ID: 919977344

View in Genome Browser
Species Human (GRCh38)
Location 1:202621259-202621281
Sequence AAGGAGAAAACAAATGAGGG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1324
Summary {0: 2, 1: 2, 2: 6, 3: 129, 4: 1185}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
919977338_919977344 -10 Left 919977338 1:202621246-202621268 CCTCAGCCTTGCAAAGGAGAAAA 0: 1
1: 0
2: 6
3: 42
4: 436
Right 919977344 1:202621259-202621281 AAGGAGAAAACAAATGAGGGGGG 0: 2
1: 2
2: 6
3: 129
4: 1185
919977331_919977344 22 Left 919977331 1:202621214-202621236 CCCTCTGGTACTTCAGAACCCTG 0: 3
1: 0
2: 1
3: 18
4: 215
Right 919977344 1:202621259-202621281 AAGGAGAAAACAAATGAGGGGGG 0: 2
1: 2
2: 6
3: 129
4: 1185
919977330_919977344 25 Left 919977330 1:202621211-202621233 CCACCCTCTGGTACTTCAGAACC 0: 3
1: 0
2: 1
3: 12
4: 146
Right 919977344 1:202621259-202621281 AAGGAGAAAACAAATGAGGGGGG 0: 2
1: 2
2: 6
3: 129
4: 1185
919977332_919977344 21 Left 919977332 1:202621215-202621237 CCTCTGGTACTTCAGAACCCTGG 0: 3
1: 0
2: 0
3: 15
4: 156
Right 919977344 1:202621259-202621281 AAGGAGAAAACAAATGAGGGGGG 0: 2
1: 2
2: 6
3: 129
4: 1185
919977335_919977344 4 Left 919977335 1:202621232-202621254 CCCTGGAGCTGGATCCTCAGCCT No data
Right 919977344 1:202621259-202621281 AAGGAGAAAACAAATGAGGGGGG 0: 2
1: 2
2: 6
3: 129
4: 1185
919977336_919977344 3 Left 919977336 1:202621233-202621255 CCTGGAGCTGGATCCTCAGCCTT 0: 3
1: 0
2: 3
3: 28
4: 263
Right 919977344 1:202621259-202621281 AAGGAGAAAACAAATGAGGGGGG 0: 2
1: 2
2: 6
3: 129
4: 1185

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
919977344 Original CRISPR AAGGAGAAAACAAATGAGGG GGG Intronic
900125743 1:1068324-1068346 AAGGAAAAACCAAATGTGAGGGG - Intergenic
900874082 1:5329098-5329120 AAGGAGAAAACAAATGGACATGG + Intergenic
901053818 1:6439518-6439540 AAGGGGGAAATAAATCAGGGTGG + Intronic
901074685 1:6546424-6546446 AAGGAGAGAAGAAATGAGAGTGG - Intronic
901120278 1:6886079-6886101 AAGGAAAACAAAAATAAGGGAGG - Intronic
901125620 1:6926406-6926428 AAAGAGAAAAGAAAAGAGAGAGG - Intronic
901475437 1:9486175-9486197 AAGGAGCAACCAGATGAGGTGGG - Intergenic
901519065 1:9768922-9768944 AAGGAGAAAGGGAAAGAGGGAGG + Intronic
901743427 1:11356987-11357009 AAGAAAGAAAGAAATGAGGGTGG - Intergenic
902160888 1:14529591-14529613 GAGGACAGAAAAAATGAGGGAGG + Intergenic
902480478 1:16708811-16708833 AAGGGGGAAATAAATCAGGGTGG - Intergenic
902712678 1:18251139-18251161 AAGGGGAACACAAGTCAGGGCGG + Intronic
902966445 1:20007957-20007979 AAAGAGTAAAGAGATGAGGGAGG - Intergenic
903088280 1:20883723-20883745 AAGGAGAAAACACTTTAGGAAGG + Intronic
903170836 1:21552141-21552163 AAGGAGAAAAGGAAGGAGGGAGG - Intronic
903731603 1:25500420-25500442 AGGGAGAAAACAAATGAGAATGG - Intergenic
903793183 1:25908324-25908346 AGGGAGAAAGAAAATGTGGGGGG - Intergenic
903850939 1:26305769-26305791 AAGGAGAGAAAAAATGTGGTTGG - Intronic
904104715 1:28069575-28069597 AAGAAGAAAAAAAAAGAGGGTGG + Intronic
904887414 1:33751286-33751308 TAGGAGAAAACACAGGAGAGTGG + Intronic
904889181 1:33765267-33765289 AAAGAGAAAATAATTCAGGGAGG + Intronic
905785104 1:40749216-40749238 AAGGAGAAACAATATGAGGAAGG - Intronic
905984624 1:42268013-42268035 AAGGAGAAAAAAAAGGAATGGGG + Intronic
906011827 1:42534205-42534227 AAAGACAAAGAAAATGAGGGGGG + Intronic
906065337 1:42976454-42976476 AAGAAAGAAAGAAATGAGGGAGG + Intergenic
906562390 1:46768675-46768697 AAGGAGAAAAGAAGAGAGGGAGG + Intronic
906800830 1:48735539-48735561 AAGGAAAAAGGAAAGGAGGGAGG + Intronic
907579132 1:55556126-55556148 AATGAGAAAGCAAATGGGGCAGG - Intergenic
907877080 1:58501533-58501555 AAGAAGAAAACCAGTGTGGGTGG - Intronic
907915127 1:58861323-58861345 AAGGAGGGAAGAAGTGAGGGAGG + Intergenic
907948252 1:59155439-59155461 ATGGAGAAAACAAGTATGGGTGG + Intergenic
907996070 1:59633961-59633983 AACAAGAGAACAAATGAGGAAGG + Intronic
908179556 1:61590287-61590309 AAGCAGAAAAGAAAAAAGGGAGG - Intergenic
908312878 1:62903081-62903103 AGGGAGAAAGCAAATGAAGATGG - Intergenic
908359757 1:63357437-63357459 AAGGAAAAAAGAAAGAAGGGAGG - Intergenic
908499518 1:64729294-64729316 AAGGAGAGAAGAAAGGAAGGAGG + Intergenic
908634277 1:66145181-66145203 GATGAGAAAACAAAGTAGGGTGG + Intronic
908836295 1:68232307-68232329 AAGGAGAAAAGAAAAAGGGGGGG - Exonic
908993784 1:70127509-70127531 AAGGAGAAAAGACCTGAGAGAGG + Intronic
909290992 1:73882955-73882977 AAGTAGAAAACAACTTAGGAAGG - Intergenic
909460610 1:75908980-75909002 AAGGAGACACCAAATCAGTGTGG - Intronic
909470989 1:76027878-76027900 AAGGAGAAGCCAAATCAGAGTGG + Intergenic
909655671 1:78029332-78029354 AAGGAGACTACAAAGGAGGTAGG - Intronic
909813654 1:79962774-79962796 AAGGAGAAAGGATATGAGAGAGG + Intergenic
910594148 1:88960477-88960499 AAGGACAAAGCAAATGCTGGAGG + Intronic
910660892 1:89671309-89671331 AAGGAGAAAAGGAAAGAGGAAGG + Intronic
911181439 1:94864031-94864053 AAAGATAAAACAAAGGAGTGGGG - Intronic
911219263 1:95229989-95230011 AAAGAGAAAAAAAAAGAGGTAGG - Intronic
911259971 1:95674195-95674217 AAATAGAAAACTAAGGAGGGAGG - Intergenic
911265638 1:95740123-95740145 AAGAAGAAAACAAATAAGGAAGG - Intergenic
911397622 1:97331612-97331634 AAGGAGAAAAGCAAAGAAGGAGG + Intronic
911890708 1:103368156-103368178 AAGGAGAAAACAGGTGTTGGAGG - Intergenic
912016100 1:105038465-105038487 AAGGAAGAAAAAAATGAGGAGGG - Intergenic
912740117 1:112186602-112186624 AAGGAGAATACAAAGAAGGGAGG - Intergenic
912782306 1:112562542-112562564 AAGGAGACAACAGATGAGCAGGG + Intronic
912807814 1:112771889-112771911 AAGGGGAAAAGTAGTGAGGGAGG - Intergenic
913456771 1:119040442-119040464 AATAAGAAAACACATGAGCGTGG - Intronic
913588136 1:120296630-120296652 TAGCAGAAATCAAATGAAGGTGG + Intergenic
913620049 1:120601739-120601761 TAGCAGAAATCAAATGAAGGTGG - Intergenic
913645313 1:120849311-120849333 AAAGAGAAAACTACTGAGGAAGG - Intergenic
914081416 1:144414228-144414250 AAAGAGAAAACTACTGAGGAAGG + Intergenic
914176325 1:145282767-145282789 AAAGAGAAAACTACTGAGGAAGG + Intergenic
914531052 1:148524253-148524275 AAAGAGAAAACTACTGAGGAAGG + Intergenic
914570153 1:148908503-148908525 TAGCAGAAATCAAATGAAGGCGG + Intronic
914602675 1:149221766-149221788 TAGCAGAAATCAAATGAAGGCGG - Intergenic
914713874 1:150238221-150238243 AAGGGGAAAAGAGAAGAGGGAGG + Intergenic
914871495 1:151478763-151478785 CAATACAAAACAAATGAGGGAGG + Intergenic
915369447 1:155336121-155336143 GAGGAAAAAACAAAAGAGAGAGG - Exonic
915467291 1:156105058-156105080 AATGAGAAAACCACTGGGGGAGG - Intronic
915713390 1:157922336-157922358 AAGAATAGAAGAAATGAGGGAGG + Intergenic
915880373 1:159664821-159664843 AAGGAGACACCAAATCAGAGTGG - Intergenic
916372030 1:164109200-164109222 AAGGAAAAAACAGAAAAGGGAGG - Intergenic
916435909 1:164777595-164777617 TAGTAGCAAACAAAGGAGGGCGG + Intronic
916506274 1:165430653-165430675 AAGGAGAAAACACATGCTGTGGG + Intronic
917043379 1:170830876-170830898 AAGAAGAAAAGAAAGGATGGAGG - Intergenic
917115819 1:171602077-171602099 AAAGAGAAAAAAAAGGGGGGAGG + Intergenic
917268949 1:173252223-173252245 AAATAGAAAAGAAAGGAGGGAGG + Intergenic
917663835 1:177204481-177204503 AAGCAGAAAAAAAAAGAGAGTGG + Intronic
917857138 1:179109938-179109960 AAAGAAAAAAAAAATGGGGGAGG + Intronic
919547384 1:198940689-198940711 GAGGAGAAAAGGAATGAAGGGGG - Intergenic
919977344 1:202621259-202621281 AAGGAGAAAACAAATGAGGGGGG + Intronic
920021743 1:202961636-202961658 AAGGAGAACACACATTAGAGGGG - Intergenic
920189222 1:204181775-204181797 AAGGAGAAGAGAAAAGAGGAAGG - Intergenic
920573348 1:207035160-207035182 AAGGAGAGAACAGATGAGTCAGG - Intronic
920821113 1:209381895-209381917 TATGAAAAAACAAATGAGGCTGG - Intergenic
921263492 1:213404000-213404022 TAGGAGAAGGCAGATGAGGGAGG + Intergenic
921325938 1:213986339-213986361 AAGGAGAAAAAAAATTAGGTCGG - Intronic
921548739 1:216506654-216506676 AAGAAGCAAAGAAATAAGGGAGG + Exonic
921756640 1:218864588-218864610 AAGGAGAGAAGAAAGGAGGGAGG - Intergenic
921799053 1:219380848-219380870 AGTGAGAAAACAAATGGGAGAGG + Intergenic
922129354 1:222761620-222761642 AAGGAGAAAAGGAAGGAAGGAGG - Intergenic
922812764 1:228426990-228427012 AAGGAGAAAGGAAGGGAGGGAGG - Intergenic
922865706 1:228859861-228859883 AAGGAAAAATAAAAGGAGGGAGG + Intergenic
922974318 1:229771020-229771042 TAGGAGAAAACAATTGAGGGAGG + Intergenic
923222380 1:231907091-231907113 AAGGAGAGAAGGAAGGAGGGAGG - Intronic
923398194 1:233588402-233588424 AGGGAGAAAGCAAAGGAAGGCGG - Intergenic
923639031 1:235733298-235733320 AGGAAGAAAAGTAATGAGGGGGG - Intronic
923821455 1:237447853-237447875 AAAGAAAAAAGAAAAGAGGGAGG - Intronic
923865778 1:237938108-237938130 GAGCAGAACACAAGTGAGGGAGG + Intergenic
924222143 1:241888752-241888774 AAAGAGAAAACAACCGAGAGGGG + Intronic
924443946 1:244111101-244111123 AAGGAGAGAAAAGAGGAGGGAGG + Intergenic
924788981 1:247226415-247226437 AAGAAGAAAAAGAATGAGTGTGG - Intergenic
924791420 1:247253402-247253424 AGAGAGAAAACAAGTGAGGGAGG - Intergenic
924812171 1:247412692-247412714 AAAAAGAAAAGAAAGGAGGGAGG - Intergenic
1062966043 10:1608585-1608607 AAGGAAAAAAGGAATGAGGAAGG + Intronic
1063306996 10:4911445-4911467 AAAGAGAAAAAAAGTGAGGGGGG - Intergenic
1063307448 10:4918270-4918292 AAAGAGAAAAAAAGTGAGAGGGG + Intergenic
1063737928 10:8782323-8782345 AAGGAAAAGAAAAATGAAGGAGG + Intergenic
1063778932 10:9298651-9298673 AAGAAGAAAAAAAATGTGTGAGG - Intergenic
1063789028 10:9419910-9419932 AAGGAGAAATTACATGAGGCTGG + Intergenic
