25242727-25242749 CCCACCCTCCCTCCTCCAATAGG - Intergenic
1115529782 14:34316628-34316650 CCACCCCTTCCTCCACCTCTTGG + Intronic
1118304937 14:64647940-64647962 CCAACCCTGCCTCCTTCCAAAGG - Intergenic
1118844352 14:69535484-69535506 CCACCCCCGCCGTCTCCCAGAGG - Intergenic
1119542580 14:75450475-75450497 CCACCCGTGCCCCCAGCCATGGG + Intronic
1119622028 14:76138583-76138605 CCTCCCCTGCCCCCTCCCCAAGG + Intergenic
1119759734 14:77141836-77141858 CCACCCCTCCCTCCGCTCCTGGG + Intronic
1119910489 14:78345513-78345535 CTACACCTGCCTCTTCCCAAGGG + Intronic
1121619103 14:95333811-95333833 AGACCCCTGCCTTCTCCCCTGGG - Intergenic
1121743895 14:96273041-96273063 CCACCCCTGACTCCTCTCCCTGG + Intergenic
1122128045 14:99589844-99589866 ACACCCCTGCCTGCACCCAGGGG + Intronic
1122798101 14:104216460-104216482 CCACCCCTGCCAACTCCCCAGGG - Intergenic
1123135582 14:106025084-106025106 GCACAGCTGCCTCCTCCCACAGG + Intergenic
1202937549 14_KI270725v1_random:105177-105199 CCACCCCGGCGGCCTCCCAAAGG - Intergenic
1123694015 15:22863787-22863809 TCACCTCTGCCTTCTCCCTTGGG - Intronic
1124209695 15:27752823-27752845 CCACAGCTGCCTCCTCTCACTGG + Intergenic
1124414925 15:29466705-29466727 CCACCCCTGGGCCCTCCCCTGGG - Intronic
1124415051 15:29467010-29467032 CCACCCCTGGGCCCTCCCCTGGG - Intronic
1124552313 15:30693080-30693102 CCACCCCTGCCAGCTCCCACAGG - Intronic
1124678926 15:31712586-31712608 CCACCCCTGCCAGCTCCCACAGG + Intronic
1125535155 15:40438202-40438224 CCACCTCTTCCTCCTTCCTTCGG - Intergenic
1126457302 15:48877804-48877826 CCCCCCCTTCCTCTTCCCCTGGG - Intronic
1126585332 15:50280361-50280383 CCACCCCTCACCCCTTCCATTGG - Intronic
1127739822 15:61892102-61892124 CCACTCCTGGCTCAGCCCATGGG + Intronic
1128265704 15:66265122-66265144 CCTCCGCCTCCTCCTCCCATTGG + Intergenic
1128627254 15:69222315-69222337 CCACCCCTGCCTCCCACCCATGG - Intronic
1128728093 15:70002564-70002586 CCAGCCCTGCCTGCCCCCAGAGG - Intergenic
1129606094 15:77025695-77025717 CCACCCCTGCCGCCCTCCACTGG - Intronic
1129616655 15:77104257-77104279 CCACCCCTGGCTGCTCCACTGGG - Exonic
1129686536 15:77689276-77689298 CCCCCGGTGCCTCCTACCATAGG - Intronic
1129832178 15:78678112-78678134 CCAATCCTGCCTCTTCCCCTAGG + Intronic
1130821889 15:87504763-87504785 CCACCCCTGCTCCCTCGCAAGGG + Intergenic
1131459627 15:92609174-92609196 CTACACCTGGCTCCTCCCACTGG + Intergenic
1132196553 15:99918234-99918256 CTACCGCTGCCGTCTCCCATAGG - Intergenic
1132226950 15:100150301-100150323 CATCCCCTGCCTCCTCTCTTTGG + Intronic
1132357091 15:101179774-101179796 CCAACCCTGCCTCCGCCCCGTGG + Intronic
1132518105 16:375277-375299 CCGCCCCGGCCTCCTCTGATGGG - Intronic
1132581290 16:685855-685877 CCACCCCAGCCTACCCTCATTGG + Exonic
1132618631 16:854256-854278 CCATCCCACCCTCCTCCCAGAGG - Exonic
1134201078 16:12199525-12199547 CCACCCCTGCCCCCTCCTGTGGG + Intronic
1136060971 16:27726242-27726264 CCACCCCTGCCACCATCCATGGG + Intronic
1136251045 16:29005368-29005390 CCACCCCTGTCATCTCCCAACGG + Intergenic
1136373377 16:29849733-29849755 CCACCCTGGGCTCCTCCCCTTGG + Intergenic
1136549784 16:30976795-30976817 CCACCTCTGCCACCTCCCCAGGG - Intronic
1136628508 16:31476287-31476309 CCACCCCTACCCCTTCCCCTTGG + Intronic
1136987627 16:35125323-35125345 CTTCCTCTGCCTCTTCCCATGGG + Intergenic
1137811728 16:51359159-51359181 CCACCCCTGCGTTCTCCTTTCGG + Intergenic
1138347146 16:56326988-56327010 CCACCCCTGCCACTCACCATCGG + Intronic
1139216002 16:65124023-65124045 CCACTCCTGCCTCCCCCTGTGGG + Intronic
1139563288 16:67757269-67757291 CCACCCCTACCCGCTCCCTTTGG - Intronic
1139778956 16:69335020-69335042 CCACTGCTGCCCCCTGCCATGGG - Exonic
1141163497 16:81644850-81644872 CCTTGCCTACCTCCTCCCATGGG - Intronic
1141380187 16:83569257-83569279 CCTCCCCTCCCTCTCCCCATTGG + Intronic
1141624269 16:85253166-85253188 CTCCTCCTGCCTCCTCCCGTGGG - Intergenic
1141718105 16:85738692-85738714 CTACCCCTCACTCCTCCCATAGG - Intronic
