ID: 919976278

View in Genome Browser
Species Human (GRCh38)
Location 1:202615129-202615151
Sequence AGCTCTAAGTCATTTTCCTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 205
Summary {0: 1, 1: 2, 2: 1, 3: 21, 4: 180}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
919976278_919976283 -4 Left 919976278 1:202615129-202615151 CCAGAGGAAAATGACTTAGAGCT 0: 1
1: 2
2: 1
3: 21
4: 180
Right 919976283 1:202615148-202615170 AGCTGCAGAGAGGGAATGTGGGG 0: 3
1: 0
2: 2
3: 37
4: 526
919976278_919976282 -5 Left 919976278 1:202615129-202615151 CCAGAGGAAAATGACTTAGAGCT 0: 1
1: 2
2: 1
3: 21
4: 180
Right 919976282 1:202615147-202615169 GAGCTGCAGAGAGGGAATGTGGG 0: 3
1: 0
2: 3
3: 33
4: 449
919976278_919976285 24 Left 919976278 1:202615129-202615151 CCAGAGGAAAATGACTTAGAGCT 0: 1
1: 2
2: 1
3: 21
4: 180
Right 919976285 1:202615176-202615198 ATGAAGCAGCAGCAGCAGATTGG No data
919976278_919976281 -6 Left 919976278 1:202615129-202615151 CCAGAGGAAAATGACTTAGAGCT 0: 1
1: 2
2: 1
3: 21
4: 180
Right 919976281 1:202615146-202615168 AGAGCTGCAGAGAGGGAATGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
919976278 Original CRISPR AGCTCTAAGTCATTTTCCTC TGG (reversed) Intronic
903398943 1:23024779-23024801 TCCTCTGATTCATTTTCCTCAGG + Intronic
906405205 1:45536586-45536608 AGGTCTTAGTCATGTTCCTTTGG + Intergenic
914193291 1:145429365-145429387 ACCACTAAATCATTTTCATCAGG - Intergenic
916974927 1:170065846-170065868 AGCTGTAAGTCATTTCCATCAGG + Intronic
918860027 1:189811895-189811917 AGCTCTGAATACTTTTCCTCAGG + Intergenic
919030551 1:192236778-192236800 CCCTCTAAGCCAATTTCCTCTGG - Intergenic
919052433 1:192527606-192527628 AGCTCTATGCCATTTACTTCTGG + Intergenic
919976278 1:202615129-202615151 AGCTCTAAGTCATTTTCCTCTGG - Intronic
920054034 1:203180040-203180062 ATCTCTGGGTCATTTGCCTCTGG - Intronic
921375934 1:214473684-214473706 AGTACTAGGTCATTTTCCTAAGG + Intronic
921407284 1:214794416-214794438 ATCTCCATGTCATTTTCCACAGG + Intergenic
923522178 1:234743871-234743893 AGCTCGATGTCTTTTTCCCCTGG + Intergenic
923692394 1:236207466-236207488 AGCTCTAAGTCATTTCTGGCAGG - Intronic
1063194883 10:3732093-3732115 AGATCTAAATGAATTTCCTCTGG - Intergenic
1063332279 10:5172796-5172818 AGCTCTAATTAATTGTCCTAAGG - Intergenic
1064837544 10:19550623-19550645 AGCTAGAAGCCATTATCCTCAGG - Intronic
1065399614 10:25283114-25283136 AGCTCTAAATGATTTCACTCTGG - Intronic
1065839538 10:29690056-29690078 AGGTCTTGGTCATTTTCCTCTGG - Intronic
1068380718 10:56250602-56250624 AGCTCAAAACCATTATCCTCAGG - Intergenic
1068559555 10:58498253-58498275 AGTTCTAACTCATTTTCTTTGGG - Intergenic