1064121462 10:12623196-12623218 AGGGAGGAAAGAAAGGAGGGAGG - Intronic
1064121508 10:12623328-12623350 AGGGAGGAAAGAAAGGAGGGAGG - Intronic
1064415007 10:15141480-15141502 AAGGAGAAACCAAATTCCGGAGG - Exonic
1064447276 10:15406932-15406954 AATGGGGAAATAAATGAGGGAGG + Intergenic
1064483793 10:15765137-15765159 AATCAGAGAAGAAATGAGGGTGG + Intergenic
1064839393 10:19573518-19573540 GAAGAGAAAGAAAATGAGGGAGG - Intronic
1064888902 10:20146376-20146398 AAGGAAGAAAGAAAGGAGGGAGG - Intronic
1064953649 10:20882304-20882326 AAGGAGAAAAGAAAGAAGAGGGG + Intronic
1065402140 10:25317528-25317550 AAGAAGAAAACTAATCAGGAAGG - Intronic
1065681353 10:28236564-28236586 ACGGAGAAAAAAAATGAGATCGG + Intronic
1065958637 10:30715285-30715307 AAGAAAAAAAGAAATGAGGCCGG + Intergenic
1066443480 10:35460773-35460795 AAGGAGGAAATAACTGAGTGAGG - Intronic
1066490030 10:35885340-35885362 AATGAGAAACCAAGTTAGGGAGG - Intergenic
1066517730 10:36182588-36182610 AAGGAGAAAACAAAATAGAGAGG - Intergenic
1066950199 10:42110491-42110513 AGGGAGAAAGCAAGGGAGGGAGG - Intergenic
1067070438 10:43126968-43126990 GAGGAAAAAACAGATCAGGGCGG + Intronic
1067107404 10:43375321-43375343 AAGAAGAAAAAAAGTGAGGCTGG - Intronic
1067148570 10:43711248-43711270 AATGAGAAAATAAATGAAAGTGG + Intergenic
1067749067 10:48958048-48958070 AAGGAGAACACTGACGAGGGGGG - Intronic
1068496535 10:57790626-57790648 AAGGAAAAAGAAAATGAGGAAGG + Intergenic
1068571895 10:58638923-58638945 AAGATGAAAGCAAACGAGGGAGG - Intronic
1069169987 10:65214743-65214765 AAGCAGAAAAAAGATGAGAGTGG + Intergenic
1069590877 10:69641137-69641159 AAGGAAGAAAGAAAGGAGGGAGG + Intergenic
1070225201 10:74496969-74496991 AAAGAGAAAAAAAATGAGAGAGG - Intronic
1070316256 10:75315907-75315929 AAATAGAAACCAAAAGAGGGTGG + Intergenic
1070429084 10:76318270-76318292 AAGGAAAAAGAAAAGGAGGGAGG - Intronic
1070520097 10:77245075-77245097 AAGGAAAAAAAAAAACAGGGAGG + Intronic
1070908803 10:80099533-80099555 GAGAAGAAAAGAAAGGAGGGAGG + Intergenic
1070972577 10:80579690-80579712 AAGGAGAAAAAAAAAGGGAGTGG - Intronic
1071148994 10:82610697-82610719 AAGAAGAATACAAATGAGTAAGG - Intronic
1071165521 10:82801785-82801807 AAGGAGAAAACAAATGCCACAGG - Intronic
1071220005 10:83454927-83454949 AAGGAGAAAACAAGTTAAGAAGG + Intergenic
1071455960 10:85851881-85851903 AGGGAGAAAAAAATTGAGGATGG - Intronic
1071822320 10:89291148-89291170 AAGGAAAAAAGGAATGAAGGAGG - Intronic
1071911283 10:90236969-90236991 AAGGAGAAAAAAAAAGAATGGGG - Intergenic
1072000282 10:91188628-91188650 AATGAGAATCCAAATGAAGGCGG - Intronic
1072205581 10:93202276-93202298 AAGGAGAAAAGAAGAGATGGAGG + Intergenic
1072275274 10:93816681-93816703 AAGGAGAAAAGAAGAGAGGCAGG + Intergenic
1072434575 10:95403553-95403575 AAAAAAAAAACAAATGAGGGTGG - Intronic
1072799312 10:98382049-98382071 AAGGAGAAAGGAAGGGAGGGAGG - Intergenic
1072940551 10:99759983-99760005 AAGGAGAAATCAAAGAAAGGGGG + Intergenic
1072965024 10:99964469-99964491 CAGGAGAAAAGAAAGGTGGGGGG - Intronic
1073016385 10:100402982-100403004 AAGATGAAAACAAACAAGGGAGG + Intergenic
1073035338 10:100560964-100560986 TATGAGTAAACAAATGATGGTGG + Intergenic
1073626021 10:105097933-105097955 GAGAAGAAAACAAAGGACGGTGG - Intronic
1073654571 10:105399260-105399282 GAGGAGGATACAAATGGGGGTGG + Intergenic
1074201796 10:111243967-111243989 AAGGAAAAGAAAAATGAGGGAGG + Intergenic
1074831467 10:117252601-117252623 AAGAAGAAAGAGAATGAGGGAGG + Intronic
1074865632 10:117543081-117543103 AAGGAAAAAGGAAAGGAGGGGGG - Exonic
1075023761 10:118968931-118968953 AGGGAGAAAACCCAGGAGGGAGG + Intergenic
1075189081 10:120289516-120289538 AAGGAGAAAGGAGAAGAGGGTGG + Intergenic
1075266320 10:121002099-121002121 AAGGAGAACAGAAGGGAGGGAGG - Intergenic
1075591497 10:123694659-123694681 AAGGAAAAAAGGAAGGAGGGAGG + Intergenic
1076197899 10:128533251-128533273 AAGAAGGAAGAAAATGAGGGAGG + Intergenic
1076241625 10:128912926-128912948 GAGGATAAAACAAATTAGGAAGG + Intergenic
1077372050 11:2186956-2186978 GAGGAGACAAAAGATGAGGGCGG + Intergenic
1077372768 11:2191242-2191264 AGGGAGAAAGCAAAGGAGGAAGG + Intergenic
1078272758 11:9811813-9811835 AAGGTGATAACAAATAATGGGGG + Intronic
1078326164 11:10382893-10382915 GGGGAGAAAACCAAAGAGGGAGG - Intronic
1078390434 11:10931638-10931660 AAGGAGAGAAGAAAAGAGGCAGG + Intergenic
1078595297 11:12681350-12681372 AAGATGAAAGGAAATGAGGGAGG - Intronic
1078841453 11:15079382-15079404 AGGGGGAAAATAGATGAGGGAGG - Intronic
1078964377 11:16320896-16320918 AAGGATAAAATAAATGGGGCAGG + Intronic
1079134646 11:17769503-17769525 AAGGAGAAAGGAAAGGAGGAAGG + Intronic
1079193490 11:18302808-18302830 AAGGAGAAAAAAAGCGGGGGGGG + Intronic
1079388133 11:19998706-19998728 AAGGAGAAAAGGAGAGAGGGGGG - Intronic
1079554892 11:21747130-21747152 AAAAAGTAAAGAAATGAGGGAGG + Intergenic
1079778956 11:24574092-24574114 AGGGATTAAACAAAGGAGGGAGG - Intronic
1080308050 11:30858089-30858111 AGGGAGAAAACAAATGAAACAGG - Intronic
1080533692 11:33200990-33201012 AAAAAGAAAAGAAAGGAGGGAGG - Intergenic
1080928669 11:36784838-36784860 AGGGAGAAAATAATGGAGGGAGG - Intergenic
1081331120 11:41801332-41801354 AAGGAGAAAACAAATGTGGGTGG - Intergenic
1081481076 11:43489744-43489766 AAGGACAAAGGAAAGGAGGGGGG + Intronic
1081516474 11:43835837-43835859 AAGGAGCAAACAAGTAAGGGAGG + Intronic
1081559350 11:44198621-44198643 AATGAGAAACCAAATGCAGGTGG - Intronic
1081947829 11:47014268-47014290 AAAGAGAAAAGAAAGGAAGGAGG + Intronic
1081967561 11:47178826-47178848 AAGGAGAAAGGAAAGGAGGGCGG + Intronic
1082067582 11:47913443-47913465 AAGAAGAAAAGAAAGGAGAGAGG - Intergenic
1082223063 11:49665662-49665684 ACAGAGGAAACAAATGAAGGTGG + Intergenic
1082741493 11:56916531-56916553 AAGGAGATACCCAACGAGGGAGG + Intergenic
1082809714 11:57472152-57472174 AAAGAGAAAACAAGTGTCGGCGG - Intronic
1082893657 11:58166755-58166777 AAGGAGGAAAGAAATGAAGTCGG + Intronic
1083224662 11:61277155-61277177 AAAGAGAGAAAAAAGGAGGGAGG + Intronic
1083481927 11:62954531-62954553 AAAGAGAAAACAAATGACAGTGG + Intronic
1084848046 11:71916263-71916285 AAAGAGAAACAAAATCAGGGGGG + Intronic
1085098654 11:73781653-73781675 AAGGAAAAAAAAAAGTAGGGAGG - Intergenic
1085235165 11:75008994-75009016 AAAGAGAAAAAACATGAGGCAGG - Exonic
1085329912 11:75639744-75639766 AGGGAGAAAACAAGGGAGGGAGG + Intronic
1085847536 11:80083291-80083313 AAGGAGAGAAGAAGGGAGGGAGG - Intergenic
1085894265 11:80618886-80618908 AAAGGGAAAACAAAGGAGAGAGG + Intergenic
1085909999 11:80812041-80812063 AAGGAGAAAAAAAAAGAGAAAGG - Intergenic
1085921558 11:80963938-80963960 AAGGAGAAAACAAAACAGAAAGG - Intergenic
1086026633 11:82301245-82301267 AAGGAGAGAAGAAGAGAGGGAGG + Intergenic
1086088962 11:82985629-82985651 AGAGAGAAAAAAAATGAGAGTGG + Intronic
1086113348 11:83221783-83221805 AAGGAGACACCAAATCAGAGTGG - Intronic
1086319708 11:85632101-85632123 TAGGAGAAAACCATTGAGGGGGG + Intronic
1086625988 11:88953570-88953592 ACAGAGGAAACAAATGAAGGTGG - Intronic
1087324885 11:96709679-96709701 AAGAAGAAAAGAAAGGAGGAAGG - Intergenic
1087820530 11:102706676-102706698 AAGGGGAGGACAAGTGAGGGAGG - Intergenic
1087845845 11:102971577-102971599 AGGGAGAGAGCAAAGGAGGGAGG + Intergenic
1087937703 11:104054608-104054630 GGGGAGAAAACAAATGAAGATGG + Intronic
1088115008 11:106303632-106303654 AAGGAGATAGCAAATGGGTGGGG - Intergenic
1088438422 11:109841352-109841374 AAAGAGAGAACAAGAGAGGGAGG + Intergenic
1088735805 11:112726840-112726862 AAGGAGAAATCAAATGTGCATGG - Intergenic
1089201325 11:116726245-116726267 AAGGAGAAAACAAAGTAGGGAGG + Intergenic
1089233292 11:116999724-116999746 AGGGAGAAAACAAATGAAAATGG - Intronic
1089248409 11:117138851-117138873 AAGGGGAAAAAAAAAGAGGATGG - Intergenic
1089295923 11:117468079-117468101 AAGGAGAGAAAAAAAGAGAGAGG - Intronic
1089307338 11:117535001-117535023 AGGGAGGAAAGAAAGGAGGGAGG - Intronic
1089568478 11:119386111-119386133 AAGGAGGACACAGCTGAGGGAGG - Intergenic
1089746371 11:120620239-120620261 GAGGAGAAAACCTATTAGGGTGG - Intronic
1090200959 11:124855830-124855852 AAGGAGAAAGCAAGTGAAGGAGG - Intergenic
1090214757 11:124952051-124952073 CAGGAGAAAACTAATGATGCGGG - Intergenic
1090725675 11:129525183-129525205 GAGGAGAAAAGAAAAGTGGGCGG + Intergenic
1090995184 11:131859853-131859875 AAGGAGAAAAAAAAAAGGGGAGG - Intronic
1091057957 11:132436489-132436511 AACGAGAAAAAAAATGGAGGAGG - Intronic
1091330868 11:134729996-134730018 AAGGTCAAGACAAATGTGGGTGG - Intergenic
1091632367 12:2171576-2171598 AGGGAGAAAACGAAGAAGGGAGG - Intronic
1091890595 12:4051020-4051042 AAGTAGCAAACAAATGAGCCAGG - Intergenic
1092606588 12:10126950-10126972 AAGAAGAAATAGAATGAGGGAGG + Intronic
1092719801 12:11430603-11430625 AGGGAGAAGACAAGGGAGGGAGG - Intronic
1093142661 12:15527524-15527546 AAGGAGACACCAAATCAGAGTGG + Intronic
1093198030 12:16151963-16151985 AAGGAGAAAGCAAAAGACGGAGG - Intergenic
1093438994 12:19171216-19171238 AAGAAGAAATCAATTGAGAGAGG + Intronic
1093756167 12:22854278-22854300 AAGGAGAGAAAGAAAGAGGGAGG - Intergenic
1093838597 12:23868020-23868042 AAGGAAAAAAGAAAAAAGGGAGG - Intronic
1094219528 12:27976537-27976559 AAGGAGAAAACAAATGCTATGGG + Intergenic
1094469027 12:30785580-30785602 AAGGAGAAAAAAAAAGAGGCTGG + Intergenic
1094492929 12:30972482-30972504 AAGTAGAACACAAATGGGGTTGG + Intronic
1095251848 12:39988644-39988666 AGGGAGAAAAGGAAGGAGGGAGG + Intronic
1095272608 12:40237517-40237539 AATGAGAAGAGAAAGGAGGGTGG + Intronic