1141763970 16:86046585-86046607 CCTCCCCTGCCACTTCCCACAGG - Intergenic
1141878504 16:86842445-86842467 TCACCCCTGCCTTCTCTCAGGGG - Intergenic
1141878513 16:86842478-86842500 TCACCCCTGCCTTCTCTCAGGGG - Intergenic
1141878522 16:86842511-86842533 TCACCCCTGCCTTCTCTCAGGGG - Intergenic
1141878530 16:86842543-86842565 TCACCCCTGCCTTCTCTCAGGGG - Intergenic
1142143141 16:88481428-88481450 CCACCGCTGCCTCCTCGCCGGGG + Intronic
1142290541 16:89192031-89192053 CCACCACTGCATCCTCCCGTGGG + Intronic
1143009729 17:3859416-3859438 CCACCGCGCCCACCTCCCATGGG - Intergenic
1143124308 17:4631844-4631866 CCACAGCTGCCTCCTTCCTTAGG + Intronic
1143632252 17:8146078-8146100 CCACCACTGGCTCCTTCCGTGGG + Exonic
1144737675 17:17564094-17564116 CCACCCATGCCTCCGCCCTGGGG - Intronic
1144770263 17:17755684-17755706 CCAGCCATGCTTTCTCCCATGGG + Intronic
1144830843 17:18130475-18130497 CCACTCCTGCCTCTGACCATTGG - Intronic
1144839900 17:18179432-18179454 CAACTCCTGCCTCCTCCCTCAGG - Exonic
1145905030 17:28511558-28511580 GTGCCCCTGCCTCCTCCCCTGGG - Intronic
1146507277 17:33416420-33416442 TCTTCTCTGCCTCCTCCCATGGG + Intronic
1146833519 17:36090561-36090583 ACAACCCTTCCTCCTCCCAGAGG + Intergenic
1146851039 17:36221832-36221854 CCACCCCTGTCACCGCCCAATGG + Intronic
1147357615 17:39910082-39910104 CCACCCCTACCTCCACCCCGAGG - Intronic
1147371436 17:39995574-39995596 CCACTCCTGCCTCCTGAGATTGG - Intronic
1147442781 17:40457590-40457612 CCACACCTCCCTACTCCCCTGGG + Exonic
1147443629 17:40462088-40462110 CTACCCCCGCCTCCTCTCCTGGG - Intergenic
1147566187 17:41537717-41537739 CCACCCCTGGCTGCTCCCTGTGG + Intergenic
1148209731 17:45800881-45800903 CCACCCCTCCCTCCCTCCAGTGG + Intronic
1148334559 17:46832647-46832669 CCAGCCCTGCCTCCACGCCTGGG + Intronic
1148342422 17:46881225-46881247 CCACCTCTGCCTCCCGCCCTGGG - Intronic
1148546385 17:48522324-48522346 CCTCCCCAGCCTCCTCCTGTTGG - Intergenic
1148575020 17:48704396-48704418 CCACCATGGCCTCCTCCCAGAGG + Intergenic
1149006849 17:51815103-51815125 CCACCCCCGCCTCCTGCCTGGGG + Intronic
1149655188 17:58306134-58306156 CATCCCCTGCCTCCCCCCATGGG - Intronic
1149846972 17:60014001-60014023 CCTCCCGTGGCTCCTACCATGGG + Intergenic
1150649624 17:67001362-67001384 CCACCCCTGTCCCCTCCCCCTGG + Intronic
1151656984 17:75500760-75500782 CCACCCCTACTTCCTCCCTGAGG + Exonic
1151715498 17:75829025-75829047 CCACCCCAGCCTCGGCACATGGG + Intronic
1151817209 17:76477194-76477216 CCTCCCCTGTCTCCCCCGATGGG - Exonic
1152093014 17:78257307-78257329 CCAGCCCTGCCTTGTCCCAGTGG + Intergenic
1152234055 17:79129431-79129453 CCACCCCTCCTTCCTCCCCTGGG - Intronic
1153184498 18:2471522-2471544 CCACCCCTGCCATCGCCCAAAGG + Intergenic
1154165141 18:12009046-12009068 CCACCCTTGCTTGCTCCCAGAGG + Intronic
1154172462 18:12061469-12061491 CCCAACCTGCCCCCTCCCATGGG - Intergenic
1156262488 18:35458547-35458569 CCACCACTGCCACCACCCACAGG - Intronic
1156290853 18:35747763-35747785 CCACCCCCGCCTCCACCCCATGG - Intergenic
1156377910 18:36531311-36531333 CCACCCCTGCTCCCTCCCGAGGG + Intronic
1157204810 18:45688990-45689012 CCATCCCTGCATACTCCCCTGGG + Intergenic
1157476613 18:48028020-48028042 CAACCCCTTCCTCCTCCCTCTGG - Exonic
1157964809 18:52195895-52195917 CCAATCCTGCCTTCTCCCAATGG + Intergenic
1157975519 18:52323079-52323101 CCACCCCTGGCTCTGCCCACAGG - Intergenic
1158142095 18:54266872-54266894 CCAGCCCTGCTTGCTCCCCTAGG + Intergenic
1158341786 18:56473829-56473851 CCACCCATTCCTCCTCCAATGGG + Intergenic
1158490671 18:57906965-57906987 CCTCCCCTCACTCCTCCCACAGG - Intergenic
1158505606 18:58044196-58044218 CCTCCTCCGCCTCCTCCCACCGG - Intergenic
1160749197 19:726046-726068 CCAGCTCTGCCTCTTCCCCTAGG - Intronic
1160786460 19:902130-902152 CCACCCCTGCCCCGGCCCACAGG - Exonic
1161035665 19:2083145-2083167 CCACCCCTGCCTGCTTCCCAAGG + Intronic
1161209232 19:3057571-3057593 CAACCCCGGCCACCTCCCCTGGG - Intronic