1070956757 10:80469013-80469035 AGCTCTCAGTCCTTCCCCTCTGG + Intronic
1071036946 10:81258772-81258794 AATTCTAAGTCATTTTGCTCAGG + Intergenic
1072893814 10:99348415-99348437 TGCACAAAATCATTTTCCTCCGG - Intronic
1077858274 11:6151247-6151269 AAATCTAAGACATCTTCCTCAGG + Intergenic
1078392150 11:10944538-10944560 AATTCTAAGTCCTTTTCTTCTGG - Intergenic
1078502150 11:11890873-11890895 AGCTGGAAGTCATTATTCTCAGG + Intronic
1079920400 11:26427114-26427136 ACCTCTATGTCATTTTACTAAGG + Intronic
1080007340 11:27423994-27424016 AACTCTCAGTCATCTTTCTCTGG - Intronic
1080217488 11:29861923-29861945 ATCTCAAAGTCACTTTCCACAGG - Intergenic
1082182238 11:49133609-49133631 AGCTCTAGCTCAGCTTCCTCAGG - Intergenic
1083345802 11:61991124-61991146 AGCTCGAAGCCATTATCCTCAGG + Intergenic
1083705751 11:64513441-64513463 ATCTCTAAGACATTTTTCTAAGG - Intergenic
1084310666 11:68314312-68314334 AGCTATAATTCTTTCTCCTCAGG - Intronic
1086683270 11:89701337-89701359 AGCTCTAGCTCAGCTTCCTCAGG + Intergenic
1086972147 11:93093525-93093547 AGTTTTAAGTCCTTTCCCTCTGG + Intergenic
1087287478 11:96280761-96280783 AGCTAAAAGTCCTTTCCCTCTGG + Intronic
1087445931 11:98253400-98253422 AGCTGGAAGCCATTATCCTCAGG - Intergenic
1089771619 11:120807253-120807275 AGCTCTAATTCATTAACCGCAGG - Intronic
1090034192 11:123234130-123234152 AGATCTGAGTCAAGTTCCTCAGG - Intergenic
1093477496 12:19572479-19572501 AGCTCTAAGATTCTTTCCTCAGG + Intronic
1094793526 12:33942738-33942760 ATCTCCAAGTAATTTCCCTCAGG + Intergenic
1095104799 12:38219486-38219508 ATCTCCAAGTAATTTCCCTCAGG + Intergenic
1096257804 12:50073603-50073625 TGCTCCATGTCATTCTCCTCTGG + Intronic
1096807965 12:54151779-54151801 GGGTCTATGTCGTTTTCCTCCGG - Intergenic
1099251489 12:80260783-80260805 AGCTCTAAGTCAGTTCCACCTGG + Intronic
1099894601 12:88629295-88629317 AGCTCTATGTTGTTTGCCTCTGG + Intergenic
1100106017 12:91173274-91173296 AGCTGTGATTCATTTTCCTTTGG - Intronic
1104608816 12:130211011-130211033 AGCTCTAAGCCAACTTTCTCAGG - Intergenic
1107524594 13:41217687-41217709 ACCTTTCAGTCTTTTTCCTCTGG - Intronic
1107723890 13:43277716-43277738 AGCTCTAAGTCCTTGTTCTCTGG - Intronic
1109096744 13:58128387-58128409 AGCTGGAAGGCATTATCCTCAGG - Intergenic
1109593026 13:64512208-64512230 AACTCTAGGTCATTATCCTTAGG - Intergenic
1112547879 13:100389353-100389375 AGCTGGAAGTCATTATCCTTAGG + Intronic
1113542465 13:111119660-111119682 AGCCCTAGGTGATTTTCCACAGG + Intronic
1114563966 14:23614585-23614607 CTCTCTGGGTCATTTTCCTCAGG + Intergenic
1116306952 14:43268201-43268223 AGAGCTAATTCATTTTTCTCCGG - Intergenic
1118426897 14:65675307-65675329 ATCTCTAATTCACTTTCCCCAGG - Intronic