1095378746 12:41563527-41563549 ATCTAGAAAACAAATGAGAGTGG - Exonic
1095781690 12:46067143-46067165 CAGGAGCCAGCAAATGAGGGGGG + Intergenic
1095917659 12:47496318-47496340 AAAGAGAAAATAAATGAGAAAGG - Intergenic
1096617689 12:52843391-52843413 AAAAAGAAAAGAAATGAGGCTGG + Intronic
1096757082 12:53808661-53808683 AAGGAACAAAAAAAAGAGGGAGG - Intergenic
1096804405 12:54131616-54131638 AAGAAAAAAAAAGATGAGGGGGG + Intergenic
1096809349 12:54159691-54159713 AGGGAGAAAGGAAAGGAGGGAGG + Intergenic
1096813383 12:54185865-54185887 AGGGAGAAAAGAAATGGGAGAGG + Intronic
1096910273 12:54976539-54976561 AAGGAGGAAAAGAAGGAGGGAGG + Intronic
1096990379 12:55796962-55796984 TAAGAGGAAACAAAAGAGGGGGG + Intronic
1097361910 12:58667559-58667581 GAGGAGAGAAAAAAAGAGGGTGG - Intronic
1097419488 12:59356774-59356796 ATGGAGTAAACAAGTGTGGGAGG - Intergenic
1098096401 12:66961222-66961244 GAGGAGCAAACAAAACAGGGAGG + Intergenic
1098139682 12:67438827-67438849 AAGGAGTAAAGAATAGAGGGGGG - Intergenic
1098199451 12:68039338-68039360 TAGGAGGCAATAAATGAGGGAGG - Intergenic
1098237760 12:68434298-68434320 CAGGAGGAAACAGATGAGTGGGG + Intergenic
1098335102 12:69396073-69396095 AAAGAGTAAACAGATTAGGGTGG - Intergenic
1098639546 12:72823032-72823054 AAGGAAAAAAAAAAAGGGGGAGG - Intergenic
1098705343 12:73681329-73681351 AAGAAGAAAAAAAATGAGATGGG - Intergenic
1098724459 12:73945310-73945332 AAGGGGAAAACAAATTAGTGAGG - Intergenic
1098833390 12:75390975-75390997 GAGGGAAAAACAAAGGAGGGAGG - Intergenic
1099014313 12:77325785-77325807 AAGGAAGAAAGAAATGAGGACGG - Intergenic
1099028190 12:77491987-77492009 AAGGAGAAAAAATATGAGATAGG - Intergenic
1099097372 12:78391381-78391403 AAGGAAAAAACAAAAAAGAGGGG - Intergenic
1099100898 12:78439396-78439418 AAGGAGAGAAAAAAGTAGGGAGG - Intergenic
1099134898 12:78885290-78885312 AAGGAGAGAAGAAAGGAGAGAGG + Intronic
1099711545 12:86232138-86232160 AAAGAAAAAAAAAAGGAGGGGGG + Intronic
1099907855 12:88793080-88793102 AAGGAGAAAAGAACGGAGGAAGG - Intergenic
1100149601 12:91720037-91720059 AGGAAGAAAACAAAAGAAGGAGG + Intergenic
1100174298 12:92011939-92011961 AAGGAAAAAAGGAAGGAGGGAGG + Intronic
1100238711 12:92687694-92687716 AGGGAGGACACAAAAGAGGGAGG - Intergenic
1100310704 12:93392246-93392268 AAGGAAAAAAAAAAGGGGGGGGG - Intronic
1100556146 12:95695919-95695941 AAAGAGAAAAGAAAAGAGGGAGG - Intronic
1100872135 12:98921154-98921176 AAGAAGAAAAGAAAGGAGGAAGG - Intronic
1101053408 12:100887488-100887510 AAGGAGAAACCAAATGACCCTGG + Intronic
1101234957 12:102779088-102779110 AAGCAGAAAAGAAATGGGGCAGG + Intergenic
1101310852 12:103577072-103577094 AAAGAGTAAAAAAATGAGAGAGG - Intergenic
1101357843 12:103997543-103997565 AACGACAAAAGAAATGATGGTGG + Intronic
1101427639 12:104600942-104600964 AAGGAGAGAGGAAAAGAGGGAGG - Intronic
1101887938 12:108684647-108684669 AAGGAGAAAATAAATAAGAATGG + Intronic
1102096352 12:110244470-110244492 AAGAAAGAAAGAAATGAGGGTGG + Intergenic
1102159355 12:110756067-110756089 AAAGAGAAAAAAAAAAAGGGCGG - Intergenic
1102661323 12:114531372-114531394 AAGAAGGAAGAAAATGAGGGTGG + Intergenic
1103151859 12:118647787-118647809 AAGGAGAAAAGAAATATGGAAGG + Intergenic
1104335419 12:127890014-127890036 CAGGTGAAAACTAATTAGGGAGG + Intergenic
1104683553 12:130768972-130768994 AAGGAAAAGAAAAATGAGGCCGG + Intergenic
1105705039 13:22963317-22963339 AAGGAGGGAAAAAAGGAGGGTGG + Intergenic
1105783040 13:23721014-23721036 CAGGAGAGAACGAGTGAGGGGGG + Intergenic
1106216905 13:27710158-27710180 AAGAAGAAAATAAATGAAAGGGG - Intergenic
1106359968 13:29021962-29021984 AAGGAGAAAAAGCATGAGAGCGG + Intronic
1106379625 13:29223743-29223765 AAGGAGAGAAGAAAGGAGAGAGG + Intronic
1106609245 13:31262815-31262837 AAGTAGAGATCAAATGAGGAAGG - Intronic
1106903652 13:34381992-34382014 AAGGTGAAACCAAATGGGGCTGG - Intergenic
1107173535 13:37373222-37373244 AAGCAGAAAGAAAATAAGGGAGG - Intergenic
1107182673 13:37479919-37479941 GATGAGAAAAGAAATGAGGGAGG + Intergenic
1107881000 13:44831842-44831864 AAGGAGGAAACAGAAGAGGAAGG + Intergenic
1108044036 13:46366133-46366155 AGGGAGAAAATGAATGTGGGTGG - Intronic
1108070516 13:46624276-46624298 GAGAACAAAACAAATGAAGGAGG - Intronic
1108713382 13:53056005-53056027 CAGGAGAAAACAAAATAGGTTGG + Intergenic
1108739712 13:53323138-53323160 AAGGAGAGAACAAAGGTGAGAGG - Intergenic
1109148443 13:58812925-58812947 ATGGTGAAAACAAATTATGGTGG + Intergenic
1109852871 13:68090101-68090123 AAGGAGGAAATAATTGAAGGCGG - Intergenic
1110904441 13:80867860-80867882 AAGGAGAAAATAAAGGAGAATGG + Intergenic
1111389000 13:87566008-87566030 AAGGAGCAAACAAATAATAGAGG + Intergenic
1111414530 13:87922236-87922258 AAGGAAAGAACAAGTGAGAGGGG - Intergenic
1111670291 13:91321223-91321245 GAAGAGAAAAGAAAGGAGGGAGG + Intergenic
1111695437 13:91617639-91617661 AGGGAGAAAAGAAAGGAGGGAGG - Intronic
1111749070 13:92304499-92304521 AAGTTGAAAGTAAATGAGGGTGG - Intronic
1112095377 13:96126862-96126884 AAGGAGAAGACTAAAGAGAGAGG - Intronic
1112251088 13:97781107-97781129 AAGAAAAAAAAAAAGGAGGGAGG + Intergenic
1114428647 14:22641497-22641519 AGGGAGGAAAGAAAGGAGGGAGG + Intergenic
1114524160 14:23357711-23357733 AAGGAGAAAAGAAGTGAGGGAGG - Intronic
1115022354 14:28697863-28697885 AAGGAGAACAGATATGAGGCGGG - Intergenic
1115111415 14:29827936-29827958 AGGTGGAAAAGAAATGAGGGAGG - Intronic
1115593591 14:34887552-34887574 ACGGAGAAAACAAATGCCGGTGG - Intergenic
1115696758 14:35907697-35907719 AAGGAGAAAAGAAAAGAGGCTGG + Intronic
1115714765 14:36091114-36091136 ATGGAGTAAACAAATGAAGAGGG - Intergenic
1115758605 14:36555319-36555341 AAGGAGAAAAACTATGTGGGAGG + Intergenic
1115946720 14:38669940-38669962 AAGGAGAAAACTCATGACAGAGG - Intergenic
1116019846 14:39447094-39447116 AAGGAGAAAAAAAATTAAGGAGG + Intergenic
1116154038 14:41180691-41180713 AGAGAGAAAACAATTGAGGCAGG + Intergenic
1116551956 14:46251574-46251596 TAGGAGCAGACAAGTGAGGGAGG - Intergenic
1116659562 14:47691969-47691991 AAGGAGGAAAGAAAGGAAGGAGG - Intergenic
1116863582 14:50013763-50013785 AAGAAGAAAAGAAATGACGAAGG + Intergenic
1117190389 14:53284678-53284700 AAGGACAAAAGTAATGAGGGTGG + Intergenic
1117283324 14:54261656-54261678 AAGGAGGAAAAAAAAAAGGGGGG + Intergenic
1117541104 14:56747373-56747395 AAGGAAAAAAAAAATGAGAAAGG - Intergenic
1118017187 14:61672271-61672293 AAGGAGAAAAAAAGTGGGGGGGG + Intergenic
1118233764 14:63979910-63979932 AAGAAAAATAGAAATGAGGGGGG + Intronic
1118554939 14:67007878-67007900 ATGGAGAAAATAAAAAAGGGAGG + Intronic
1118840265 14:69504617-69504639 TAGAAGAAGAAAAATGAGGGTGG - Intronic
1119026504 14:71157012-71157034 AAGAAGAAAAAAAAAGAGTGAGG + Intergenic
1119089316 14:71765832-71765854 AGGGAGGAAAGGAATGAGGGAGG - Intergenic
1119383405 14:74242336-74242358 AGGCTGAAAACAAATTAGGGTGG - Intronic
1119460878 14:74802289-74802311 TAGTAGAAAACAACTGAGGCAGG + Intronic
1119710407 14:76818043-76818065 AAGGAGAGAACAAAGGAGCTGGG - Intronic
1119881615 14:78104229-78104251 AAGTAAAAAACAAACGTGGGAGG + Intergenic
1119964619 14:78900426-78900448 AAAAAGAAAAAAAATGAAGGAGG - Intronic
1120257036 14:82133718-82133740 AAAGAGAAAAGAAATGAGTGCGG - Intergenic
1120483920 14:85086396-85086418 AGGGAGGAAGGAAATGAGGGAGG - Intergenic
1120688876 14:87570338-87570360 AAGGAGCATGCAAATAAGGGTGG - Intergenic
1121587025 14:95069431-95069453 AATGAATAAACAAATGAGTGCGG - Intergenic
1121628551 14:95405602-95405624 AAGGAGTTTACAACTGAGGGAGG - Intergenic
1121916730 14:97842380-97842402 AAGGAAAAAAGAACAGAGGGAGG + Intergenic
1121916761 14:97842488-97842510 AAGGAAAAAAGAACCGAGGGAGG + Intergenic
1121976942 14:98413602-98413624 GTGGAAAAGACAAATGAGGGGGG + Intergenic
1122341622 14:101032150-101032172 AAGGAGAAAAGACATGGGGTAGG - Intergenic
1122765871 14:104069472-104069494 ACAGAGAAAACAGCTGAGGGAGG - Intergenic
1123220425 14:106850726-106850748 AAGTAGAAAATAAAAGAAGGAGG + Intergenic
1123430465 15:20211243-20211265 TATGAGAAAACAAATAGGGGTGG + Intergenic
1123571524 15:21615435-21615457 AAAAAGAAAACAAAAGAAGGAGG - Intergenic
1123608143 15:22058026-22058048 AAAAAGAAAACAAAAGAAGGAGG - Intergenic
1123709621 15:22977865-22977887 GAAAAGAAAACAAAGGAGGGAGG + Intronic
1123893500 15:24804720-24804742 AAGGATTAAAGAATTGAGGGTGG + Intergenic
1123917701 15:25049003-25049025 AGGGAGAAAAGAAGGGAGGGAGG - Intergenic
1123966413 15:25464053-25464075 AAGGAGAAAGAAAGGGAGGGAGG + Intergenic
1124493003 15:30169640-30169662 AAGGAGAAAACAAACGAGGGGGG + Intergenic
1124555738 15:30724125-30724147 AGGGAGAAAGGAAAGGAGGGAGG + Intronic
1124675532 15:31681594-31681616 AGGGAGAAAGGAAAGGAGGGAGG - Intronic
1124750531 15:32368685-32368707 AAGGAGAAAACAAATGAGGGGGG - Intergenic
1124932223 15:34131775-34131797 TAGGAGAAAATAAAGAAGGGTGG - Intergenic
1125171430 15:36770333-36770355 AGGGAGAATACAAAGGAAGGAGG + Intronic
1125526610 15:40380183-40380205 GAGAAGAAAACAAAAAAGGGTGG - Intergenic
1125543024 15:40482569-40482591 AAGAAGAAAACATAGGAGGAAGG - Intergenic
1125547278 15:40515290-40515312 AAGGAGGAAGAAAAGGAGGGTGG - Intergenic
1125686602 15:41567329-41567351 AAGCAGAAAACTAATGATGTAGG - Intronic
1126196264 15:45935578-45935600 ATAGAGAAAACAAATAAGGGAGG + Intergenic
1126367037 15:47904731-47904753 AAGGAGAGAAGAAGGGAGGGAGG + Intergenic
1126966833 15:54063544-54063566 TAGGAGAATAAAAATGAGTGAGG - Intronic
1127291243 15:57573422-57573444 AAGGAGAAAAGGAGTGAAGGAGG - Intergenic
1127360692 15:58242476-58242498 AATGAGAAAAAAAATGATGATGG + Intronic