1161310257 19:3589956-3589978 GGACCCCTGCCTCCTCCCGTAGG - Intronic
1162030208 19:7914060-7914082 CCTCCCCTGCATCCAGCCATGGG + Exonic
1162036206 19:7941021-7941043 CCACCCCTCCCTCCTGCCAATGG + Intronic
1162818138 19:13208241-13208263 CCTCCCCTCCCTCCTCCCTGTGG - Intronic
1162959122 19:14115971-14115993 CCTCCCCAGCCCCCACCCATTGG + Intronic
1163630985 19:18417772-18417794 CCAGCCCCGCCTCCTCCCCGAGG - Intergenic
1164593695 19:29520030-29520052 ACCCCCATGTCTCCTCCCATGGG + Intergenic
1165435060 19:35790893-35790915 CCACCCCCACCTCCTCCCTGGGG + Intergenic
1165787267 19:38469226-38469248 CCATCCCTACCTCCTCCCCTCGG + Intronic
1166294717 19:41883306-41883328 CCCGCCCGGCCTCCTCCCCTCGG + Intronic
1166937709 19:46344788-46344810 CCTTCCCTGCCTGCTCCAATTGG + Intergenic
1168076492 19:53983020-53983042 CCTCCCCTGCCCCCTCCCTCGGG - Exonic
1168151313 19:54450238-54450260 CTACCCCTGCCTGCTTCCACGGG - Intronic
1168269297 19:55241079-55241101 CCAATCCTGTGTCCTCCCATAGG - Exonic
1202709733 1_KI270714v1_random:11358-11380 CCAAACCTGCCTCCTCTCAAAGG - Intergenic
925146664 2:1587191-1587213 CCACCCCTGGCCCCACCCACAGG + Intergenic
925564409 2:5234943-5234965 CAACCCCTGCCTCAACCCATAGG - Intergenic
925643193 2:6006918-6006940 CCACCCCTGCACCCTCCAACAGG + Intergenic
925878314 2:8330289-8330311 CCACACCTGCCTCCTCTTTTGGG - Intergenic
929294263 2:40228800-40228822 CCACCCCTGACACCTCACCTTGG - Intronic
929455331 2:42061122-42061144 CCACCCCGCCCTCCCACCATAGG + Intergenic
929755097 2:44757803-44757825 CCACCCCTGCCCCGACCCCTTGG + Intronic
930034308 2:47075976-47075998 CCTCCCATGCCTCCTCTCCTAGG - Exonic
930365682 2:50436376-50436398 CCACCACAGCCTCTGCCCATGGG - Intronic
930422432 2:51169793-51169815 CAAGCCCTGCCTCCTCCAAAAGG + Intergenic
931705328 2:64942202-64942224 CCTGCCCTGGCTCCTTCCATGGG + Intergenic
932468776 2:71940331-71940353 CCACCTCTGCCTCCACCCTATGG + Intergenic
932476466 2:72009354-72009376 CTGCCCCTGCCCCCACCCATTGG - Intergenic
933708581 2:85309092-85309114 ACAGCCCTGCCTCCTCCCACGGG + Exonic
933762738 2:85683912-85683934 CCACCCCTTCCTCCTTCCCTAGG - Intergenic
933944801 2:87276698-87276720 CCATCCCTGCCTACCCACATTGG + Intergenic
934540487 2:95170002-95170024 CCACCTCTGCCTCTTCCTACCGG - Intronic
934748272 2:96774147-96774169 CTTCCCCTGCCCCCTCCCACAGG - Intronic
934758977 2:96843087-96843109 ACACCCATGCTTCCTCCCACCGG + Intronic
935220070 2:101004595-101004617 TCACCCCTCCCTCCTCCACTGGG - Intronic
936142032 2:109948760-109948782 TCACCCCTGCCGCTTCCCACTGG + Intergenic
936178722 2:110246720-110246742 TCACCCCTGCCGCTTCCCACTGG + Intergenic
936202656 2:110422712-110422734 TCACCCCTGCCGCTTCCCACTGG - Intronic
936335409 2:111584881-111584903 CCATCCCTGCCTACCCACATTGG - Intergenic
936677104 2:114728227-114728249 CTCCTCCTGGCTCCTCCCATAGG - Intronic
937119364 2:119431444-119431466 CTGCGCCTGCCTCCTCCCTTCGG + Intronic
938227514 2:129628495-129628517 CCAGCCCTGCCTCCAGCCCTGGG - Intergenic
938258246 2:129877444-129877466 CCACCTCTGCCTGCTCCCTGGGG + Intergenic
938539578 2:132275079-132275101 CCACCCCACCCTCCACCCGTCGG - Intergenic
938689072 2:133770269-133770291 CCTCCTCTGCCTCCCTCCATTGG + Intergenic
942462610 2:176178645-176178667 CCAGCCCTGCCGCCTGCCCTCGG + Intergenic
942479512 2:176368891-176368913 CCACCCCTGCATCCCCCCTATGG + Intergenic
942939198 2:181597501-181597523 GCACCCCAGCTTCTTCCCATGGG - Intronic
943701864 2:190995835-190995857 CCACCCATCTCTCCTCACATAGG - Intronic
944391292 2:199222422-199222444 CCCACCCTTCATCCTCCCATAGG + Intergenic
946420560 2:219562298-219562320 CCACACCTCCCTCCTCCCCGGGG + Intronic
946519847 2:220452681-220452703 CCATCCCTGCCTGCTTCCTTAGG - Intergenic
946700883 2:222411916-222411938 CCATTCCTTCCTCCTCCCATGGG + Intergenic
947404504 2:229760809-229760831 CCACTCCTGCCCACTCCCATGGG + Intergenic
947651150 2:231787000-231787022 CCACCCCCACCTCCTAACATTGG + Intronic
