ID: 919976277

View in Genome Browser
Species Human (GRCh38)
Location 1:202615126-202615148
Sequence TCTAAGTCATTTTCCTCTGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 191
Summary {0: 1, 1: 0, 2: 1, 3: 17, 4: 172}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
919976277_919976282 -2 Left 919976277 1:202615126-202615148 CCACCAGAGGAAAATGACTTAGA 0: 1
1: 0
2: 1
3: 17
4: 172
Right 919976282 1:202615147-202615169 GAGCTGCAGAGAGGGAATGTGGG 0: 3
1: 0
2: 3
3: 33
4: 449
919976277_919976281 -3 Left 919976277 1:202615126-202615148 CCACCAGAGGAAAATGACTTAGA 0: 1
1: 0
2: 1
3: 17
4: 172
Right 919976281 1:202615146-202615168 AGAGCTGCAGAGAGGGAATGTGG No data
919976277_919976280 -10 Left 919976277 1:202615126-202615148 CCACCAGAGGAAAATGACTTAGA 0: 1
1: 0
2: 1
3: 17
4: 172
Right 919976280 1:202615139-202615161 ATGACTTAGAGCTGCAGAGAGGG 0: 3
1: 0
2: 1
3: 15
4: 209
919976277_919976283 -1 Left 919976277 1:202615126-202615148 CCACCAGAGGAAAATGACTTAGA 0: 1
1: 0
2: 1
3: 17
4: 172
Right 919976283 1:202615148-202615170 AGCTGCAGAGAGGGAATGTGGGG 0: 3
1: 0
2: 2
3: 37
4: 526
919976277_919976285 27 Left 919976277 1:202615126-202615148 CCACCAGAGGAAAATGACTTAGA 0: 1
1: 0
2: 1
3: 17
4: 172
Right 919976285 1:202615176-202615198 ATGAAGCAGCAGCAGCAGATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
919976277 Original CRISPR TCTAAGTCATTTTCCTCTGG TGG (reversed) Intronic
901326257 1:8367248-8367270 TCTGAGGCCATTTCCTCTGGGGG - Intronic
902563834 1:17296707-17296729 TGTCAGTCTTTTTTCTCTGGAGG - Intergenic
904602907 1:31683590-31683612 ACTAAGTCCTGTGCCTCTGGGGG + Intronic
904982956 1:34522166-34522188 CCCAAGTTATTTTCCTCTGTAGG + Intergenic
906993463 1:50764276-50764298 ACAAAGTCTTTTTCCTCTGGTGG + Intronic
908285198 1:62590034-62590056 TCCATGTCATTGTACTCTGGTGG - Intronic
911436278 1:97863163-97863185 CCTAGGTCATGTTCCTCTGCTGG - Intronic
911793416 1:102047054-102047076 TCTCTGTCATGTTCCACTGGTGG - Intergenic
916439890 1:164813902-164813924 TCTAAGGAATTTTTTTCTGGTGG + Intronic
918312382 1:183293981-183294003 TCTAAATCCTTTTGCTTTGGGGG - Intronic
919976277 1:202615126-202615148 TCTAAGTCATTTTCCTCTGGTGG - Intronic
920876030 1:209836861-209836883 TTTAAGTCAATATCCTTTGGGGG - Exonic
921151114 1:212403872-212403894 TCTAAGCCATTTGCCTCTCTAGG + Intronic
924032713 1:239902830-239902852 TATAAGTCATTTCCCTCTAATGG + Intronic
924665579 1:246068114-246068136 ATTAAGTGATTTTCATCTGGAGG + Intronic
1063140241 10:3250302-3250324 TCTTACTCATTTTCCTCTCGTGG + Intergenic
1064323259 10:14325770-14325792 TCTAAGCCATTTTCCTCCTTTGG - Intronic
1066263202 10:33748988-33749010 TCTAACACATTCTCGTCTGGAGG - Intergenic
1067283286 10:44889223-44889245 TCTAATACATTTTCCTCTGCAGG + Intergenic
1069209484 10:65738391-65738413 ACTAAGTTACTTTCTTCTGGTGG - Intergenic
1070190679 10:74109040-74109062 TCTTCATCCTTTTCCTCTGGTGG - Exonic
1072297771 10:94028020-94028042 TCTCAATCATTTTCCAGTGGAGG + Intronic