1127610885 15:60635151-60635173 AAGCAGAATGCAAATGACGGTGG + Intronic
1127747921 15:61999836-61999858 AAGGAGAAAAGAAAGAAGAGAGG + Intronic
1128240947 15:66100535-66100557 CAGGTGAAAAAAACTGAGGGAGG - Intronic
1128264361 15:66253897-66253919 AAAGAGGAAAAAAATGAGGGGGG - Intergenic
1128385739 15:67147014-67147036 AAGGAGCAAAGAACTGTGGGAGG - Intronic
1128400491 15:67275040-67275062 AAGGAGACACCAAATCAGAGTGG - Intronic
1128546462 15:68571977-68571999 AAGGAGAGAACTCCTGAGGGGGG + Intergenic
1128916704 15:71569510-71569532 TACAAGAAAACAAATAAGGGAGG + Intronic
1128918754 15:71591892-71591914 AAGAAGAAAACAAATGTTTGTGG + Intronic
1129304428 15:74648827-74648849 CAGTAGAAAACAAATGGTGGAGG + Intronic
1129335265 15:74848400-74848422 AAGGAGAAAAAAAAAGTGAGTGG + Intronic
1129592052 15:76924777-76924799 AAGAAGAAAAAGAATGTGGGAGG - Intergenic
1129723278 15:77889303-77889325 GAGGTGAAAAGAAAGGAGGGAGG - Intergenic
1129880974 15:79005813-79005835 AAAGAGAAAGGAAATGAGGAGGG - Intronic
1130119289 15:81033365-81033387 AAAGAAAGAACAAAAGAGGGAGG + Intronic
1130435612 15:83896215-83896237 CATGAGATAACAAATGAAGGAGG + Intronic
1130556403 15:84925602-84925624 AAAAAGAAAAGAAATGATGGGGG + Intronic
1130744604 15:86637664-86637686 TAGGACAAAAGCAATGAGGGTGG + Intronic
1130919789 15:88334478-88334500 AAGAAAACAATAAATGAGGGTGG + Intergenic
1131683143 15:94744895-94744917 AAGGAGAAGGGAAAGGAGGGAGG + Intergenic
1131935914 15:97504717-97504739 AAGAAGAAAAAAAAAGGGGGTGG - Intergenic
1202980378 15_KI270727v1_random:349824-349846 AAAAAGAAAACAAAAGAAGGAGG - Intergenic
1132755342 16:1481822-1481844 AAGGAAAAAAGAAATGAGCAGGG + Intergenic
1133404512 16:5512359-5512381 AAGGAAAGAAGAAAGGAGGGAGG - Intergenic
1133568783 16:7021245-7021267 AAGTAGTAACCAAATGAGGTGGG - Intronic
1133711727 16:8408158-8408180 AAGGAGAGAAGGAATGAAGGAGG - Intergenic
1134291726 16:12907069-12907091 AAGGAAAAAACAAAGGAGGAAGG - Intronic
1134818330 16:17224944-17224966 AAGACCAAAACAAATGAGTGTGG + Intronic
1135037812 16:19092912-19092934 AATGAGAAAAGAAAAGAGGGAGG - Intergenic
1135037827 16:19092986-19093008 AATGAGAAAAGAAAAGAGGGAGG - Intergenic
1135471741 16:22737248-22737270 AAGGAAAAAAGAAAAGAGGCTGG + Intergenic
1135587551 16:23682400-23682422 AAGCAAAAAACAAAGGAGGTAGG + Intronic
1136495627 16:30641868-30641890 AAAGAAAAAAAAAAGGAGGGAGG - Intergenic
1136854168 16:33639967-33639989 TATGAGAAAACAAATAGGGGTGG - Intergenic
1136938427 16:34498671-34498693 GAGGAGAAAGCAAGGGAGGGAGG - Intergenic
1136961392 16:34849886-34849908 GAGGAGAAAGCAAGGGAGGGAGG + Intergenic
1137567143 16:49540433-49540455 AAGAAAAAAAAAAATGAGTGGGG - Intronic
1137822408 16:51458728-51458750 AAAGACAAAAAAAAGGAGGGGGG + Intergenic
1137903009 16:52289656-52289678 AAAAAGAAAAAAAAAGAGGGGGG - Intergenic
1138028482 16:53540538-53540560 AAGGAGAAAGAGAATGAAGGTGG + Intergenic
1138862431 16:60774632-60774654 AATAAAAAAACAAAAGAGGGAGG + Intergenic
1139233587 16:65311061-65311083 AAGGAGAGAACAATTAGGGGAGG - Intergenic
1139542880 16:67631683-67631705 AAGGAAAAAAAAAAGGGGGGGGG - Intronic
1140031706 16:71344519-71344541 AAGGAGAAAGCAAGGGAGGCAGG + Intergenic
1140684754 16:77422637-77422659 AAGGAAAGAAGAAAGGAGGGAGG + Intronic
1140906687 16:79415316-79415338 AAGGAGAGAAGGAAGGAGGGAGG + Intergenic
1140944384 16:79754324-79754346 AAGGAGAAAAGGAGGGAGGGAGG - Intergenic
1140956060 16:79867108-79867130 AGGGAACAAATAAATGAGGGAGG + Intergenic
1142080153 16:88144843-88144865 AAAGAGAAAAAAAAAAAGGGGGG - Intergenic
1142251482 16:88993875-88993897 AAGGAGAAAAAAAGGGAGGGAGG - Intergenic
1142418913 16:89958378-89958400 AAGGTGACAACAAAAGAAGGTGG + Intronic
1203115743 16_KI270728v1_random:1488406-1488428 TATGAGAAAACAAATAGGGGTGG - Intergenic
1142484580 17:238221-238243 AAGGAGAAAAGAAAAGAGGGAGG + Intronic
1142753515 17:2002244-2002266 AAAGAAAAAAGAAAGGAGGGAGG - Intronic
1142789514 17:2253012-2253034 AATATGTAAACAAATGAGGGTGG - Intronic
1142946262 17:3431581-3431603 AATGAGTGAACAAATGAGTGAGG + Intergenic
1143021308 17:3918272-3918294 AAGGAAAAAAGGAAGGAGGGAGG + Intergenic
1143041462 17:4040666-4040688 AAGGAGAAAATAACTTAGGAAGG + Intronic
1143401816 17:6651207-6651229 AAGCAGAAAACCAATCAAGGAGG + Intronic
1143804996 17:9418905-9418927 AAAAAGAAAAAAAAAGAGGGGGG - Intronic
1144213022 17:13031233-13031255 AAGGAAAAAAGAAAGGAAGGAGG - Intergenic
1144341446 17:14313562-14313584 AAAAAGAAAAGAAATGACGGAGG - Intronic
1144387099 17:14758905-14758927 GTGGAGAAAACAAAGGAAGGGGG + Intergenic
1144775800 17:17784016-17784038 AAGGAGAGAGAAAAAGAGGGAGG - Intronic
1145073224 17:19829535-19829557 AAGGAAAAAAAAAAGGGGGGGGG + Intronic
1145102975 17:20092066-20092088 AAGTAGAAGAGAAAGGAGGGAGG - Intronic
1145692395 17:26755988-26756010 AGGGAGAAAAGAAGGGAGGGAGG + Intergenic
1145780749 17:27561336-27561358 AAGGAAAGAAGAAATGAGGGGGG - Intronic
1146150218 17:30461961-30461983 AAGGTACAAACAAAAGAGGGAGG + Exonic
1146340544 17:32015796-32015818 AAGGAGTCAACAAATGAGCCAGG + Intronic
1146665395 17:34699217-34699239 AAGGAGAAAAGAAAGAAAGGGGG - Intergenic
1146702714 17:34975362-34975384 AAGAAGAAAGCAGAGGAGGGTGG - Intronic
1146918934 17:36696888-36696910 AAGGAGAAAACTGAAGAGAGGGG + Intergenic
1147290062 17:39434863-39434885 AAGAAGAAAATAAATTAGGAAGG + Intronic
1147305709 17:39562835-39562857 AAGGAGGAAAAAAATGAGAGAGG - Intronic
1147502002 17:40974629-40974651 AAGAAGAAAAGAAAGGAGGGAGG - Intergenic
1147565423 17:41533317-41533339 AAGGAGGAAAGGAAGGAGGGAGG + Intergenic
1147664211 17:42135753-42135775 AAGGACAAAACATATGAAGTGGG - Intronic
1147679099 17:42228376-42228398 AAGAAGGAAAGAAAGGAGGGAGG - Intronic
1148176752 17:45572704-45572726 AATAAGTAAACAAATGAGTGTGG - Intergenic
1148250432 17:46074361-46074383 AATGAGTAAATAAATGAGGGGGG + Intronic
1148294625 17:46490243-46490265 AATAAGTAAACAAATGAGTGTGG + Intergenic
1148403440 17:47388056-47388078 AAGGAGACACCAAATCAGAGTGG - Intronic
1148590413 17:48812270-48812292 AAGGAGAATACAAAGGAGTGAGG + Intronic
1148985624 17:51618498-51618520 GAGGACACAACAAATGAGTGTGG - Intergenic
1149207417 17:54264513-54264535 AAGGAAAAATCAAAGGAGAGAGG - Intergenic
1149218553 17:54388441-54388463 AGGGAGAAAACGAGGGAGGGAGG - Intergenic
1149397817 17:56262731-56262753 AATGAGATAATAAATGAGGATGG + Intronic
1149443922 17:56699118-56699140 AAGGGTAAAACAGATGAAGGTGG - Intergenic
1149648493 17:58258743-58258765 AAGGATAAAACAAAAAATGGTGG - Intronic
1149949357 17:60968757-60968779 AAGGAGACACCAAATTAGAGTGG - Intronic
1150023784 17:61650062-61650084 AAGAATAAAACAGATGATGGAGG + Intergenic
1150293251 17:63993493-63993515 AAGGAGGAAAGGAAGGAGGGAGG + Intergenic
1150464621 17:65381534-65381556 CAGGAGAAAACAGAAGAGGCTGG + Intergenic
1150749636 17:67848366-67848388 AAGGAGTCAACAAATGAGCCAGG + Intronic
1150757365 17:67926904-67926926 AAAGAAAAAAAAAAAGAGGGAGG - Intronic
1151180042 17:72320700-72320722 AAAGAGAAAAGAAATAAGGGAGG + Intergenic
1151234581 17:72710254-72710276 AAGGTGAAAACAAAGGTGGGTGG - Intronic
1152105187 17:78324594-78324616 AAGGGGAAAAAAAGGGAGGGAGG - Intergenic
1152270015 17:79319054-79319076 AAGGAGGGAAGACATGAGGGTGG + Intronic
1152601920 17:81267333-81267355 AAGTACTAAAAAAATGAGGGAGG + Intronic
1152763863 17:82124807-82124829 AAAGAAAAAAAAAATGAGGGGGG + Intronic
1152855228 17:82661908-82661930 AAGGAAGAAACAAATGAGGGTGG + Intronic
1153325283 18:3812242-3812264 AAGGTGACATGAAATGAGGGAGG - Intronic
1153351492 18:4085256-4085278 AGGCAGAAAAAAAATGTGGGTGG + Intronic
1153695585 18:7637495-7637517 AATGAGCAAACAAATGAATGAGG - Intronic
1153962876 18:10154298-10154320 AAGGAGAAGAAAAATGATGAAGG + Intergenic
1154374372 18:13796868-13796890 AAGGAGAAAACGAGTCAGGGAGG - Intergenic
1155113701 18:22742596-22742618 AAGGAGATGACAAATCAGAGTGG + Intergenic
1155141680 18:23050011-23050033 AGGGAGAAAACCAGTGAGTGTGG - Intergenic
1155242515 18:23877116-23877138 TTGGAGAAGACAGATGAGGGAGG + Intronic
1155482058 18:26299560-26299582 AAGCTTAAAACAAAGGAGGGGGG - Intronic
1155482150 18:26300849-26300871 AAGGAAAAAAAAAATCAGAGTGG - Intronic
1155649374 18:28121967-28121989 AAGGTGATAGAAAATGAGGGTGG + Intronic
1155702892 18:28769619-28769641 AAGGAGAAAACAGACGAGAGGGG - Intergenic
1156046764 18:32886079-32886101 AAGTATAAAACAAATGAAGAGGG + Intergenic
1156259581 18:35432469-35432491 AAGGAAAAATAGAATGAGGGAGG + Intergenic
1156512948 18:37656539-37656561 AAGGAGAAAACATTTTAGGCTGG + Intergenic
1156576975 18:38328318-38328340 AAGGACTAAGCAAAAGAGGGGGG + Intergenic
1156768543 18:40689609-40689631 AAGGAGAAAAAGAAGGAGGAGGG - Intergenic
1156851811 18:41737503-41737525 AAGGAGGAAAGAAAGTAGGGAGG - Intergenic
1156931352 18:42647992-42648014 CAGGAGAAAAGAAATCAGGAAGG - Intergenic
1157119276 18:44893706-44893728 AAGGAAAAAAGAAAAGAGGGAGG + Intronic
1157282092 18:46352834-46352856 AAGGAGAGAACAGATAATGGGGG + Intronic
1157763301 18:50280702-50280724 AAGGAGAAGAAAAATAAGGGGGG - Intronic
1157850540 18:51045010-51045032 AAAGAGATAACAACAGAGGGAGG + Intronic
1158104510 18:53870701-53870723 AAAGAGAAGACAAAGGAAGGTGG + Intergenic
1158490768 18:57907491-57907513 ATGGAGAAAAGAAATTAGGATGG + Intergenic
1158676101 18:59519326-59519348 AAGAATAAAATAAAAGAGGGGGG + Intronic
1158803594 18:60943343-60943365 CAGCCGAAATCAAATGAGGGAGG + Intergenic
1158975277 18:62705383-62705405 TAGGAGAAAAAAAATCTGGGAGG + Intergenic