948231350 2:236351659-236351681 CCACACCTGCCTGCTCCCCAAGG - Intronic
948683908 2:239658787-239658809 CCACCCCTCCCTCCACTCCTAGG + Intergenic
948683962 2:239658945-239658967 CCACCCCTCCCTCCACTCCTAGG + Intergenic
948684015 2:239659103-239659125 CCACCCCTCCCTCCACTCCTAGG + Intergenic
948684081 2:239659293-239659315 CCACCCCTCCCTCCACTCCTAGG + Intergenic
949042350 2:241855180-241855202 CCTCCCCTGCCTCCACCAACTGG + Intronic
1168892879 20:1306112-1306134 TCCCCCCTCCCTTCTCCCATGGG + Exonic
1169211361 20:3767785-3767807 ACGCCCCCGCCTCCGCCCATTGG + Intronic
1169219748 20:3815126-3815148 CACTCCCTGCCTCCTCACATTGG - Intergenic
1169503461 20:6183866-6183888 CCACCCCTGCCTCCAACTCTGGG - Intergenic
1169519223 20:6353060-6353082 ACACCACTGCCTGTTCCCATGGG - Intergenic
1170011497 20:11728507-11728529 CCACAGCTGCCTCTTCCCACAGG - Intergenic
1170101809 20:12709579-12709601 CCTCCCCTTCCTCCTGCCCTTGG + Intergenic
1171233996 20:23509744-23509766 CCTCCGCTGCCTCCTCCCACGGG + Intergenic
1171291647 20:23985981-23986003 GCATCCCTGTCTTCTCCCATTGG - Intronic
1171369639 20:24653320-24653342 CCAGCCCTGCCTCCTCACGGTGG - Intronic
1171444779 20:25195748-25195770 CCACCCCGGCCTCCACCCGCGGG - Exonic
1172654165 20:36526697-36526719 CCACCCCAGCCTCCCCGCATCGG - Intronic
1173280364 20:41621486-41621508 CCTTCCCTTCCCCCTCCCATAGG - Intergenic
1173658189 20:44715429-44715451 CCTCCTCTGCCTCCTCTCAAAGG + Exonic
1174264480 20:49321201-49321223 CCCCTCCTGCCTGCTCCCCTGGG - Intergenic
1174278069 20:49418145-49418167 CCACCCCGTCCTCCTCCCCAGGG - Intronic
1174345131 20:49923469-49923491 CAAACCCTGCCTCCACCCGTGGG - Intergenic
1174419417 20:50390002-50390024 CCACCCCTCCCACCCCCCAGTGG + Intergenic
1175288153 20:57851596-57851618 CCACCCCAGCCCCCACCCAGAGG - Intergenic
1175965683 20:62658963-62658985 CCTGCCCTGCCTCCTGCCCTGGG - Intronic
1176256526 20:64155957-64155979 CCACCCCTGCCTCACCCTCTTGG + Intronic
1176515460 21:7780476-7780498 CCCCTCCTCCCTGCTCCCATGGG + Intergenic
1178263151 21:31118157-31118179 CCCCCCCAGCCTGCTCCCATCGG + Intergenic
1178649488 21:34410488-34410510 CCCCTCCTCCCTGCTCCCATGGG + Intergenic
1179666327 21:42915181-42915203 CCACCCCTGCTTCTTCCTTTAGG - Intergenic
1179898611 21:44377368-44377390 CCACCCCTGCCTGCTTTCTTGGG - Intronic
1179959997 21:44762763-44762785 ACACCCCTCTCTCCTCCCACAGG - Intergenic
1179998475 21:44984709-44984731 CCACCTCGGCCCCCTCCCCTGGG + Intergenic
1180001356 21:44996920-44996942 CCACCCCATCTTCCTCCCAGCGG - Intergenic
1180765751 22:18345112-18345134 GCATCCCTGTCTTCTCCCATCGG + Intergenic
1180780559 22:18517266-18517288 GCATCCCTGTCTTCTCCCATCGG - Intronic
1180813278 22:18774587-18774609 GCATCCCTGTCTTCTCCCATCGG - Intergenic
1180941454 22:19662050-19662072 CCACCCCTGCCTGCTGCCCCCGG + Intergenic
1181162227 22:20965696-20965718 CCCCCACTGCCTCATCCCAAGGG - Intronic
1181199453 22:21208903-21208925 GCATCCCTGTCTTCTCCCATCGG - Intronic
1181368525 22:22398454-22398476 GCACACCAGCCTCCTCCCCTGGG - Intergenic
1181400303 22:22646954-22646976 GCATCCCTGTCTTCTCCCATCGG + Intronic
1181452745 22:23034791-23034813 CCACCCCTCCCCCTTGCCATTGG - Intergenic
1181577598 22:23805230-23805252 TCACCCATGTCTCCTCCCACTGG - Intronic
1181616906 22:24061204-24061226 ACACCCCAGCCTCCTCCACTTGG + Intronic
1181649059 22:24248837-24248859 GCATCCCTGTCTTCTCCCATCGG - Intergenic
1181702281 22:24628052-24628074 GCATCCCTGTCTTCTCCCATCGG + Intronic
1182299162 22:29328415-29328437 CCTCCACTGCCACCTCTCATGGG - Exonic
1182422704 22:30256287-30256309 CCTCCTCTTCCTCCTCCCAGAGG - Intergenic
1182854647 22:33506418-33506440 GAAACCCTTCCTCCTCCCATAGG + Intronic
1183472844 22:38018823-38018845 ACACACTGGCCTCCTCCCATGGG - Intronic
1183992070 22:41604024-41604046 CCACCCCTGTCTCCACTCACCGG + Exonic
1184088281 22:42279096-42279118 TCTCCCCAGCCTCCTCCCCTAGG + Intronic
1184225898 22:43128744-43128766 CCACATCTGCCTGATCCCATGGG + Intronic