1118532805 14:66725991-66726013 ATCTCTAAATCAGTTTCTTCTGG + Intronic
1123004174 14:105313658-105313680 AGCTCCAGGTCAATTTGCTCGGG + Exonic
1124491925 15:30163476-30163498 AGCTCTAAGTCATCTTCCTCTGG - Intergenic
1124751612 15:32374841-32374863 AGCTCTAAGTCATCTTCCTCTGG + Intergenic
1126743491 15:51801485-51801507 ATCTGTAAGACAGTTTCCTCAGG + Intronic
1128913367 15:71537188-71537210 AGCTCTTAGCCCTTTTCATCTGG + Intronic
1130736243 15:86553293-86553315 AACTCTGAGTCATTGTCCTCTGG + Intronic
1131620317 15:94061286-94061308 AGTTCAAAGTCAGTTACCTCAGG - Intergenic
1131682796 15:94741751-94741773 CGCTCTAAGTTCTTTTCCTCTGG + Intergenic
1135083298 16:19454389-19454411 AACTCTTAGTCATTTCACTCTGG - Intronic
1135715824 16:24765665-24765687 AGCTCAAAGACATCTTCCACAGG - Intronic
1138721152 16:59081957-59081979 ATCTCCAAGTTATTTTCCACAGG - Intergenic
1140111710 16:72010372-72010394 AGCTTTAAGTCATTTCCTTAAGG + Intronic
1143725214 17:8839808-8839830 AGCTCTAAGTCGATTACTTCGGG - Intronic
1149575475 17:57708631-57708653 AGCTCTAAGTCATATCCCCTAGG + Intergenic
1152565114 17:81096895-81096917 AGCGCGAAGTACTTTTCCTCTGG - Intronic
1156130602 18:33968485-33968507 AGCTGTAGGTCATTATCCTAAGG + Intronic
1157076701 18:44474714-44474736 TGCAATAAGTCATCTTCCTCTGG - Intergenic
1158861933 18:61601260-61601282 AGTTTTAATTCATTTTCCTGAGG - Intergenic
1162604712 19:11697718-11697740 AGCTTAAAGTCACTGTCCTCAGG + Intergenic
1163046238 19:14644622-14644644 AGCTCATTGTCTTTTTCCTCAGG + Intronic
1164600311 19:29558573-29558595 AGCTGGAAGCCATTATCCTCAGG + Intronic
1165458183 19:35927192-35927214 AGCTCAAATTCATCTCCCTCAGG + Intergenic
1165827989 19:38716521-38716543 TGCTCTTAGTCTTTTCCCTCAGG - Intronic
1166919479 19:46219448-46219470 AGATCAAAGTCATATGCCTCAGG + Intergenic
1167298142 19:48663838-48663860 ACCTCTTAGTCATTTCCCCCAGG + Intronic
1167840497 19:52113740-52113762 AGCTGGAAGCCATTATCCTCAGG - Exonic
925843297 2:8012433-8012455 TGCTCTAAGTCAGGTTCCTCAGG - Intergenic
926402223 2:12509124-12509146 AGCTGGAAGCCATTATCCTCAGG - Intergenic
928145281 2:28768638-28768660 AGCAGTAACTCATTTTCCTGAGG - Intronic
928180697 2:29066392-29066414 AGCTCTCAATCAGTTGCCTCAGG + Intronic
929797297 2:45069925-45069947 GCCTCTAAGTCAATTTCCTGGGG + Intergenic
930497843 2:52171755-52171777 AGATCAAAATCATTTACCTCTGG + Intergenic
930853273 2:55984957-55984979 TGCTCTATGTGATCTTCCTCAGG + Intergenic
932613275 2:73215167-73215189 AGCTCTAAGACTTTTGACTCTGG - Intronic
933546940 2:83726271-83726293 AGATATAAGTCATTTTGCTGGGG + Intergenic
935153698 2:100463249-100463271 AGCTAGAAGCCATTATCCTCAGG - Intergenic