1159122747 18:64189945-64189967 AAGGAGAAAAATTATGAGGGGGG - Intergenic
1159271202 18:66153282-66153304 GCTGAGAAAACAAATGATGGAGG + Intergenic
1159436907 18:68429825-68429847 ATGGAGAAAACAAGGGAGGGAGG + Intergenic
1159572129 18:70127748-70127770 AAAAAGAAAAAAAATGAAGGAGG + Intronic
1159688364 18:71453000-71453022 AAAGAGAAAATAAATGAAGAAGG + Intergenic
1159790105 18:72767756-72767778 AGGAAGGAAAGAAATGAGGGAGG + Intronic
1159816221 18:73077111-73077133 CAGGAGAAGACAAATAATGGAGG - Intergenic
1159837211 18:73352733-73352755 AAGGAGATACCAAATTAGTGTGG - Intergenic
1159850340 18:73519906-73519928 AAGCAGATGACAAATGAGGTAGG - Intergenic
1159906675 18:74098366-74098388 AAAGATATAAGAAATGAGGGGGG + Intronic
1160147158 18:76375235-76375257 AAGGAGAAAGGAAATGCGGAAGG + Intronic
1160483676 18:79267439-79267461 AAGGTGAAAACTAATCAAGGAGG - Intronic
1161312507 19:3602778-3602800 AAAAAGAAAAGAAAAGAGGGAGG + Intronic
1161496982 19:4591922-4591944 AGGAAGAAAAGAAATGAAGGAGG + Intergenic
1161665697 19:5574866-5574888 AGGGAGAAAAGAAAGGAAGGAGG + Intergenic
1161758656 19:6153957-6153979 AGAGAGAAAAAAATTGAGGGTGG + Intronic
1161789270 19:6349342-6349364 AAGAAGAAAGGAAAAGAGGGAGG + Intergenic
1161903349 19:7136343-7136365 AAGCAGAAAAAAAATCAAGGAGG - Intronic
1162103047 19:8352188-8352210 AAGAAGAAAGAAAAAGAGGGAGG + Intronic
1162504679 19:11076263-11076285 AAGGAGAAAAGAAAGGGGGCAGG - Intergenic
1162730547 19:12715861-12715883 AAAGAAAAAAAAAAGGAGGGGGG - Intronic
1162738625 19:12760872-12760894 AAAAAGAAAGCAGATGAGGGTGG - Intergenic
1162765800 19:12918655-12918677 TAGGAGAAAAGAGATGAGGCCGG + Intronic
1163468640 19:17484284-17484306 AAGGAGATAATAAATAAGGATGG + Intronic
1163501251 19:17677676-17677698 AAGGGGAGAAGAAAAGAGGGAGG - Intronic
1164788019 19:30952208-30952230 AAGGAAGAAGCAAAAGAGGGAGG - Intergenic
1164794424 19:31014689-31014711 AAGGAAGAAAAAAAGGAGGGAGG + Intergenic
1165528446 19:36376634-36376656 AAAGATAAAACAAATGTGGTAGG + Intronic
1165636927 19:37348084-37348106 ACGGAGAAGACAAATGAGGAAGG - Intronic
1165723839 19:38099004-38099026 GAGAAGAAAAGAAAGGAGGGAGG - Intronic
1165775582 19:38402802-38402824 CAGCAGAAGACAACTGAGGGAGG + Intergenic
1166258475 19:41621668-41621690 AAGCAGAAAACACACCAGGGCGG + Exonic
1166576224 19:43840844-43840866 AAGGAGAAAAAAAATTAGCCGGG - Intronic
1166915356 19:46191807-46191829 AAAGAGTAATCAAATGATGGGGG - Intergenic
1166986598 19:46663797-46663819 AAAGAGAATGCAAATGAGGCCGG + Intergenic
1167430259 19:49450076-49450098 AAGGAGAAAACAAAGAAGAGAGG - Intronic
1167584859 19:50368597-50368619 ACTGAGAAAACAAAGGGGGGTGG - Intronic
1167619225 19:50551870-50551892 AAGGAGAGAAAGAAGGAGGGAGG - Intronic
1167791228 19:51683533-51683555 AAGAAAAAAATAAATGAGGATGG + Intergenic
1168075522 19:53979048-53979070 AGGCAGAAAAAAAAAGAGGGGGG + Intronic
1168091643 19:54089411-54089433 AAAGAGAAAAGGAAGGAGGGAGG + Intergenic
1168143921 19:54408604-54408626 AAGGAGAAAGGAAGAGAGGGAGG + Intergenic
1202714520 1_KI270714v1_random:34719-34741 AAGGGGGAAATAAATCAGGGTGG - Intergenic
925099267 2:1231626-1231648 AAGAAGGAAACAGAGGAGGGAGG - Intronic
925625920 2:5842035-5842057 AAGGAGAAAAGAAAAGAAGAGGG + Intergenic
925647795 2:6054702-6054724 AATGAGAACACATATGAAGGTGG + Intergenic
926340047 2:11897952-11897974 CAGGAGAAAAAAAATCAGTGAGG + Intergenic
926701650 2:15808011-15808033 ACGGAAAAAAAAAATGGGGGGGG - Intergenic
926827375 2:16920144-16920166 AAGAAGAAAAGAAATAAGGAAGG + Intergenic
926871332 2:17421186-17421208 GAGGAGCAAATAAATGGGGGAGG - Intergenic
926881080 2:17543819-17543841 AAGGAGAAAAAACAGGAGGAAGG - Intronic
927295876 2:21452668-21452690 GAGAAGAAAACAAATTAGGGAGG - Intergenic
927296253 2:21456654-21456676 AAAGAGAAATGAAAGGAGGGAGG - Intergenic
927417247 2:22892150-22892172 AAGGAGGCATCAAATGAGGGAGG + Intergenic
927779291 2:25926528-25926550 AAGGAGAAAATGAAAAAGGGAGG + Intergenic
928029194 2:27764471-27764493 AAAGAGAAAACAAATTAGCTGGG + Intergenic
928228004 2:29470914-29470936 AAGGATAAAAGAAAGGATGGTGG + Intronic
928332893 2:30371153-30371175 AGGGTGAAAAAAAATGAGGCTGG + Intergenic
928373777 2:30759162-30759184 AAGGAGGAGAAAAACGAGGGAGG - Intronic
928477197 2:31640714-31640736 AAGGAGACACCAAATCAGAGTGG - Intergenic
928563879 2:32522073-32522095 ATAGAGAAAAAAAATGATGGGGG - Intronic
928572759 2:32625557-32625579 AAGGAGAAAAAATAGGAAGGAGG - Intergenic
928620012 2:33079248-33079270 ATGGAGAAAACAAATGAATAAGG + Intronic
928786685 2:34895566-34895588 AGGGAGAAAAGAAAGGAGGGAGG - Intergenic
928921709 2:36534253-36534275 AAGGAGGAAAGAAAGGATGGAGG + Intronic
928921731 2:36534323-36534345 AAGGAGAAAAGGAGGGAGGGAGG + Intronic
929186663 2:39102362-39102384 AAGGGGAAAAAAAATTAGGTGGG + Intronic
929408517 2:41670233-41670255 AAGGAGAAAAACAATTAGAGAGG - Intergenic
929651520 2:43684394-43684416 AAAGAGAAAAAAATTGAGGATGG + Intronic
929681657 2:43998100-43998122 AAGGAGAAAAAAAAAAAGAGTGG + Intergenic
929935357 2:46290933-46290955 AGGGAGAAAAAGAAGGAGGGAGG - Intergenic
930258946 2:49123002-49123024 AAGGATAAAGGAAAGGAGGGAGG - Intronic
930264971 2:49189124-49189146 ATGGAGAAAACAAGTGGGGGAGG - Intergenic
930800686 2:55439647-55439669 AAGGAGATAAAAAGTGGGGGAGG - Intergenic
930804698 2:55478815-55478837 GAGGAGATAAGAGATGAGGGAGG - Intergenic
931068664 2:58619010-58619032 AAGAAAAAAAAAAAAGAGGGTGG + Intergenic
931569585 2:63654513-63654535 AAGGAGAAGACAAGAGAGTGAGG - Intronic
931683075 2:64768718-64768740 AAGGAGGAAAAGAAGGAGGGAGG - Intergenic
932339301 2:70950598-70950620 AAATAGAAAAAAAAGGAGGGGGG + Intronic
932564820 2:72899617-72899639 AAGGAGAGAAGGAAGGAGGGAGG + Intergenic
932908245 2:75777765-75777787 AATGAGAATACAAATGTTGGTGG - Intergenic
933041585 2:77474200-77474222 ACAAAGAAAAGAAATGAGGGAGG + Intronic
933248012 2:79997306-79997328 AAGGAGAAAAAAAGAGAGGGAGG + Intronic
933259250 2:80113573-80113595 AATAAGTAAACAAATGAGCGTGG - Intronic
933370941 2:81414707-81414729 AGGGAAAAACCAAAGGAGGGAGG + Intergenic
933439517 2:82294606-82294628 AAGAAGAAAACAAAAAAGGATGG - Intergenic
933636149 2:84711072-84711094 AAAGAGAGAAGAAATGAGAGAGG + Intronic
933646482 2:84816988-84817010 AAGGAGAAAATAAAGAATGGAGG + Intronic
933811662 2:86036484-86036506 AAAGAGAAAGAAAAAGAGGGTGG + Intronic
933846544 2:86331515-86331537 AAGGAAAAAAAAAAGGTGGGGGG + Intronic
933851453 2:86370017-86370039 GAGGAGAGAAGAAATGAAGGAGG + Intergenic
934042590 2:88141014-88141036 AAGGAAGAAAGAAAAGAGGGAGG - Intergenic
934249397 2:90336257-90336279 AGGGAGAAAGGAAGTGAGGGAGG - Intergenic
934331875 2:92075618-92075640 AGGGAGAAAGCAAGGGAGGGAGG + Intergenic
934903250 2:98177559-98177581 AAGGAGAAAAAAAAAAAGGAGGG - Intronic
935051487 2:99528734-99528756 GAGGAGAAAGGAGATGAGGGAGG - Intergenic
935861548 2:107336622-107336644 AAACAGAAAGCAAATGAGAGAGG - Intergenic
935899081 2:107771181-107771203 AAAGAAAAAAAAAATGTGGGAGG + Intergenic
936259133 2:110943247-110943269 AAAAAGAAAAGAAAGGAGGGAGG + Intronic
936655288 2:114478568-114478590 AAGGAAAAAATAAATAAGGAAGG + Intronic
936780019 2:116021535-116021557 AAAGAAAAAAGAAAGGAGGGAGG - Intergenic
936996631 2:118421562-118421584 ATGGAGAAAACAAATGAAATAGG + Intergenic
937683890 2:124674376-124674398 AAAGAAAGAACAAAGGAGGGAGG - Intronic
937912670 2:127083058-127083080 AAGAAAAAAGCAAATGAGTGTGG - Intronic
938621558 2:133059932-133059954 CAGAAAAAAAAAAATGAGGGAGG + Intronic
939049373 2:137289795-137289817 AAAGAGAAAAAAAAAGAGTGGGG + Intronic
939291313 2:140198923-140198945 AAGGAGAAAAAGAAAGAAGGAGG + Intergenic
939337862 2:140854087-140854109 AAGGAGAAAAGAAAAAAGAGAGG + Intronic
939754254 2:146090079-146090101 AGGAAGAGAACAAAGGAGGGAGG - Intergenic
940644520 2:156376543-156376565 AAGAAAAGAAGAAATGAGGGAGG + Intergenic
941064600 2:160887245-160887267 GAGGAGGAAATAAATGAGAGTGG + Intergenic
941283587 2:163581970-163581992 AGGAAGAAAACATATGAGGCTGG + Intergenic
941360608 2:164546831-164546853 AAGGAGACACCAAATCAGAGTGG + Intronic
941424523 2:165325390-165325412 AAGGTGCAAACAAATGAAGTAGG + Intronic
941647604 2:168057954-168057976 AAGGAAAAATTGAATGAGGGAGG - Intronic
941659732 2:168183556-168183578 AAGGCCAAAACAAGTGAGGAAGG - Intronic
941710496 2:168706947-168706969 AATAAGAAAACAAATGGGCGTGG + Intronic
941867603 2:170351006-170351028 AGGGAGAAAAGAAAAAAGGGAGG + Intronic
941904762 2:170710073-170710095 TAGAAGAAAACAAAGGAGGCTGG - Intergenic
942242867 2:173979714-173979736 AGGCAGAAAACAAATGAGAGTGG - Intergenic
942296625 2:174523816-174523838 AAGGAAAAAACAAATCAGGAAGG - Intergenic
942476040 2:176321824-176321846 AAGGAGAGAACATATGTGGCAGG + Intronic
942539496 2:177001062-177001084 GAGGAGAAAATGAATGAGGACGG - Intergenic
942715265 2:178884569-178884591 AAGGAAAACAAAAAGGAGGGAGG - Intronic
942831324 2:180239612-180239634 AAGAAGAAAAGAAGGGAGGGAGG - Intergenic
942925045 2:181421465-181421487 GACTAGATAACAAATGAGGGAGG + Intergenic
943295731 2:186135781-186135803 AAGGAGAAAGCAAATTAAAGAGG - Intergenic
943330749 2:186556248-186556270 AAGGAGAAAAGAAAGAAGGAAGG - Intergenic
943409242 2:187525429-187525451 AAGGAGAAAAAAAGGAAGGGAGG - Intronic
943763536 2:191635711-191635733 AAGGATAAAATGAATGATGGAGG + Intergenic
944065037 2:195610446-195610468 AAGGAGAAAAGGAGGGAGGGAGG + Intronic
944384145 2:199145735-199145757 AAGCAGAAAGCAGAAGAGGGTGG + Intergenic
944400731 2:199323268-199323290 CAGGAGAAAACACACGTGGGGGG - Intronic
944461173 2:199952480-199952502 AATGAGCAAACGATTGAGGGGGG - Intronic