1184359645 22:44007262-44007284 CCAGCCCACCTTCCTCCCATAGG - Intronic
1184422589 22:44390520-44390542 CAACCCCAGCCACCTCCCACTGG - Intergenic
1184459823 22:44630845-44630867 CCACCCATCCCTCCTCCCCAGGG - Intergenic
1184500647 22:44869528-44869550 CTCCCCATGCCTCCTCCCATGGG - Intergenic
1184720459 22:46309547-46309569 CCAGCTCTGCCCCCTCCCCTGGG + Intronic
1185197783 22:49483153-49483175 CCACCCCTTCCTCCCGCCACAGG + Intronic
1203227373 22_KI270731v1_random:86003-86025 GCATCCCTGTCTTCTCCCATCGG + Intergenic
1203263380 22_KI270734v1_random:269-291 GCATCCCTGTCTTCTCCCATCGG - Intergenic
950254751 3:11495205-11495227 CAATCCCTGCCTCCTTCCCTGGG - Intronic
950349796 3:12337696-12337718 CCACCCCTGCCCCCATTCATGGG + Intronic
952007880 3:28863254-28863276 CCAGCCCTGCCTTCTCAGATGGG + Intergenic
952512226 3:34069165-34069187 CCACCCCTCCATCCTCTCTTTGG - Intergenic
953809604 3:46100746-46100768 CCACCTCTCCCTAATCCCATGGG - Intergenic
954371379 3:50171145-50171167 CCACCCCCACCTCCACCCAGGGG + Intronic
954747921 3:52797437-52797459 CCATCCCAGCCTCTTCCCCTTGG - Intronic
954856636 3:53649401-53649423 CCACCCCTGCCTTTTCACAACGG - Intronic
955016372 3:55074092-55074114 CAACCCCTGCCTTTCCCCATAGG + Exonic
956355768 3:68390399-68390421 CCACAGCTGCCCCTTCCCATAGG - Intronic
956467667 3:69535641-69535663 CCGCCCCTGCCTCCGGCCCTAGG + Intronic
956509769 3:69981161-69981183 CCACCCCTGTCACCGCCCAATGG + Intergenic
956921834 3:73938034-73938056 GTACTCCTGCCTCCTCCCCTGGG + Intergenic
957193352 3:77039098-77039120 CCTCCCCTTCCTCCTTCCCTTGG + Intronic
959226675 3:103596484-103596506 CCACCCCTGCATCACCCAATGGG - Intergenic
959566410 3:107836949-107836971 CCACCCCTGCCTCATTCCCCCGG + Intergenic
959733604 3:109632072-109632094 CCAAGACTGCCTCCTCCCTTAGG + Intergenic
960619890 3:119627626-119627648 CCACCCCTGCCCCCGCCGAGAGG + Intronic
961286591 3:125810316-125810338 CCCCTCCTGCCTCCTTTCATGGG - Intergenic
961557081 3:127703089-127703111 CCACCACTGTCTCCTCCCCCAGG + Intronic
961584145 3:127908435-127908457 CCTCCCCTCCCTTCTCCCATTGG + Intergenic
961677582 3:128577068-128577090 CCACCCCTGCATCCCTGCATCGG + Intergenic
961749565 3:129087315-129087337 ACACCCCAGGTTCCTCCCATTGG - Intergenic
961863750 3:129938619-129938641 CCATCCCTGCCTCCTCTCCTGGG + Intergenic
962803210 3:138908096-138908118 CCACCCCTGCTTCCACCCTTTGG + Intergenic
964293981 3:155213348-155213370 CCACCCTTGACTCCTTCCCTTGG + Intergenic
965441462 3:168720467-168720489 CCACTTCTGCCTTCTGCCATGGG - Intergenic
965727728 3:171736730-171736752 CCACCACTGCCTCCTGCCTCAGG - Intronic
965728226 3:171743128-171743150 CCACTCATGCTTCCTCCCTTGGG + Intronic
967416231 3:189221793-189221815 CCCTCCCTGCCTTCTCCCATGGG - Intronic
968441069 4:624842-624864 CAAGCCTTGCCTGCTCCCATAGG - Intergenic
968581431 4:1397132-1397154 TCAGCCCTGCCTCCTCCCTCAGG + Intergenic
968726801 4:2251629-2251651 CCAGCCCTGCCCGCCCCCATCGG + Intronic
968908194 4:3464033-3464055 GGACCCCTGCCTCCTCCCAGAGG - Intronic
969185787 4:5473359-5473381 CCACGCCTGCCACTGCCCATTGG - Intronic
969244298 4:5922534-5922556 CCACGCCTGCCCCTTCCCGTGGG - Intronic
969251526 4:5971408-5971430 CCTCCCCCGACTCCTCCCCTGGG + Intronic
969436226 4:7191243-7191265 CCTCCCTTCCCTCTTCCCATTGG + Intergenic
969682611 4:8651762-8651784 CCGCCCCAGCCTCCTCTCGTAGG - Intergenic
969804542 4:9596717-9596739 CCTCTCCTGTCTCCTCCCCTTGG - Intergenic
970494246 4:16609337-16609359 CCCCCCCCGCCCCCTCCCCTGGG - Intronic
972324198 4:37999604-37999626 CCTCCCCTCCCTCCCCCCACAGG - Intronic
972699707 4:41482311-41482333 CCACCCCTACCTCCTTCCCCGGG - Intronic
974987165 4:69042246-69042268 CCACCCCTGGATGCTGCCATGGG + Intronic
976695270 4:87912628-87912650 CGTCCCCTTCCTCCTTCCATCGG + Intergenic
977770785 4:100856069-100856091 CCACCCATTCCTCCTTCCATTGG + Intronic
978107814 4:104925754-104925776 CCACCCCTGCTCCCTGCCACTGG - Intergenic
978148588 4:105407833-105407855 CAATCCCTTCCTCCTACCATAGG - Intronic