936170264 2:110164846-110164868 AGCTCTACCTCGTTTTCATCTGG - Intronic
936347506 2:111686517-111686539 AGAAATAAGTCATTTTTCTCTGG + Intergenic
936531174 2:113277967-113277989 ACCTCTAAGTCCTCTTCCTCGGG - Intronic
937755082 2:125527314-125527336 ACCTCTAGGTCATTTTTCTTAGG + Intergenic
942263425 2:174194860-174194882 AACTCTATGTCATCATCCTCTGG + Intronic
942865094 2:180663924-180663946 ACCCCTAGGTGATTTTCCTCTGG + Intergenic
943499819 2:188673543-188673565 AGCTGTCAATCATTTTCTTCTGG + Intergenic
943916180 2:193635260-193635282 AGTTCTAAATAATTTTCCTGTGG - Intergenic
945402150 2:209396746-209396768 AGCTTTTAGTCATTTACATCTGG + Intergenic
947260115 2:228211590-228211612 AGGTATAATTCATTTTCCTATGG + Intergenic
948712418 2:239833379-239833401 AGCTCTCAGCCATGTTCCTCCGG - Intergenic
1169680177 20:8203504-8203526 AGCCCAAACTCATTTTCCTTAGG - Intronic
1170391565 20:15880534-15880556 AGCTCTAAGCCAGTTACCACTGG + Intronic
1170613902 20:17934297-17934319 TGCTCTTGCTCATTTTCCTCGGG - Intergenic
1170819632 20:19745407-19745429 AGCTCTAAAACATTTTCTTTAGG - Intergenic
1171120851 20:22568077-22568099 AGCTCGAACTCCTTTTCCTCTGG - Intergenic
1173047281 20:39524758-39524780 AGCTAAAAGTCATTTTCCAGAGG - Intergenic
1173141139 20:40484124-40484146 AGCTCCATTTCATTTTCTTCTGG + Intergenic
1173507766 20:43602112-43602134 AGCTCAAAGTCCATTTCCTCTGG - Intronic
1175014574 20:55775458-55775480 AGGTCCGAGACATTTTCCTCTGG + Intergenic
1175527664 20:59646694-59646716 AGCTCCGAGTCATGTTCCTGGGG - Intronic
1177118413 21:17112637-17112659 AGCTGGAAGCCATTATCCTCAGG + Intergenic
1178715691 21:34962315-34962337 AGTTCTCAGTCCTTTGCCTCAGG - Intronic
1180619296 22:17149457-17149479 AGCTCCAAGTCCCTTTCCCCTGG - Intronic
1182088205 22:27575925-27575947 TGCCCTAAGACATTTTTCTCTGG - Intergenic
1182186091 22:28404033-28404055 AGCTATGTGTCATTTGCCTCTGG - Intronic
1183036530 22:35144744-35144766 AACTGGATGTCATTTTCCTCAGG - Intergenic
1183772045 22:39935059-39935081 ATCTCCTGGTCATTTTCCTCAGG - Intronic
949644113 3:6073308-6073330 ATCTCTATGTGATCTTCCTCCGG + Intergenic
949654376 3:6200151-6200173 AGCTGGAAGTCATTATCCTCAGG + Intergenic
949703236 3:6783708-6783730 AACACTAAGACATTTTGCTCTGG - Intronic
951542951 3:23800009-23800031 AGCTCTAATCCCTTTTCCTCTGG + Intergenic
952552638 3:34496531-34496553 AGCTCCATGCCTTTTTCCTCTGG - Intergenic
954062344 3:48078764-48078786 AGCTCTCAGTCATTTTCTTATGG - Intronic
954740572 3:52746715-52746737 TGCTGTAAGTCATTTTGCTTTGG - Exonic
954982236 3:54756783-54756805 AGATCTCAGACACTTTCCTCTGG + Intronic
955076460 3:55618176-55618198 AGCTCTCAGTATTTTTCTTCTGG - Intronic