944912824 2:204327072-204327094 AAGGAGGGACAAAATGAGGGAGG + Intergenic
945224599 2:207520540-207520562 AAAAAGAAAAAAAATGAGAGGGG + Intergenic
945506884 2:210652616-210652638 AAGGAGAAAAGTATAGAGGGAGG + Intronic
946076687 2:217079465-217079487 ATGGAGAAAAGAAAGGAGTGGGG + Intergenic
946288970 2:218728752-218728774 AAGGAGATACCAAATCAGAGTGG - Intronic
946382859 2:219360641-219360663 AAAGAGATAACAATGGAGGGTGG - Intergenic
946553012 2:220823621-220823643 AGGGAGGAAAGAAAGGAGGGAGG - Intergenic
946553038 2:220823698-220823720 AGGGAGGAAAGAAAGGAGGGAGG - Intergenic
946580562 2:221124016-221124038 ACGAAGAAAACACATGAGGAAGG + Intergenic
946610996 2:221457799-221457821 AAGAAGAAAACAAAGAAGGAAGG + Intronic
946956279 2:224933362-224933384 AAAAAGAAAATAAATGTGGGTGG - Intronic
947103209 2:226643686-226643708 AAAGGGAAAAAAAAGGAGGGGGG + Intergenic
947904088 2:233747147-233747169 ATGAAGAAAACAAATGTAGGAGG + Intronic
947909204 2:233790541-233790563 AAGGAGAAAAAGAAAGGGGGAGG - Intronic
948288530 2:236806759-236806781 AAGGAAAAAGCAGATGACGGAGG + Intergenic
948724211 2:239921889-239921911 AAGGAGAAAAGGAAGGAGAGAGG - Intronic
949016850 2:241718332-241718354 AAGGAGGAAGGAAGTGAGGGAGG - Intronic
1168849255 20:965389-965411 GAGGAGGAAAAAAATGATGGGGG + Intronic
1168914052 20:1471999-1472021 AAGGAGAAAACAGAAGGGGAGGG + Intronic
1168944586 20:1742049-1742071 AAGGAAAAAAAAAAAGAGAGCGG + Intergenic
1169114712 20:3056632-3056654 AAGAAGATAAAAAATTAGGGAGG - Intergenic
1169448992 20:5695434-5695456 AAGGAGAAAAAAGAAGAAGGAGG - Intergenic
1169780815 20:9307742-9307764 AATGAAAAAACAATTGAGGATGG - Intronic
1169799669 20:9502164-9502186 AAGAACAAAAAAAATGAGGGCGG - Intergenic
1169842410 20:9954632-9954654 AGGGAGGAAACCAATGAGGCTGG - Intergenic
1169902201 20:10565034-10565056 AAGGAAAAAAAAAATTAGGAGGG - Intronic
1169971765 20:11276073-11276095 AAGGAGAGAGGAAAGGAGGGAGG - Intergenic
1170020663 20:11833864-11833886 AAGAAGAAAAGAAAGGAGGAAGG + Intergenic
1170084106 20:12510094-12510116 AAGGAGAAAACACAAGAGCCTGG + Intergenic
1170392817 20:15893891-15893913 AAGGAGAGAAGAAAAGAAGGAGG + Intronic
1170501886 20:16982688-16982710 AAGGAGGAAAGAAAGGAGGGAGG - Intergenic
1170528691 20:17267364-17267386 AAGGAGAAATGCAATGGGGGAGG + Intronic
1170663700 20:18366630-18366652 GAAGGGAAAACAACTGAGGGAGG + Intergenic
1170848856 20:19985569-19985591 AAATAGAAAAGAAATGAGTGAGG + Intronic
1170859745 20:20091430-20091452 AATGATAAAACAAATGGGGTTGG - Intronic
1171340239 20:24421643-24421665 AGGGAGAAAATAAATGAGTAAGG - Intergenic
1171771455 20:29325774-29325796 AAGGAGAGAAGAACAGAGGGAGG + Intergenic
1172062166 20:32193985-32194007 AAGGAGAAAAGACAGGAGGTGGG + Exonic
1172360521 20:34309819-34309841 AAAGAGAAAAGAAAAGAGAGAGG + Intronic
1172396422 20:34609339-34609361 AAGGTGAAAAAAAGTGAAGGTGG - Intronic
1172677863 20:36687341-36687363 AAGGAGAGAAAATATGAGGATGG + Intronic
1172788730 20:37487682-37487704 AAGGGGAAGACAAGTGAGGGTGG - Intergenic
1172853060 20:37980660-37980682 AATGAGAAAACAGGTCAGGGAGG - Intergenic
1173482026 20:43409299-43409321 AAGGAGATACCAAATCAGAGTGG + Intergenic
1173531134 20:43770518-43770540 AAGAAGGAAGGAAATGAGGGAGG - Intergenic
1173756279 20:45519227-45519249 AAGGAGGAAGTAAATAAGGGTGG + Intergenic
1173890676 20:46507186-46507208 AAGGAGAAATGAAGGGAGGGAGG + Intronic
1174013427 20:47469187-47469209 ACAGAGAAAACAACAGAGGGAGG + Intergenic
1174063663 20:47849583-47849605 AAGGGGAAAAGAAGGGAGGGGGG - Intergenic
1174166098 20:48584562-48584584 AAGGAGGAAAGAAAGGAGGAAGG - Intergenic
1174221523 20:48959456-48959478 AAGGAGAGAAGAAGGGAGGGAGG - Intronic
1174325361 20:49774480-49774502 AAGAAAAAAAAAAATGAGGCTGG + Intergenic
1174627571 20:51928029-51928051 AAGGAGGAAAGACATGAAGGAGG + Intergenic
1174846184 20:53945384-53945406 AAGAAGAAAATAAAACAGGGTGG - Intronic
1174923231 20:54727644-54727666 AAGGAGAAAAACAATGAGGATGG - Intergenic
1175041636 20:56057682-56057704 AGGGAGAAAGGAAAAGAGGGAGG + Intergenic
1175042864 20:56072197-56072219 AAAGAGAATACAAAGAAGGGAGG + Intergenic
1175167216 20:57053453-57053475 AAGGAGGAAACGAAGGAGGGAGG + Intergenic
1175197467 20:57254317-57254339 AAGAAGAAACCAAAAGAGGCTGG - Intronic
1175247111 20:57588851-57588873 AATGAGAAAACACATGTGGAGGG + Intergenic
1175286792 20:57841899-57841921 GAAGAGAAAGCAAATGAGGCAGG - Intergenic
1175287694 20:57848717-57848739 AGGGAGAAAGGAAATGAGGAAGG - Intergenic
1175293733 20:57894868-57894890 TGGGAGAAAGAAAATGAGGGAGG + Intergenic
1175473730 20:59253860-59253882 AAGGAAAAAAAAAGTGGGGGGGG - Intronic
1175565036 20:59967805-59967827 AAGAAAGAAAGAAATGAGGGAGG - Intronic
1175633056 20:60558129-60558151 AAGGAAAAAATAAAGGAAGGAGG - Intergenic
1175848784 20:62075426-62075448 GAGGAGAGAAGAAATGAGGCAGG + Intergenic
1177235853 21:18389207-18389229 AAGAAAAAAAGAAAGGAGGGAGG + Intronic
1177340007 21:19786079-19786101 AAGAAAAAAACAAAAGAGAGAGG - Intergenic
1177512672 21:22110325-22110347 AAAGAGAAAACAATTGAGCTGGG + Intergenic
1177521412 21:22232704-22232726 AAGGAAAAAAGGAAGGAGGGAGG + Intergenic
1178002330 21:28176327-28176349 AAAAAGAAAAGAAAGGAGGGAGG + Intergenic
1178006628 21:28227721-28227743 AAAGAGAAAAAAAGGGAGGGAGG + Intergenic
1178014237 21:28325146-28325168 AAGGAAAGAACAAAGAAGGGAGG - Intergenic
1178146847 21:29750257-29750279 AAGGAATAAAGGAATGAGGGAGG - Intronic
1178158913 21:29888146-29888168 AAAGAAAAAAGAAAGGAGGGAGG - Intronic
1178235539 21:30837095-30837117 AAAGAGCATACAAATCAGGGTGG + Intergenic
1178290908 21:31367123-31367145 AAGGAGAGAAGGAAGGAGGGAGG + Intronic
1178455295 21:32744275-32744297 AAGAAAAAAAAAAAGGAGGGGGG + Intronic
1178684557 21:34701044-34701066 TAGGAGAAAAAAAATCAGTGAGG + Intronic
1179186194 21:39086945-39086967 AAGGAGAAATGAAATGAGAAGGG + Intergenic
1179355992 21:40660304-40660326 AAGAAGAAATCAAAGGAGGAGGG + Intronic
1179366327 21:40761394-40761416 GAGGAGAGAAAAAAAGAGGGAGG - Intronic
1180607977 22:17075572-17075594 AAGGAGACAGCAAATCAGCGTGG - Intergenic
1180729880 22:17973249-17973271 ATGGGGAAAACAAAGGTGGGGGG + Intronic
1181314652 22:21963567-21963589 CAGGAGAAGGCAAATGAGGAAGG - Intronic
1181741238 22:24923508-24923530 AAGGAGGAAGCAACAGAGGGAGG - Intronic
1182150912 22:28026460-28026482 AGGGAGAAAAGAAAGTAGGGAGG - Intronic
1182489627 22:30662666-30662688 AAAAAGAAAAAAAATGAGGCGGG + Exonic
1182694068 22:32184859-32184881 AAAAAGAAAAAAAAAGAGGGGGG - Intergenic
1182753241 22:32658228-32658250 CAGGAGAAACCAAAGGAAGGTGG + Intronic
1182805511 22:33066602-33066624 AAGGAGAAAAGAACTGAAGGCGG + Intergenic
1182927520 22:34139538-34139560 AGGGAGAAAACTATTCAGGGAGG - Intergenic
1182997357 22:34826465-34826487 AAGCAGAAAAAAAAGGAGGCTGG + Intergenic
1183252602 22:36740895-36740917 AAGGACAAAACAAGGGAGAGAGG - Intergenic
1183309348 22:37101092-37101114 AAGGAGCAGAGAAATGGGGGAGG + Intronic
1183698835 22:39438267-39438289 AAGGAGGAAAGAAGGGAGGGAGG - Intergenic
1183868831 22:40725226-40725248 AAGGAGAAGGAAGATGAGGGTGG - Intergenic
1184063363 22:42099387-42099409 AAAGAGAAAATAAAAGAGGCCGG - Intergenic
1184405054 22:44296152-44296174 AAAAAGAAAAGAAAAGAGGGAGG - Intronic
1184576094 22:45367516-45367538 AAGGAGACACCAAATTAGAGTGG - Intronic
1184719723 22:46304148-46304170 AAGAAAAAAAAAAATGAGCGGGG - Intronic
1184984030 22:48117284-48117306 AAGGAGAAGGGAAATGAAGGAGG + Intergenic
949161400 3:887212-887234 AAGGAAGAAAGGAATGAGGGAGG - Intergenic
949194886 3:1293237-1293259 AAGGAGAAAGAAAATGTGGAAGG - Intronic
949331947 3:2932750-2932772 AGAGAGAAAAAAAAGGAGGGAGG + Intronic
949365713 3:3278397-3278419 AAGGGGAAAAAAAAAGAGGATGG - Intergenic
949505722 3:4725443-4725465 AAGGACAAAACACAGGAGGAAGG - Intronic
949914184 3:8944617-8944639 AGGGAGAAAGGAAAGGAGGGAGG + Intronic
949986487 3:9545237-9545259 GAGGAAGAAAGAAATGAGGGAGG + Intronic
949994560 3:9606272-9606294 AAGAATAAAAAGAATGAGGGAGG - Intergenic
950398881 3:12755031-12755053 AAGGAAGAAAGAAAGGAGGGAGG - Intronic
950611521 3:14130109-14130131 AAGGAGAAAAAGAAAGAGAGAGG - Intronic
950907566 3:16552997-16553019 AAGGACAGAAGGAATGAGGGAGG + Intergenic
951150079 3:19278384-19278406 AAGGAAAAAAGGAAGGAGGGAGG + Intronic
951338238 3:21451688-21451710 AAGGACTAAACAAATGTAGGAGG - Intronic
951417663 3:22444937-22444959 AAGGAGAGAAGGAAGGAGGGAGG + Intergenic
951707771 3:25560698-25560720 AAGGAAGGAAAAAATGAGGGAGG - Intronic
952165566 3:30744814-30744836 TAATAGAAAACAAATGAGAGTGG + Intronic
952659273 3:35824685-35824707 TAGGTGAAAACTAATGGGGGAGG - Intergenic
952737582 3:36705755-36705777 AAAGAAAAAAGAAATGACGGTGG - Intergenic
952779436 3:37080763-37080785 AAGGAGAAAAAACATGAAAGAGG + Intronic
952949811 3:38513691-38513713 AAGGAGAAAGGGAAGGAGGGAGG - Intronic
953060605 3:39425746-39425768 GAGGAGAAAACAAAAGAAGGTGG + Intergenic
953460372 3:43077178-43077200 AAAGAGGAAAAAAAAGAGGGGGG + Intergenic
954067142 3:48115936-48115958 AAGGAGAAAAAAAAGGGTGGGGG - Intergenic
954382954 3:50229314-50229336 AAGGACAAAGAAAAGGAGGGAGG + Intronic
954655177 3:52190257-52190279 AAGGAGAGAGCCAAGGAGGGTGG + Intergenic
954681062 3:52346245-52346267 AAGGAGGGAAGAAAGGAGGGAGG - Intronic
954850150 3:53593270-53593292 AATGATAAAAGGAATGAGGGAGG + Intronic
954898502 3:53997832-53997854 AAGCAGAAAGCAAATGAAGCAGG + Intergenic
955905131 3:63799253-63799275 AAGGAGGAGACAAATGTGTGTGG + Intergenic
956279947 3:67545732-67545754 AAGGAGAGAGGAAAGGAGGGAGG - Intronic