979898307 4:126188271-126188293 CCACCCCTGTCACCGCCCAATGG - Intergenic
980997072 4:139789524-139789546 CCACCCGTGCCTAGTCACATTGG - Intronic
981531911 4:145761727-145761749 CCAGCCCTGCCGCCTCTCAGGGG + Intronic
982688360 4:158519971-158519993 CCTCCCTGGCCTCCACCCATTGG - Intronic
984915383 4:184718647-184718669 ACACCCCTGCCACCTCCCTGTGG - Intronic
985793767 5:1947084-1947106 CCGACACTGCCTCCTCCCAGGGG + Intergenic
986456654 5:7927074-7927096 CCACTCCAGCCTCCTCCCCAGGG - Intergenic
988616685 5:32781784-32781806 CCACCCCTGCAACCTCACAATGG - Intronic
990337309 5:54787377-54787399 CCACCACTGCTTTCTCCAATAGG - Intergenic
991493687 5:67207967-67207989 CCATCCCAGCCTCGTCCCCTAGG + Intergenic
992162590 5:74017222-74017244 CCCCCTCTGACTCCTCCCACAGG - Intergenic
993144671 5:84078970-84078992 CCACCCCTGCCCCGTCCTCTAGG + Intronic
996362846 5:122669729-122669751 CCTCCCCTGCCTCCTACCTCCGG + Intergenic
997594353 5:135096202-135096224 CCACCCTTGCCTCCTCACTCTGG + Intronic
998871161 5:146553589-146553611 CAACCCCTTCCTCCTGCCAGAGG + Intergenic
999683527 5:154081932-154081954 CCATCCCAGCCTGATCCCATGGG - Intronic
1001294508 5:170489523-170489545 GGTCCCCTGCCTCCTCCCACTGG + Intronic
1001398476 5:171433114-171433136 CCACCCCCGCCACCTCCCTGGGG + Intronic
1001436753 5:171705202-171705224 CCACCCCTGCCATCGCCCAAAGG + Intergenic
1001745165 5:174087007-174087029 ACACCCCTCCTTCTTCCCATGGG + Intronic
1001937453 5:175715471-175715493 CCACCCCTACCTTCTCCTCTAGG - Intergenic
1002000015 5:176192166-176192188 CCTCCCCTGCCTCCTGCCCAGGG + Intergenic
1002196546 5:177504492-177504514 CCAGCCCTGCCCCCTGCCACGGG - Exonic
1002485777 5:179535271-179535293 CCAGCCCTTCCTCCTACCTTGGG + Intergenic
1002597707 5:180334944-180334966 ACACCCTTGCCCCCTCTCATGGG - Intronic
1002600894 5:180353418-180353440 CCCCGCCCGCCTGCTCCCATTGG + Intergenic
1002960196 6:1906947-1906969 CCACCCTTGCCTCCTCTCGGAGG - Intronic
1003488314 6:6598749-6598771 CTGCCCTTGCCTTCTCCCATTGG + Intronic
1005413247 6:25573140-25573162 CCTCCCCATCCTCCTCCCCTTGG - Intronic
1006136972 6:31901483-31901505 CCACGCCTCCCTCCTCTCAGAGG - Intronic
1006316184 6:33293196-33293218 CCCCACCAGCCTCCTCCCCTAGG - Exonic
1006641459 6:35491740-35491762 CCATCCCTGCCTCCACCCAGAGG - Intronic
1007395235 6:41574006-41574028 CCCCCTCTTCCTCCTCCCCTAGG + Intronic
1007777765 6:44233338-44233360 CCACCCCTCCTTCCACCCAGAGG + Intronic
1008581694 6:52913924-52913946 CCACCCCAGGGTCCTCCCAGTGG - Intergenic
1009024721 6:57984671-57984693 CCTCCCCTGCCCTCTCCCAAGGG - Intergenic
1009200298 6:60736143-60736165 CCTCCCCTGCCCTCTCCCAAGGG - Intergenic
1010069677 6:71728880-71728902 ACACCTCTGCCTCCTCTCCTGGG + Intergenic
1011993822 6:93559488-93559510 CCCACCCTCCATCCTCCCATAGG + Intergenic
1012399892 6:98834502-98834524 CCCCCTCCGCCCCCTCCCATTGG - Intergenic
1013466976 6:110426486-110426508 CCACCCCTCCCTCCTCCTGGAGG + Intronic
1013612971 6:111812258-111812280 TCTGCCCTGCCTCCTCCCAGAGG - Intronic
1014535677 6:122610573-122610595 CCACTCCTCCCTCCTCGCATAGG - Intronic
1017916884 6:158838029-158838051 CCACCCCTTCCCCCTCCCTCTGG - Intergenic
1019374068 7:679789-679811 CAACCCCAGCCACCTCCCAAAGG - Intronic
1019404548 7:876835-876857 CCGCCCCCGCCGCCTCCCATTGG + Intronic
1019429330 7:991449-991471 ACACCCCTGCCCACGCCCATGGG - Intergenic
1019687246 7:2388670-2388692 CCATCCCTGCGTCCTCCTGTGGG + Intergenic
1020194383 7:6026058-6026080 CCACCCCTGCCTCTCCCCGGTGG + Intronic
1020800497 7:12726805-12726827 CCACACCTCCCTCCACCTATTGG + Intergenic
1021041568 7:15869294-15869316 ACATCCCTGCCTCCTCCCTGCGG - Intergenic
1021144134 7:17064795-17064817 CCTCCCCTGCTTCCTTCTATAGG + Intergenic
1021783808 7:24133158-24133180 TGCCCCCTGCCTCCTCCCCTGGG - Intergenic
1022050539 7:26664417-26664439 CCTCCCCTCCCAGCTCCCATGGG - Intergenic
1022340303 7:29461322-29461344 TCACCCCTCCATCCTCCCCTGGG - Intronic
