ID: 919976285

View in Genome Browser
Species Human (GRCh38)
Location 1:202615176-202615198
Sequence ATGAAGCAGCAGCAGCAGAT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
919976278_919976285 24 Left 919976278 1:202615129-202615151 CCAGAGGAAAATGACTTAGAGCT 0: 1
1: 2
2: 1
3: 21
4: 180
Right 919976285 1:202615176-202615198 ATGAAGCAGCAGCAGCAGATTGG No data
919976277_919976285 27 Left 919976277 1:202615126-202615148 CCACCAGAGGAAAATGACTTAGA 0: 1
1: 0
2: 1
3: 17
4: 172
Right 919976285 1:202615176-202615198 ATGAAGCAGCAGCAGCAGATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
919976285 Original CRISPR ATGAAGCAGCAGCAGCAGAT TGG Intronic
No off target data available for this crispr