1073676780 10:105656185-105656207 TCTAATTCTTTTTCCTTTGAAGG - Intergenic
1078928411 11:15894654-15894676 TCTGAGCCTCTTTCCTCTGGAGG - Intergenic
1080407838 11:31995553-31995575 TCTCTGTCATTTACATCTGGGGG - Intronic
1081236334 11:40651732-40651754 GCAAAATCATTTTCCTCTGTAGG + Intronic
1084733660 11:71090888-71090910 TCTCAGTCTTTTTCCTCTTAAGG + Intronic
1086275314 11:85120877-85120899 TCTAAGTCATTTCTGTCTAGGGG + Intronic
1091813816 12:3421257-3421279 CCCAAGTCATTTTTATCTGGTGG + Intronic
1095158252 12:38885295-38885317 TTTAAGTCATTTTTCTTTTGGGG - Intronic
1095200249 12:39375984-39376006 TCTAAGTCATTTCCCTCATGAGG + Intronic
1095538611 12:43281648-43281670 TCTAAAACATTTTCCTGCGGAGG - Intergenic
1097538680 12:60907509-60907531 TCTCAGTCCTTTTCATCTGATGG + Intergenic
1097810466 12:64013477-64013499 TCTACGTTATTTACCTATGGAGG + Intronic
1098300872 12:69053095-69053117 TTTAAGTAATTTGCCTCTAGCGG - Intergenic
1098366357 12:69707223-69707245 TCTCAGCATTTTTCCTCTGGCGG + Intergenic
1099144647 12:79025205-79025227 TCAGAGTAATTTTCCTCTGGAGG + Intronic
1102951706 12:117035623-117035645 TCCCAGGCAGTTTCCTCTGGAGG - Intergenic
1107322129 13:39201115-39201137 TCTAAGTCATTTTCCTCCTCTGG - Intergenic
1107398078 13:40039246-40039268 TCTAAATTTATTTCCTCTGGTGG + Intergenic
1107886841 13:44880736-44880758 TCTAAGCAATTTTCCCCTAGAGG - Intergenic
1110713014 13:78670775-78670797 TCAAGGTCATATTCTTCTGGGGG + Intergenic
1111259505 13:85718093-85718115 TCTAAGTTATTATACTTTGGAGG - Intergenic
1113069557 13:106407268-106407290 TCTTAGTCATTTAAATCTGGGGG + Intergenic
1115428419 14:33288105-33288127 TCTAAATCAGTTTCCTCTTCTGG - Intronic
1115908894 14:38233593-38233615 ACTAAATCATTTTGCTGTGGTGG + Intergenic
1116027573 14:39534047-39534069 TCTGAGTCATTTTCTTGTGAAGG - Intergenic
1117088122 14:52222374-52222396 TCTAAGTCTATTTACTCAGGAGG - Intergenic
1119099828 14:71869553-71869575 GATAAGTCATTTTCCTTTGTTGG - Intergenic
1119531019 14:75361457-75361479 TATGGGTCATTTTCCTCTGTGGG + Intergenic
1121780963 14:96622216-96622238 TCTAGGTCTTTCTTCTCTGGGGG + Intergenic
1125241840 15:37585168-37585190 TCTATTTCAGTTTCCTATGGTGG - Intergenic
1126456847 15:48872096-48872118 TCTATTTCATTTGCCTCTGGAGG - Exonic
1127550006 15:60027756-60027778 CATAAGTCATTTTCATCTGGGGG + Intronic
1127638300 15:60891966-60891988 TCTTTGTCATCTTCCTCTGGAGG - Intronic
1129650021 15:77478611-77478633 TTTAATTAATTTTCCTCTGGAGG - Intronic
1130120041 15:81040087-81040109 GAGAAGTCATTTGCCTCTGGAGG - Intronic
1131466324 15:92657284-92657306 TGTAATTCATTTTGATCTGGGGG + Intronic
1139636929 16:68263822-68263844 TCGAGTTCCTTTTCCTCTGGTGG - Intergenic
1140962676 16:79931656-79931678 TTTATATCATTTTCATCTGGTGG + Intergenic
1141404358 16:83778819-83778841 TCCAAGACATTTTCTTCTGGGGG - Intronic
1142567411 17:849628-849650 TCCACGTCCTTGTCCTCTGGCGG + Intronic
1144067868 17:11640604-11640626 GCTGACTCATTTTGCTCTGGGGG + Intronic
1148263486 17:46205376-46205398 TCTAAGTCTTTTTTTTTTGGCGG - Intronic