1024000669 7:45187390-45187412 CCCCTCCTGCCTCCTCAAATTGG - Intergenic
1024032078 7:45469726-45469748 CCACCCCTGTCATCTCCCAATGG + Intergenic
1024632739 7:51262848-51262870 CCTGCCCTGCCTCCTACCAGGGG - Intronic
1024914619 7:54485299-54485321 CCACCCCCACCTCCTCCCAAGGG + Intergenic
1025255778 7:57383170-57383192 CCACCCCTCACTCCACCCCTGGG - Intergenic
1025271279 7:57520280-57520302 CTTCCCCTGCTTCCTGCCATAGG + Intergenic
1027737019 7:81945378-81945400 CCACTCCTGCCTCTTCTCTTGGG - Intergenic
1028728923 7:94122370-94122392 CCACCTCTGCCTTCTGCCCTCGG + Intergenic
1029114957 7:98232035-98232057 CCAGCCCTGCCTCCTCCTCTGGG - Intronic
1029223609 7:99009161-99009183 CCTGCCCTGCCTCCTACCAAGGG - Intronic
1029705630 7:102274327-102274349 CTCCTCCTCCCTCCTCCCATGGG - Intronic
1030277650 7:107737435-107737457 CCACCCCTGCCATCGCCCAATGG + Intergenic
1030713553 7:112782919-112782941 CAGCCTCTTCCTCCTCCCATTGG + Intronic
1031632975 7:124066187-124066209 CCACCGCTGCCTCTTGCCAGGGG + Intergenic
1032253183 7:130275417-130275439 GCACCCCAGGCTCCTCCCCTTGG + Intronic
1032432126 7:131870775-131870797 CCACTGCGGCCTCCTACCATCGG - Intergenic
1032535389 7:132658676-132658698 CCTCCACTGCCTCCTCTCAGTGG + Intronic
1033289029 7:140065706-140065728 CCAGCCCTGTCTCCTCCCTCTGG - Intergenic
1033705415 7:143881719-143881741 CCAACCCTGCTTACTCCTATGGG - Intronic
1034694321 7:153040515-153040537 TCACCCCTGCCTCCTCGCAGTGG - Intergenic
1034752737 7:153586337-153586359 ACACCCCTGCCTCCTACCATAGG + Intergenic
1035349864 7:158238304-158238326 CCTCCCCTCCCTCCTGCCCTGGG + Intronic
1035663509 8:1364139-1364161 TCTCCCGTGCCTCCTCCCACTGG + Intergenic
1035836376 8:2757613-2757635 CCACCCTTCCCTCCTCTCTTTGG - Intergenic
1036410344 8:8494108-8494130 CCACTGCTGCCTCTTGCCATAGG + Intergenic
1036581359 8:10078661-10078683 CCATTTCTGCCTCCTCCCGTGGG - Intronic
1036766638 8:11553695-11553717 CCACCCCAGCCTCAGCCCAGAGG - Intronic
1037640411 8:20736988-20737010 CTACCACCACCTCCTCCCATTGG + Intergenic
1037886310 8:22598260-22598282 CCAGCCCTGCCCCCTCCCTCTGG + Intronic
1038597498 8:28902159-28902181 TCACCCCTGCCCCCTACCAGCGG - Intronic
1039239940 8:35545445-35545467 ACACCCCTTCCTCATCCCACAGG - Intronic
1039668390 8:39564467-39564489 CCAACCCTCCATCCTCCAATAGG + Intergenic
1039882550 8:41634080-41634102 CCTCCCCTCCCACCTCCCACTGG + Intergenic
1041363489 8:57076061-57076083 TCACTCCTGCCACATCCCATGGG + Intergenic
1041428344 8:57749064-57749086 CCACCCCTCCGTCCTCCCCAGGG + Intergenic
1041712765 8:60909065-60909087 ACAGCCCTCCCTCCTCCCTTCGG + Intergenic
1044467742 8:92526376-92526398 CCCACCCTGCCTCCTGCCACTGG + Intergenic
1044824434 8:96182829-96182851 CCACCCCCACCCCCACCCATAGG - Intergenic
1044837080 8:96306226-96306248 CCACCCCTGCCACCTCTCCCTGG + Intronic
1044839506 8:96325922-96325944 CCACCCCTCACTCCTTCCCTGGG - Intronic
1045320378 8:101077608-101077630 CCACCCCTGCCTCCCTGCAAAGG - Intergenic
1045417649 8:101983249-101983271 CCACCCCTGGCTCATCTCAGGGG + Intronic
1045575470 8:103415373-103415395 CCACCGCCACCTCCTCCCACAGG - Exonic
1046697747 8:117360804-117360826 CCACCCCTTACTCCACCCAAAGG - Intergenic
1046774159 8:118146183-118146205 CTACCCCTGCCTCCTTCATTTGG - Intergenic
1046902218 8:119535772-119535794 CCTCCCCTCCATCCTCACATAGG + Intergenic
1047335374 8:123930883-123930905 CAACCCATGCCTCCTCACAAAGG - Intronic
1048416201 8:134230184-134230206 CCACACCTCCCTCCTCTCTTTGG + Intergenic
1048938396 8:139375981-139376003 CCACTCCTACCTCCACCCCTAGG + Intergenic
1049549394 8:143249882-143249904 GCACGTCTGCCTCCTCCCTTGGG - Exonic
1049595731 8:143482468-143482490 CCACCCCACACTCCTCCCTTAGG - Intronic
1049646931 8:143739721-143739743 CCACCCGGGCCTCCTCCCGAGGG - Intergenic
1049655409 8:143794922-143794944 CCACCCCAGCCCCCGCCCAAAGG + Intronic
1049663366 8:143830484-143830506 CTACCCCTGCCTCCACCCCTGGG + Intergenic