955268118 3:57467655-57467677 GACACTAAGTCATTTTCCTATGG - Intronic
956634659 3:71351847-71351869 ATCTTTGAGTCATTTTTCTCTGG - Intronic
957489253 3:80902536-80902558 TTCTCTAAGTCAATTTCCTAAGG + Intergenic
958985682 3:100777090-100777112 AACTCTAGGTCATTTTCCCATGG - Intronic
960452539 3:117828015-117828037 AGCTCTACTTCATTTTACTGTGG + Intergenic
962897171 3:139726037-139726059 AGCTCTAAGTCATCTTTTTATGG - Intergenic
963999367 3:151750998-151751020 AGCTCTAAGTAAATTTTCTTAGG + Intronic
964247550 3:154670729-154670751 ACTTCTAAGTGATCTTCCTCAGG - Intergenic
967669102 3:192211118-192211140 AGCTTTCAGTCCTTCTCCTCTGG - Intronic
969317093 4:6388889-6388911 AGCTCTGTGTCAGTTTCCTAGGG - Intronic
970014473 4:11498234-11498256 ATCTCAAAGTCAGCTTCCTCGGG - Intergenic
973738810 4:53900073-53900095 TTCTTTACGTCATTTTCCTCTGG + Intronic
976326767 4:83780376-83780398 ACCTGTAAGTCATTTTTCACAGG + Intergenic
976989721 4:91350533-91350555 ATCTATACATCATTTTCCTCTGG - Intronic
977483270 4:97607573-97607595 ACCTGTAAGTCATTTTCCTAAGG - Intronic
979757039 4:124353779-124353801 AAATCTAAGCCATTTTCATCTGG - Intergenic
980524838 4:133976234-133976256 AGCTGAAAGCCATTATCCTCAGG - Intergenic
981559924 4:146036409-146036431 TGCTCTTTGTCATTTTCCTATGG - Intergenic
982170018 4:152652765-152652787 AACTCTAACTGATTTTCATCCGG + Exonic
982515261 4:156338767-156338789 AGCTCTGAGCCATTTTGCTTTGG + Intergenic
988656829 5:33221015-33221037 AGCTGGAAGCCATTATCCTCAGG + Intergenic
988694944 5:33612542-33612564 AGCTCTAAGTCATTTGTCTCAGG - Intronic
995625615 5:114072993-114073015 TACTCTAAGTGATTTTTCTCTGG + Intergenic
998370382 5:141656810-141656832 TGCTCTAAGACCTTTTCCTTGGG + Exonic
998734189 5:145116442-145116464 AGCTCGAAGGGTTTTTCCTCAGG - Intergenic
999052643 5:148540083-148540105 AGCTATAGGCCATTATCCTCAGG + Intronic
999508053 5:152218859-152218881 AGCTGTCAGTCTTGTTCCTCAGG - Intergenic
1002021555 5:176366942-176366964 TGCTGGAACTCATTTTCCTCTGG - Intronic
1003049590 6:2767043-2767065 ATCTGCAAGTCATTTTCATCCGG + Intronic
1004287264 6:14333127-14333149 AGCTCTAAGTCATCTTCACATGG + Intergenic
1005221447 6:23593265-23593287 ATCTCCAAGTCCATTTCCTCAGG - Intergenic
1005700180 6:28393046-28393068 AGCTACATCTCATTTTCCTCAGG - Exonic
1008005854 6:46408226-46408248 AGCTCTACATAATTTTGCTCAGG + Intronic
1008015104 6:46509819-46509841 AGGTCAAAGTAATTTTCCACAGG + Intergenic
1010484908 6:76398996-76399018 AGTTTTAATTTATTTTCCTCTGG + Intergenic
1014457666 6:121655051-121655073 AGCTATAAGTCATTGTAGTCAGG + Intergenic
1015328943 6:131954886-131954908 GGCTCTGAGTCACATTCCTCCGG - Intergenic