1153196179 18:2599418-2599440 TTTATGTCTTTCTCCTCTGGGGG - Intronic
1153775776 18:8452119-8452141 TCTAAGTCATTTTTCTCCCTTGG + Intergenic
1158865977 18:61638105-61638127 TGAAAGTCAATTTGCTCTGGTGG - Intergenic
1159079473 18:63721336-63721358 ATTAAGCCATTTTACTCTGGGGG + Intronic
1161566186 19:5004192-5004214 CCTAAGTCCTTTTCTTCTGGGGG + Intronic
1162090246 19:8274918-8274940 TCAAATTCATTTTCTTCTGAGGG + Intronic
1162092478 19:8289779-8289801 TCAAATTCATTTTCTTCTGAGGG + Intronic
1162755711 19:12858386-12858408 TCGAAGTCATTCTCCCCCGGCGG - Exonic
1163063839 19:14778558-14778580 TCTAAGCCAGTTTCCTCCTGTGG + Intergenic
1163626352 19:18392096-18392118 TAAAAGTCATTGTCCTCTGAAGG + Exonic
1166716815 19:44973659-44973681 TCTAAATGCTTTTGCTCTGGAGG - Intronic
1167300603 19:48675420-48675442 TGTCAGCCATTTTCCTCAGGGGG - Intergenic
926713648 2:15905139-15905161 CCTGAGTGATTTTCCTCCGGTGG - Intergenic
927705924 2:25296586-25296608 TAGAAGGCATCTTCCTCTGGTGG + Intronic
928224522 2:29436786-29436808 ACTAAGCCATTTATCTCTGGTGG - Intronic
930574646 2:53131598-53131620 TGTGAGTCATTTTCTTGTGGTGG - Intergenic
931035840 2:58241655-58241677 TAAAAGTCATTTTATTCTGGAGG - Intergenic
931660112 2:64552672-64552694 TCCAAATCATTTTCTTCTGTGGG - Exonic
932956844 2:76361317-76361339 TTTAAGTCATTATCTTCTGCTGG - Intergenic
933462005 2:82600277-82600299 TCTAAATAATTTTTCTCTGTTGG + Intergenic
935314949 2:101823565-101823587 TATCAGTCATTTTCCTTTTGTGG + Intronic
937211472 2:120275132-120275154 TCCTTGTCATTTTCCTCTGTTGG + Intronic
938160180 2:128978774-128978796 ACTGACTCATTGTCCTCTGGTGG - Intergenic
938181255 2:129187157-129187179 CCTCAGTCTTGTTCCTCTGGAGG + Intergenic
940091765 2:149927732-149927754 TCTAAGTCCTTTCTCTTTGGGGG + Intergenic
940701894 2:157055283-157055305 TCTGATTCATTTTCCTCAGTAGG + Intergenic
941288212 2:163641635-163641657 TCTAACTCATTTGCCTCTGAAGG - Intronic
942530572 2:176905383-176905405 TGTAAGTCATTTTCCTAATGAGG - Intergenic
943017909 2:182536902-182536924 CCTTAGTCATTTTTCTCTGTAGG - Intergenic
945191333 2:207190726-207190748 TAAAATTCATTTTCCTCTCGTGG + Intergenic
945641457 2:212436484-212436506 TCTTATTCTTTTTCCTCTTGAGG - Intronic
945710765 2:213291561-213291583 TCTACTTCTCTTTCCTCTGGGGG + Intronic
948678023 2:239610570-239610592 TCAAGGTCATTCTTCTCTGGGGG - Intergenic
948728195 2:239947352-239947374 ACTGAGCCATTTTCCTCTGTGGG - Intronic
1168884100 20:1233122-1233144 TCTAAGTTATTTTATTCTAGTGG + Intronic
1168978784 20:1987718-1987740 GCTAAGTCATTTTCCTAAAGTGG - Intronic
1169698070 20:8414040-8414062 TCTAAGGCATTTTCAGCTAGTGG + Intronic
1169884716 20:10386069-10386091 TTTAAGTAATTTTCCTCAAGAGG + Intergenic
1171000056 20:21405426-21405448 TCTAGATCTTTTTGCTCTGGAGG - Intergenic
1171073831 20:22102659-22102681 TAAAAGTCATTGTTCTCTGGTGG - Intergenic
1173111571 20:40195713-40195735 TCTTAGATATTTTCCTCTTGGGG - Intergenic
1175429925 20:58893510-58893532 TCTTATTTATTTTCCTTTGGTGG + Intronic
1175776495 20:61656999-61657021 TCTAAGACACATGCCTCTGGGGG - Intronic