1049680012 8:143913913-143913935 CCACTCCTGCCTCTACCCCTTGG - Intergenic
1050003570 9:1103788-1103810 CCCACCCTCCATCCTCCCATAGG + Intergenic
1051809258 9:21031510-21031532 CCACCCGCGCCCCCTCCCCTCGG + Intronic
1052006884 9:23360093-23360115 CCACCCCCAGCCCCTCCCATTGG + Intergenic
1052266440 9:26579170-26579192 CCACCTCTGCCACCTCCCTATGG - Intergenic
1053003621 9:34590882-34590904 CCACCCCCGTCTCCACCCCTTGG + Intergenic
1054798831 9:69326471-69326493 CCACTCCTCCCTCCTCCAACCGG + Intronic
1055772321 9:79730670-79730692 CCCCCCCTGCCTCTTCCAAGAGG + Intergenic
1055970161 9:81903705-81903727 CCACCTCTGCCACCTCCCAAAGG + Intergenic
1055972376 9:81924399-81924421 CCACCTCTGCCACCTCCCAAAGG + Intergenic
1055974129 9:81939471-81939493 CCACCTCTGCCACCTCCCAAAGG + Intergenic
1055979064 9:81983721-81983743 CCACCTCTGCCACCTCCCACAGG + Intergenic
1056615452 9:88161524-88161546 CTATCCCTGGCTCCTCCCAAGGG + Intergenic
1056669589 9:88615029-88615051 CCACCCCTGCCCTCCCCCAACGG + Intergenic
1057165375 9:92921295-92921317 CCACAGCTGCCTCCTTCCTTAGG - Intergenic
1057185481 9:93055281-93055303 CCTCCCCTGCCTCCTCCAGCAGG + Intergenic
1057276169 9:93676997-93677019 CCTGCCCTGCCTGCCCCCATGGG + Intronic
1059161777 9:112041582-112041604 TCCCCCTCGCCTCCTCCCATGGG - Intronic
1059424966 9:114215205-114215227 GAAGCCCTGCCTCCTCCCAGAGG - Intronic
1059700071 9:116767322-116767344 CCACCCCTCCCTCCTCTCATAGG - Intronic
1059776450 9:117480121-117480143 ACACCCCAGCCTCCTCCCCTGGG - Intergenic
1060105374 9:120869794-120869816 CCTCTCCTGCCTCCTCCAGTGGG - Intronic
1060555886 9:124507041-124507063 ACAGGCCTGGCTCCTCCCATCGG + Intronic
1060810007 9:126606331-126606353 CCCCTCCTGCCTCCTTCCAGTGG - Intergenic
1060985831 9:127818470-127818492 CCACCCCTGAGTCCTCACAGTGG + Intronic
1061196228 9:129108574-129108596 CCACCCCTGCCCCATCTCAAAGG - Intronic
1061286645 9:129627021-129627043 CCAGCCCTGGTTCCTCCCAGAGG - Intronic
1061416409 9:130449484-130449506 CTGCTCCTGCCTCCTCCCAGAGG - Intronic
1062052872 9:134456505-134456527 CCAGCCCTGCCTTCTCCCCGCGG - Intergenic
1062117910 9:134818978-134819000 ATCCCCCTGCCTCCTCCCACAGG + Exonic
1062136182 9:134929650-134929672 CCACCCCTGCCTCCTGACTCAGG + Intergenic
1062170690 9:135133173-135133195 CCACCTCTGCCTCGCCCCACTGG - Intergenic
1062378382 9:136275198-136275220 CCACCCCTGCTTCCTTGCAGTGG - Intergenic
1062523999 9:136970942-136970964 CCACCACAACCTCCTCCCACAGG + Exonic
1062535279 9:137018561-137018583 CCACCCCTGCCCCTTCCAAACGG - Intronic
1062628046 9:137451898-137451920 CAACCCCAGCCTCTTCCCCTTGG + Intronic
1062628091 9:137452055-137452077 CAACCCCAGCCTCTTCCCCTTGG + Intronic
1062628120 9:137452141-137452163 CCACCCCAGCCTCTTCCCCTTGG + Intronic
1062628160 9:137452255-137452277 CCACCCCAACCTCTTCCCCTTGG + Intronic
1062711520 9:137977717-137977739 CCACTCCTCCCTCCTCCCTCAGG - Intronic
1203771349 EBV:51434-51456 ACACCCCGGCCTCCTCCGACCGG - Intergenic
1186443641 X:9607383-9607405 CCAGCACTGCCTCATCCCACTGG - Intronic
1187042964 X:15616397-15616419 CAACCCCTGCCTCTTTCTATGGG + Intergenic
1188003471 X:25002506-25002528 CCAACCCTGCACCCTCCCCTCGG + Intergenic
1189378693 X:40486068-40486090 CCATCACTCCCTCCTCCTATTGG + Intergenic
1190212312 X:48458701-48458723 CCTCCTCCTCCTCCTCCCATGGG + Exonic
1190262599 X:48806861-48806883 AGACACCTGCCTCCTCTCATGGG + Intronic
1191787793 X:64935367-64935389 CCACCACTGCCCCTTCCCACTGG - Intronic
1195864026 X:109410008-109410030 CCAGCCCTGCCCCCTGCCACAGG + Intronic
1198853874 X:140995588-140995610 CCACCCCTGGATGCTGCCATGGG - Intergenic
1198878140 X:141249518-141249540 CCACCCCTGGATGCTGCCATGGG + Intergenic
1199846330 X:151695073-151695095 CCACCCCTCCTTCCTCCACTCGG + Intergenic
1199864117 X:151827661-151827683 CGTGCCCTGCCTCTTCCCATAGG + Intergenic
1200049897 X:153423190-153423212 CCAGCCCTGTCCCCTCCCAGGGG + Intergenic
1202583015 Y:26402155-26402177 CCACCCCTTCATCCTCCCCCAGG - Intergenic