956445629 3:69323042-69323064 AAGGAAAAAGACAATGAGGGAGG + Intronic
956677803 3:71752551-71752573 GAAGAAAAAACAAATGAGTGTGG + Intronic
956952264 3:74296253-74296275 GAGGAGAAGAAAAATGAGGGAGG + Intronic
957199001 3:77107926-77107948 AAGAAGAAAGAAAATGAGGCAGG - Intronic
957309721 3:78504446-78504468 TAGAAGGAAAAAAATGAGGGAGG + Intergenic
958737534 3:98026444-98026466 GGGCAGAAAACAAATCAGGGAGG - Intronic
959269124 3:104183183-104183205 AAGGAAAAAAGAAATAAGAGAGG + Intergenic
959445651 3:106435687-106435709 AAGAAGAAAAGAAAAGAGGGAGG + Intergenic
959465676 3:106683457-106683479 AAGGAGAAAAGAAATGCTAGAGG + Intergenic
959502754 3:107125267-107125289 AAGGAGAAGAAAAAAAAGGGGGG + Intergenic
959572109 3:107895720-107895742 AGGCAGAAAGCAAACGAGGGAGG + Intergenic
959658965 3:108843856-108843878 AAGAAGAAAACCAAAGAGGGAGG - Intronic
959711645 3:109391605-109391627 GAGGAGAAAAAAAATTAGAGAGG + Intergenic
959871813 3:111337389-111337411 AAGAGGAAGACAAAAGAGGGAGG + Intronic
960185648 3:114634918-114634940 TAGGAGCAAAGAAATGAGGAGGG + Intronic
960433721 3:117600483-117600505 AAGGCAAAAACAAATCAGTGGGG - Intergenic
960537482 3:118829157-118829179 AAGAAGAAACAAAAAGAGGGAGG + Intergenic
961192207 3:124971410-124971432 AAGGAGAAAGGAAAGGAAGGAGG - Intronic
961414730 3:126749039-126749061 AAGGAGACAAAGAATGAGGAGGG + Intronic
961939423 3:130622204-130622226 AAGGAAAAAAAAAAAGGGGGGGG - Intronic
962334468 3:134514375-134514397 AAGGAGAAAAAAAATGAGAATGG + Intronic
962528741 3:136258960-136258982 AAGGATTAAACAAATTTGGGGGG - Intronic
962533122 3:136301959-136301981 AAAGAGAAAAAAAATGAAGATGG + Intronic
962976630 3:140451592-140451614 AGGGTGAAAGCAAATGAGTGAGG + Intronic
962991169 3:140578607-140578629 AAAGAGAAAAAAAAAGAGGCTGG - Intergenic
963235923 3:142955852-142955874 AAGAAGAAAACACATGAGATAGG - Intronic
963404118 3:144840684-144840706 AAGGAGACACCAAATCAGAGTGG - Intergenic
963614361 3:147517133-147517155 AACAAGAAAACAAATGGGGAAGG - Intergenic
963704217 3:148665620-148665642 AATGAGAAGACCAAGGAGGGAGG - Intergenic
963764692 3:149322726-149322748 AAGTAGAAAATAAATAAAGGTGG - Intronic
963871314 3:150417420-150417442 GAAGACAAAACAAAGGAGGGAGG + Intronic
963976220 3:151483490-151483512 ATGTAGAAAAGAAAAGAGGGGGG + Intergenic
964149383 3:153506389-153506411 AAGTGGTAAACATATGAGGGAGG + Intergenic
964282129 3:155079202-155079224 AAAAAGAAAACGAAGGAGGGAGG + Intronic
964335326 3:155648754-155648776 AAAGAGAAAGCAAATGACAGAGG + Intronic
964372684 3:156017552-156017574 AGAGAGATCACAAATGAGGGAGG + Intergenic
964462925 3:156956237-156956259 GAGGAGAAAGCAAGTGAGGTAGG - Intronic
964777186 3:160291603-160291625 AAGGTGAAAACAAATAAGCGTGG + Intronic
964942013 3:162170031-162170053 AGGAAGAAAAGAAAGGAGGGAGG - Intergenic
964969118 3:162538521-162538543 AAGGAAATAAAAAATGAAGGAGG - Intergenic
965567555 3:170136883-170136905 TAAGAGAAAAGAAAAGAGGGAGG + Intronic
966248404 3:177834477-177834499 AAGGAGAACAAAGAGGAGGGTGG + Intergenic
966266225 3:178047721-178047743 AAGGAGAAAGGAAAGGAGGAAGG + Intergenic
966679044 3:182620627-182620649 AAGGAGAGAACAAAGAAGGGAGG + Intergenic
967193782 3:187009073-187009095 AAGAAGAAAAGAAGGGAGGGAGG - Intronic
967365483 3:188681660-188681682 AAGGAGAAGGAAAAGGAGGGAGG + Intronic
967710050 3:192696410-192696432 AATCAGCAAACAGATGAGGGAGG + Intronic
967953356 3:194857938-194857960 AGGGAGAGAAGAAATGAGGCAGG - Intergenic
968138311 3:196235388-196235410 GAAGAGAAAAAATATGAGGGAGG - Exonic
968424614 4:514185-514207 AAGGAGAAGGGAAATGAGTGTGG - Intronic
968729198 4:2261752-2261774 AGGGAGAAAACAAAGGCGGCCGG - Exonic
968914314 4:3490552-3490574 AAGGAAAAAACGAATGAGCAGGG - Intronic
968961666 4:3748387-3748409 AATGAGAAAATAAATGGGGCAGG + Intergenic
969303925 4:6314267-6314289 AAGAAGGAAACACATGAGGCAGG - Intergenic
969544671 4:7817618-7817640 AAGGACAAAACAACTAATGGGGG + Intronic
969551257 4:7869175-7869197 AAAGAGAAAAGAAAAGAGGAAGG + Intronic
969581164 4:8066319-8066341 AAAGAAAAAAGAAAGGAGGGAGG + Intronic
969621091 4:8279218-8279240 AAAGAGAAAATAAAACAGGGAGG - Intronic
969711102 4:8844476-8844498 AAAAAGAAAACAAAAGAGGCCGG + Intergenic
970289911 4:14560883-14560905 AAAGAGAAAAGAAGGGAGGGAGG + Intergenic
970365069 4:15350144-15350166 AAGGAGGAAAGAAGGGAGGGAGG + Intronic
970365093 4:15350224-15350246 AAGGAGGAAAGAAGGGAGGGAGG + Intronic
970365122 4:15350321-15350343 AAGGAGGAAAGAAAGGAGGGAGG + Intronic
970689942 4:18611506-18611528 AGGGAGGAAGAAAATGAGGGAGG + Intergenic
970867245 4:20773288-20773310 TAGGAGAAGGCAAAGGAGGGTGG - Intronic
971389750 4:26175031-26175053 AATGAGAAAACACATGAAGAGGG - Intronic
971394343 4:26214660-26214682 AAGGAAGAAACAAGGGAGGGAGG + Intronic
971399322 4:26261429-26261451 AAGTAGAAAAGAAATGAGGAAGG + Intronic
971562780 4:28102514-28102536 AAGAAGAAAAATATTGAGGGTGG + Intergenic
971677053 4:29645543-29645565 ATGGTGAGAACAAATGCGGGTGG + Intergenic
972047817 4:34691194-34691216 AAGGATTAAACAAATAATGGGGG + Intergenic
972142047 4:35973204-35973226 AAGAAGAAAAGAAAGGAAGGAGG + Intronic
972278919 4:37584818-37584840 AAGGAGGAAAGAAAAGAGGGAGG - Intronic
972369444 4:38408863-38408885 AGGGAGGAAAGAAAGGAGGGAGG + Intergenic
973331138 4:48911057-48911079 AAGGAAAAAGGAAGTGAGGGAGG - Intergenic
973544386 4:51966181-51966203 AAGGAGGAAAGGAAGGAGGGAGG - Intergenic
973779080 4:54271679-54271701 AAAGAGAGAACAAAGGAGGGAGG - Intronic
973830231 4:54752069-54752091 AAAGGGAAATGAAATGAGGGAGG - Intergenic
974099576 4:57402021-57402043 AAGGAGAGAAAGAGTGAGGGAGG + Intergenic
974283098 4:59824750-59824772 CTGGAGAAAAGAAAGGAGGGTGG - Intergenic
974518350 4:62945751-62945773 AAGGAAAAAAAAAGGGAGGGGGG - Intergenic
975347923 4:73314971-73314993 AAGTAGAAAACAAATGAATTAGG + Intergenic
975441569 4:74417240-74417262 AAGGAGCAAAGAAGTGAGGTTGG + Intergenic
975915288 4:79317804-79317826 GAGAAGAAAACAAATGAGAAAGG + Intronic
976523243 4:86054887-86054909 ATGGAGAGAACAGCTGAGGGAGG + Intronic
976708409 4:88042625-88042647 AAAGAGAAAAGAAATAAGGCTGG - Intronic
976739187 4:88341267-88341289 GAGGAGAACACAAATGAAGCAGG - Intergenic
976832588 4:89331884-89331906 AAGGACAAGACAACAGAGGGAGG - Intergenic
976961353 4:90980053-90980075 AAGGAGATAAATAATCAGGGTGG + Intronic
977019178 4:91738207-91738229 AGGGAGAAAAGAAAAGAGAGGGG + Intergenic
977790928 4:101102217-101102239 AAGAAGGAAAGAAAGGAGGGAGG + Intronic
977851269 4:101832819-101832841 AAGGAGAAAACCAATGGAGATGG - Intronic
977872231 4:102105829-102105851 AAGGAGACACCAAATCAGAGTGG + Intergenic
977902634 4:102439610-102439632 AGGAAGAAAACAAATAAGGAAGG + Intergenic
978081757 4:104601968-104601990 AAAGAGAAAGAAAAGGAGGGAGG - Intergenic
978278909 4:106985875-106985897 AGGGAGAGAAGAAAGGAGGGAGG + Intronic
978735741 4:112082391-112082413 AAGGAAAAAGCAAATGAAGCAGG + Intergenic
978802412 4:112767989-112768011 AAGGAGAAAACAAAGGGAGAAGG + Intergenic
978991065 4:115083296-115083318 AAAAAGAAAACAAATTAGGCAGG + Intronic
979411902 4:120389461-120389483 GAAGAGAGAACAAAAGAGGGAGG + Intergenic
979528024 4:121737712-121737734 AAGGAAAAAAAAAATCAGTGAGG + Intergenic
979938714 4:126731838-126731860 AAGAAGAAAAAAAAAGAGGCTGG + Intergenic
980067244 4:128203338-128203360 AAAAAGAAAAGAAAAGAGGGAGG - Intronic
980194018 4:129564812-129564834 AAGGATAAACCAAATGAAGCTGG - Intergenic
980253809 4:130350340-130350362 AAGGAGAAAACAGAGGAAAGAGG - Intergenic
980299910 4:130976062-130976084 AAGGAGGAAAAAATGGAGGGAGG - Intergenic
980442394 4:132866465-132866487 CTGGAGAAAACAAATAGGGGAGG + Intergenic
981595780 4:146420091-146420113 AAGAAGAAAACAAAACAGAGAGG + Intronic
981706919 4:147669451-147669473 AAGGATACAAGAAAAGAGGGAGG + Intronic
981879064 4:149587038-149587060 AAGGAGAAAACCACAGAGAGAGG - Intergenic
981892580 4:149755615-149755637 AAGAAGAAAATAAATCAGGAGGG - Intergenic
981912241 4:149995373-149995395 AAGAAGGAAAGAAAAGAGGGAGG + Intergenic
981915911 4:150032993-150033015 AAAGAGATCACAAATGAGGGAGG + Intergenic
982034735 4:151334527-151334549 AAGGAGAAAACAGATATTGGGGG - Intergenic
982147817 4:152417080-152417102 AACGAAACAACAAAGGAGGGAGG - Intronic
982274861 4:153628319-153628341 AAAGAGAAGAAAAATGAGGGAGG - Intronic
982371542 4:154638904-154638926 AAGGAGATAACAAATGGGAGAGG + Intronic
982431061 4:155322626-155322648 AAGGAAAAATCAAATCAGGTAGG - Intergenic
982450827 4:155550652-155550674 AAAGAGAAAAAAAAAGGGGGGGG - Intergenic
982485039 4:155956207-155956229 AAGGAAAAAAAAAAGGATGGGGG + Intergenic
982580504 4:157173004-157173026 AATGAGAAAACGAATTAGGAGGG - Intergenic
982988289 4:162238386-162238408 CATGAGAAGCCAAATGAGGGAGG - Intergenic
983379732 4:166976656-166976678 AAGGAGAAAAATAAAGAAGGAGG - Intronic
983446124 4:167855271-167855293 CAGGAGAAATCTAATGATGGTGG + Intergenic
983804927 4:171982999-171983021 AAGGAGGAAAAAAGGGAGGGAGG - Intronic
983988062 4:174084186-174084208 AGGGAGCAAACATTTGAGGGAGG - Intergenic
984351602 4:178601326-178601348 AAGGAGACATCAAATCAGAGTGG - Intergenic
984612357 4:181855961-181855983 AAGGAGGAAGGAAAAGAGGGAGG + Intergenic
984720806 4:182970901-182970923 AAGGAAAAAGGAAAGGAGGGAGG + Intergenic
984791527 4:183619398-183619420 AAAGAGAACCCAAATGAGTGGGG - Intergenic
984872188 4:184335634-184335656 GAGGAGAAATCAAAGGTGGGAGG - Intergenic
985006214 4:185537414-185537436 AAGAAAAAAACAAATGAGGCCGG - Intergenic
985303556 4:188514714-188514736 AAGGAGAAAGCAGGTGAGGTGGG - Intergenic