1177020559 21:15851309-15851331 TGAAAGTCATTATCCACTGGGGG - Intronic
1179159648 21:38883652-38883674 TCTTAGTCATTTTTCTCTCTAGG + Intergenic
1179279126 21:39918994-39919016 TATAATTTTTTTTCCTCTGGAGG + Intronic
1180726725 22:17952017-17952039 TCTAAGTGATTTGGCTCTTGTGG - Intronic
1182349924 22:29693593-29693615 TCTGAGCCTCTTTCCTCTGGAGG - Intronic
951482018 3:23171088-23171110 TCTAACTCATTTTCCTGTGTTGG - Intergenic
953157671 3:40389458-40389480 TCTAAGTCATTTTACACATGTGG + Intronic
953369665 3:42376634-42376656 CCAAAGTCAGTTTCCTCTGGCGG + Intergenic
953743818 3:45557922-45557944 TTTAACTCAATTTCCTCGGGAGG - Intronic
956135329 3:66092871-66092893 TCTAATCCAGTTTCCTCTGGGGG - Intergenic
956565178 3:70628758-70628780 TCTAACTCATCTTCCTCTGGAGG + Intergenic
958149616 3:89672866-89672888 TATAATTTATTTTCCTCTGCTGG - Intergenic
960290631 3:115880188-115880210 CCTAAGTCATTTTTCTCTCTTGG - Intronic
962343876 3:134606019-134606041 TCTTGGTCACTTTCCTTTGGAGG - Intronic
965192960 3:165555116-165555138 TTTATGTCTATTTCCTCTGGAGG + Intergenic
966192120 3:177280917-177280939 TCTTAGTCATTTTGCTCTCTGGG + Intergenic
967099259 3:186202550-186202572 TCTAGGTCATTTCCCACTGATGG + Intronic
968033295 3:195522391-195522413 ATTAATTCATTTTCCACTGGTGG - Intronic
970034031 4:11711469-11711491 TCTAAGTCTGCTTCCTCTTGAGG - Intergenic
970177619 4:13355322-13355344 TCTAAGTCATTTAAAGCTGGAGG + Intergenic
973615969 4:52678178-52678200 TGTAAGTCAGAATCCTCTGGAGG - Intergenic
974440479 4:61909325-61909347 TCAAAGTAAGTTTCCTCAGGAGG + Intronic
975588994 4:75981425-75981447 CCTAAGTAATTTTCCTCAAGAGG - Exonic
976739175 4:88341102-88341124 TCAAAGTCATTTTTGTATGGAGG - Intergenic
978712876 4:111806781-111806803 TCTAAGTCAACTTCCCCTGAAGG + Intergenic
979111199 4:116759938-116759960 TCTAACTTCTTTTCCTCTGAAGG - Intergenic
979164432 4:117509215-117509237 TGTAATTCATTTTCTTCTGCAGG - Intergenic
979306306 4:119148241-119148263 AGTAAGTTGTTTTCCTCTGGTGG + Intronic
981484996 4:145276517-145276539 TCGAAATCATTTTCCTTTTGTGG - Intergenic
982097989 4:151940857-151940879 TGTAAGTCATTTTCCTATCTGGG - Intergenic
982579131 4:157155653-157155675 TCTAATTGCTTTTCCTCTGTAGG + Intronic
985113424 4:186568865-186568887 TCTAAGTCACTTTTTTCTGCAGG - Intergenic
987020848 5:13869389-13869411 GATAAGACATTTTCATCTGGAGG + Intronic
987829560 5:23077681-23077703 TGTAAGTCATTTGCCTCTCTTGG + Intergenic
990427195 5:55698355-55698377 TTTCAGTCATTTTCCTCTCTTGG - Intronic
990992717 5:61701229-61701251 TCTTAGCCATTTTACTCTGATGG - Intronic
995442367 5:112206010-112206032 TGAAAGTCATTCTCATCTGGAGG - Intronic
995484604 5:112627530-112627552 AGTAACTCATTTTCCTTTGGGGG + Intergenic
996259528 5:121448543-121448565 TCAAGGTGATTTTTCTCTGGTGG - Intergenic
998590494 5:143472666-143472688 CCTCAGTCACTTTCCTCTTGAGG - Intergenic
999323606 5:150629645-150629667 TCTAAGAGATTTTATTCTGGAGG - Intronic
1001988389 5:176095361-176095383 TCCAAATCATGTTCCTCTGCAGG - Intronic