1024914567 7:54484728-54484750 CGGTCTCAGTCATTTCCCTCAGG + Intergenic
1027256525 7:76434236-76434258 AGCTCTAAGTCATTTGCTTAGGG - Intronic
1027282369 7:76618080-76618102 AGCTCTAAGTCATTTGCTTAGGG + Intronic
1030575922 7:111285735-111285757 AACTGTAAGTCAATTTCCTGAGG + Intronic
1034436593 7:151065540-151065562 AGTTCAAAGTCATTTTCTCCAGG - Intronic
1037915866 8:22773167-22773189 AGCACTAATTGGTTTTCCTCTGG + Intronic
1038258921 8:25976454-25976476 AACTCTGTGTCATTTTCCTAAGG - Intronic
1039463215 8:37762983-37763005 GGCACTAAGTCATTTTCCCGAGG - Intronic
1039825804 8:41173271-41173293 AGCTCTAAGAGGTTTTCCTTGGG - Intergenic
1041273940 8:56138198-56138220 AGCTGGAAGCCATTATCCTCAGG - Intergenic
1041462872 8:58131144-58131166 ACCTATAAGTCATTATTCTCTGG + Intronic
1043618828 8:82162344-82162366 ATCTCTAAGTGCTTTGCCTCTGG - Intergenic
1046124658 8:109889911-109889933 TGCTCTAAGGCATATTCCTCAGG + Intergenic
1046165552 8:110429802-110429824 AGCACTAAAGCATTTTCCACAGG + Intergenic
1046768599 8:118097032-118097054 AGCTCAATGTCATTTTCCCAAGG + Intronic
1050284054 9:4082461-4082483 AGATATAAGCCATTTTGCTCAGG + Intronic
1052501850 9:29301934-29301956 AGCTGGAAGCCATTATCCTCAGG + Intergenic
1055286518 9:74734456-74734478 AGCTCTAGGTTATTTTTCTAAGG - Intronic
1055741160 9:79391246-79391268 ACCTCAAAGTCATTTTCTTAGGG - Intergenic
1056215738 9:84404440-84404462 AGTTCTCAGTCATTCTCCTCTGG + Intergenic
1056508413 9:87279750-87279772 AGCTCTAAGTCATTGACTTGAGG + Intergenic
1057498266 9:95577197-95577219 TTCTCTGAGTCATTTTGCTCAGG + Intergenic
1058187455 9:101871550-101871572 AGCTGGAAGCCATTATCCTCAGG - Intergenic
1059330028 9:113529008-113529030 AGCTCTAAGGCATTTGCCTGCGG - Intronic
1059866212 9:118517067-118517089 GGCTCAAAGTCCTTTTCCTTCGG - Intergenic
1060540864 9:124429220-124429242 AGCTCTGAGTCATTTTTCCTTGG - Intergenic
1187276197 X:17818258-17818280 AGCCCTGAGTCATGTACCTCTGG - Intronic
1187356560 X:18578699-18578721 TCCTCTAAGTGCTTTTCCTCAGG + Intronic
1188569655 X:31568031-31568053 ACCTTTAAATCATTTTCCCCAGG - Intronic
1190467797 X:50743998-50744020 TGTGATAAGTCATTTTCCTCTGG + Intronic
1192214341 X:69148016-69148038 TGCTAGAAGTCATTTTTCTCTGG + Intergenic
1193911429 X:87310999-87311021 AGCTCCATGTCTTTTCCCTCTGG - Intergenic
1195618512 X:106931334-106931356 GGCTGTGAGTTATTTTCCTCAGG - Intronic
1197534899 X:127675317-127675339 AGCTGGAAGCCATTATCCTCAGG - Intergenic
1198052419 X:132961720-132961742 AGGTCTAAGTCATTCCCCCCGGG - Intergenic
1198079624 X:133226965-133226987 AGCTGAAAGCCATTATCCTCAGG - Intergenic
1201363060 Y:13174601-13174623 AGCTGTAAGTCTTCTTCCTGGGG - Intergenic