1002228479 5:177742772-177742794 TCCAAATCATGTTCCTCTGCAGG + Intronic
1003093451 6:3123297-3123319 GTTAAATGATTTTCCTCTGGGGG + Intronic
1003321247 6:5054006-5054028 TCTTAATCATTTTCTGCTGGTGG - Intergenic
1004594880 6:17090002-17090024 TCTTAGTCTTTTTTCTCTGTAGG + Intergenic
1008223299 6:48879659-48879681 TCTAATTCATTTGTCTCTGCTGG + Intergenic
1008226717 6:48927893-48927915 ACTAAGTCAGTTTCCTCAAGGGG + Intergenic
1008520319 6:52356798-52356820 TCTCAGTCATTTTATCCTGGGGG - Intergenic
1008628273 6:53338949-53338971 TTTAAGACATTTTCGTTTGGGGG - Intronic
1009299832 6:62003076-62003098 TCTAACTCATTTTTCTTTGCAGG + Intronic
1009360860 6:62810904-62810926 TCTAAGTAATTTACTCCTGGAGG - Intergenic
1016379249 6:143457247-143457269 TGTAAGTCAGTTTCCTTTGTTGG + Intronic
1018864521 6:167736444-167736466 AAAAAGTCATTTTCCTCAGGAGG - Intergenic
1019584022 7:1786839-1786861 ACAAACACATTTTCCTCTGGAGG - Intergenic
1020613351 7:10427875-10427897 ACTAATTCATTTTCCACCGGTGG - Intergenic
1021402919 7:20230369-20230391 TCTGAGTCACTTTCCTCAGCTGG + Intergenic
1021588130 7:22232015-22232037 TCTGAGTCATTGTCATCTGCAGG - Intronic
1026357513 7:69571700-69571722 TATAATTCATTGTCCTTTGGAGG - Intergenic
1030211031 7:106995946-106995968 TCTAAGTTCCTTTCATCTGGTGG - Intergenic
1031141914 7:117951897-117951919 TCTGACACATTTGCCTCTGGTGG - Intergenic
1031643987 7:124201180-124201202 TCTATGTTATTTTTCTCTAGAGG + Intergenic
1031710327 7:125036788-125036810 ACTAATACAATTTCCTCTGGAGG - Intergenic
1036915141 8:12797318-12797340 TCTGAGTCTTTTCCTTCTGGTGG - Intergenic
1038303784 8:26381203-26381225 TCTAAGTAATTTTCCTCAAGTGG - Intergenic
1042329864 8:67567563-67567585 TCTAGTTGATTTTCCTGTGGAGG - Intronic
1044903586 8:96974986-96975008 TCTTCGTCATTTTCTTCTGCTGG - Intronic
1048913018 8:139154174-139154196 TCCAAGTCATTTTCCTAGGCAGG - Intergenic
1053190987 9:36068473-36068495 TTTAAGTTATTTTCACCTGGAGG - Intronic
1053208112 9:36205206-36205228 TCCTGGTCACTTTCCTCTGGGGG + Intronic
1054743560 9:68832416-68832438 TGAAAGTCATTTTCCTCTATGGG + Intronic
1059783458 9:117554053-117554075 TCTGAGTCATTTTTACCTGGGGG + Intergenic
1059822322 9:117986839-117986861 TCGAAGTCATGTTCCTGTCGTGG + Intergenic
1060805914 9:126576419-126576441 TCAATGTCAATTTCCTGTGGTGG + Intergenic
1188884708 X:35535133-35535155 TTTAATTTATTTTCCTATGGGGG - Intergenic
1188912109 X:35862320-35862342 TCCAAGTGATTTGACTCTGGGGG + Intergenic
1189090832 X:38081100-38081122 TGAAAGTAATTTTCCTTTGGAGG - Intronic
1190103502 X:47541584-47541606 TTTAATGCATTTTCCTCTGAAGG - Intergenic
1190862943 X:54360761-54360783 TCTAATTCATTTTTTTCTAGAGG + Intergenic
1191250536 X:58258059-58258081 TCAAAGTCCCCTTCCTCTGGGGG - Intergenic
1191251362 X:58261648-58261670 TCAAAGTCCCCTTCCTCTGGGGG - Intergenic
1195816957 X:108898408-108898430 GCTAAGTAATTTTTCTCTAGTGG - Intergenic
1197325315 X:125085676-125085698 TCTTTGTCATTTTCCTTTAGAGG + Intergenic
1198920933 X:141725942-141725964 TCCAAGTCACTTTCCTGTGATGG - Intergenic