985377776 4:189360136-189360158 AAGGAGAAAACCAATGACTAAGG + Intergenic
985819918 5:2152827-2152849 AGGGAGAAAAGAAGGGAGGGAGG - Intergenic
986001110 5:3631629-3631651 AAGGAGAAAGGAAATGAAAGGGG - Intergenic
986283983 5:6346533-6346555 AAGGAGGAAAGGAAGGAGGGAGG + Intergenic
986827023 5:11532881-11532903 CAGGAGAAAAAGAAGGAGGGAGG + Intronic
986879075 5:12147789-12147811 AAGGAGGAAAGGAAGGAGGGAGG - Intergenic
987095285 5:14544069-14544091 AAGGAGAGAGCTAAAGAGGGAGG + Intergenic
987210541 5:15677516-15677538 AAGGAGAAAAGGAGGGAGGGAGG + Intronic
987351591 5:17026914-17026936 AACGAACAAACAAATGAGGAGGG - Intergenic
987478620 5:18424593-18424615 AAGGAGGAAGCAAGTGAAGGGGG + Intergenic
987738956 5:21880510-21880532 AAGGAAGAAAGAAAAGAGGGAGG - Intronic
987955078 5:24728748-24728770 AAAGAGAAAGCGAATGAGGGTGG - Intergenic
988106075 5:26750156-26750178 AAGGAGAAGAAAAAAGAGGAGGG - Intergenic
988176974 5:27741306-27741328 AAGTATAAAACAAATGATGCTGG + Intergenic
988832662 5:35002983-35003005 AAGGACAGGACAAATTAGGGAGG + Intronic
988903925 5:35764827-35764849 AGGGAGAAAAGAAATAAGCGGGG - Intronic
988976820 5:36524190-36524212 AAGAAGAAAACAAAAGTAGGGGG - Intergenic
989003962 5:36789236-36789258 AGAGAGAAAAAAAAGGAGGGAGG - Intergenic
989125759 5:38051019-38051041 TAGGAGCAAACAAATGTGTGTGG + Intergenic
989422253 5:41253570-41253592 AGAGAGAAAACAAATTAGGTGGG - Intronic
989488167 5:42016355-42016377 AAGGAAAAAAAAAAGGAGGGAGG - Intergenic
989800789 5:45536071-45536093 GAGGAGAATACAAATGAAAGTGG - Intronic
989812856 5:45697617-45697639 GAGGAAAAAAAAAATGAGTGGGG + Intergenic
989813540 5:45708071-45708093 AAGGTCAACACAAATGAGGAAGG - Intergenic
990034605 5:51304473-51304495 AATAAGAATAGAAATGAGGGAGG + Intergenic
990062351 5:51667603-51667625 AAGGAGAGAACGAAAAAGGGAGG - Intergenic
990335726 5:54770409-54770431 AAGGAGAAAGGAAAGAAGGGAGG + Intergenic
990443767 5:55873063-55873085 AAAGAGAAAACAAAGGATTGAGG - Intronic
990504639 5:56432291-56432313 AAGGAGAAAACGAATGAAAGAGG - Intergenic
990644468 5:57828396-57828418 AAGGAGTTAACAAAGGAGGATGG + Intergenic
990905266 5:60796184-60796206 AGTGAGAAAACAGATGAGGAAGG - Intronic
990977171 5:61570269-61570291 AAGAAGAAAGAAAATGATGGGGG + Intergenic
991047704 5:62240212-62240234 TATGAGAAAACAAATAGGGGTGG + Intergenic
991272162 5:64796848-64796870 AAGGAGGAAAGAAGGGAGGGAGG - Intronic
992270846 5:75061485-75061507 AAGCAGAAACAAAATGGGGGAGG - Intergenic
992808376 5:80361124-80361146 AAGGATAGAAGAAAGGAGGGAGG - Intergenic
992808386 5:80361165-80361187 AAGGATAGAAGAAAGGAGGGAGG - Intergenic
992808396 5:80361202-80361224 AAGGAAAGAAGAAAGGAGGGAGG - Intergenic
992808409 5:80361274-80361296 AAGGAAAGAAGAAAGGAGGGAGG - Intergenic
992990195 5:82275977-82275999 TAGGATAAAAAAAATAAGGGGGG + Exonic
992994849 5:82322803-82322825 AGTGAGAAAACAGGTGAGGGTGG + Intronic
993032265 5:82718331-82718353 AAGGAGAAAAGAAAGAAGGAGGG + Intergenic
993054613 5:82968000-82968022 AAGGAGACACCAAATGGGAGTGG + Intergenic
993213163 5:84981043-84981065 AAGGAAAAAAGAAAAGAGGAAGG - Intergenic
993305968 5:86275756-86275778 AAAGAGAAAGCAAAAGAGAGAGG - Intergenic
993346923 5:86795719-86795741 AAGGAGAAAACAAAGGAGGAAGG + Intergenic
993395890 5:87388017-87388039 AAGGAGATAATAATTGAGGTGGG - Intronic
993527767 5:88987703-88987725 AGGGAGAAAGGAAAGGAGGGCGG - Intergenic
993626281 5:90228258-90228280 AACGGGTAAACAAGTGAGGGAGG + Intergenic
993760897 5:91795921-91795943 AACTAGAAAACAAATGAGCAAGG + Intergenic
993807371 5:92428036-92428058 AAGGAGAAACTAAATGAAGAAGG - Intergenic
994038018 5:95224830-95224852 AGGAAGAAAACAAATGATTGGGG - Intronic
994102493 5:95909115-95909137 ATGGAGAAGACAAATAAGGGAGG + Intronic
994574762 5:101564134-101564156 AAGGGGGAAAAAAAAGAGGGAGG - Intergenic
994856768 5:105131474-105131496 AAGGAAAAAAGAAAGGAAGGAGG - Intergenic
995092116 5:108190107-108190129 CAGTAGAAAACAAATGCAGGAGG + Intronic
995205302 5:109473123-109473145 AAGAAGAAAAGAAAAGAAGGAGG - Intergenic
995219013 5:109627230-109627252 AAAGAAAAAAAAAAGGAGGGAGG - Intergenic
995261744 5:110112242-110112264 AAGAAGAAAAGGGATGAGGGTGG + Intergenic
995690571 5:114821921-114821943 AAGTAGAAAAAAAAAGAGGGAGG - Intergenic
995796512 5:115946862-115946884 AATGAGTCAACAATTGAGGGAGG - Intergenic
995976101 5:118036551-118036573 AGGGAGGAAGAAAATGAGGGAGG + Intergenic
996136070 5:119843955-119843977 AAGGAGAAAAAGAAAGAGAGAGG - Intergenic
996366334 5:122705187-122705209 AAGAAGAAAACAAAGGGGGATGG - Intergenic
996452884 5:123646892-123646914 ATGGAAAAAAATAATGAGGGAGG - Intergenic
996995038 5:129685685-129685707 AAGGAGAAAACAAACGTGGCAGG + Intronic
997035677 5:130188690-130188712 ATGTAGAAAACAACGGAGGGGGG + Intergenic
997040866 5:130252120-130252142 AAGGAGAAGAAAAATGAGGAAGG - Intergenic
997098024 5:130935718-130935740 AAAGAAAAAAAAAAGGAGGGTGG + Intergenic
997257941 5:132443627-132443649 AAGGAAGAAAGAAAGGAGGGAGG + Intronic
997464604 5:134078963-134078985 AAGAAAAAAAAAAAGGAGGGGGG - Intergenic
997648489 5:135497589-135497611 AAGTGGAAAACAAAGGAGGCAGG + Intergenic
998157455 5:139795125-139795147 AAGGAGAAAGAACCTGAGGGAGG - Intergenic
998556740 5:143132407-143132429 AAGGAGAAAACTCAGGAGGGAGG + Intronic
998614869 5:143728836-143728858 AAGAAGAAAACAAATTCAGGGGG - Intergenic
999065209 5:148678433-148678455 AAGGAGAAAGGAAAGGAGAGGGG - Intergenic
999483531 5:151970884-151970906 AAGGAGGGAAGAAAGGAGGGAGG - Intergenic
999868213 5:155724985-155725007 AAGAAGAAAAGAAATTAGGAAGG - Intergenic
999889364 5:155960116-155960138 AGGGAGAAGAAAAAGGAGGGAGG - Intronic
1000147586 5:158468344-158468366 AGGGAGGAAGGAAATGAGGGAGG - Intergenic
1000266343 5:159641574-159641596 AAGGAGAAAAGAAAGAAGGAAGG + Intergenic
1000392099 5:160733530-160733552 AGGGAAAAAGCAAATGAGAGGGG + Intronic
1000626418 5:163544584-163544606 AAAGAGAAAAGAAAGAAGGGAGG + Intergenic
1000984848 5:167855708-167855730 AAGGAGAAAGGAAAGAAGGGAGG + Intronic
1001405472 5:171473932-171473954 TAGGAGAAAACGAAAAAGGGTGG - Intergenic
1002393354 5:178933879-178933901 AAGTAGAAAAGAAAAGACGGGGG + Intergenic
1002797279 6:484407-484429 GCTGAGAAAACAAATTAGGGAGG - Intergenic
1002831722 6:827785-827807 AAGGAGAAATAAAATGAAGAAGG - Intergenic
1002840153 6:898519-898541 AGGGAGAAAGCAAAGGATGGAGG - Intergenic
1003095095 6:3136268-3136290 AAGAAGAAAACATTTGGGGGCGG - Intronic
1003098883 6:3162518-3162540 AGGGAGAAAAAAAGGGAGGGAGG - Intergenic
1003211449 6:4071585-4071607 GAGGAGCAAACAAATGGAGGCGG - Intronic
1003381974 6:5632961-5632983 AAGGAAGGAAAAAATGAGGGAGG - Intronic
1003418493 6:5934818-5934840 GAGGAGCTAACAAATGAGGCAGG + Intergenic
1003699066 6:8442030-8442052 AAAGAACAAACAAATGAAGGAGG + Intergenic
1003727229 6:8779031-8779053 CAGGTGAAAAAAGATGAGGGGGG - Intergenic
1003881945 6:10487184-10487206 AAGCAGAAACAAAACGAGGGAGG + Intergenic
1004086851 6:12458166-12458188 AAGGAGGAAGCAAATGGAGGGGG - Intergenic
1004114262 6:12750424-12750446 AAGGAGAGAAGAAATGAGAAGGG + Intronic
1004404979 6:15324478-15324500 AAGAAGAAGAAAAAGGAGGGGGG - Intronic
1004813125 6:19281692-19281714 AAGGAGAAAAAAAATGGGGTGGG + Intergenic
1004948073 6:20637260-20637282 GGGGAGTAAACAAATGAGGAAGG + Intronic
1005112101 6:22293716-22293738 AAGGAGGGAACAAGGGAGGGAGG + Intronic
1005221274 6:23591674-23591696 AGGGAGAAAAAAAATGACGCTGG + Intergenic
1005224115 6:23621226-23621248 AAGGAGAAAGTAAGTGGGGGAGG + Intergenic
1005819470 6:29585770-29585792 TAGGAGAAAAATAATGAGAGTGG + Intronic
1005942381 6:30570376-30570398 CTGAAGAAAACAAAGGAGGGAGG + Intergenic
1006057658 6:31397348-31397370 AAGGAAAACGCAAATGAGTGGGG - Intergenic
1006070140 6:31492348-31492370 AAGGAAAACGCAAATGAGTGGGG - Intergenic
1006119261 6:31794412-31794434 AAAGAGAAATGAAATGAGGAAGG - Intronic
1006266531 6:32930015-32930037 AAGGAGGGAGCAAATGAAGGAGG + Intergenic
1006462591 6:34171212-34171234 AAGAAGGAAAGAAAGGAGGGAGG + Intergenic
1006822306 6:36907045-36907067 AAGGAGGAAAAGAAGGAGGGAGG - Intronic
1006865471 6:37206059-37206081 AAAGAAAAAAGAAAGGAGGGAGG - Intergenic
1007013278 6:38438193-38438215 AAGGAGGAAAGGAAGGAGGGAGG + Intronic
1007089418 6:39172889-39172911 AAGGAGAAAATAAAAGAAAGAGG + Intergenic
1007188487 6:39993697-39993719 AAGGAAGAAACAAATGATAGTGG - Intergenic
1007518099 6:42429403-42429425 CAGGAGAAAACCACGGAGGGGGG + Intronic
1007558031 6:42782889-42782911 AGAGAGAAAAGAAACGAGGGGGG - Intronic
1007581969 6:42965205-42965227 AAGGAGGCACAAAATGAGGGTGG + Intronic
1007888809 6:45264782-45264804 AAAGAGAAAAGAAAGAAGGGAGG + Intronic
1008102531 6:47407300-47407322 CAGGAAAAAACAGATGAGGATGG + Intergenic
1008369065 6:50713079-50713101 AAGAAAAACACAAAAGAGGGGGG + Intergenic
1008378872 6:50820854-50820876 AGGGAGAGAAGAAAGGAGGGAGG + Intronic
1008401765 6:51071601-51071623 AAGGATAAAACAATAGATGGAGG - Intergenic
1008609175 6:53169984-53170006 AAGAAGAAAAGAAAGGAAGGAGG + Intergenic
1008612551 6:53197641-53197663 AAGGAGGGAAGGAATGAGGGAGG + Intergenic
1009400054 6:63244040-63244062 AAGGAGAAAATAGATCTGGGTGG - Intergenic
1009738077 6:67705045-67705067 AGGAAAAAAAAAAATGAGGGGGG + Intergenic
1009874923 6:69493853-69493875 AAGGAGACACCAAATCAGAGTGG + Intergenic
1009882380 6:69584400-69584422 AGGGAGAAAGGAAAGGAGGGAGG + Intergenic
1010478333 6:76317734-76317756 AAGGAGAAAAGAAAGGAGAAAGG - Intergenic
1011063770 6:83301284-83301306 AAGAAGGAAAGAAAGGAGGGAGG - Intronic
1011085609 6:83537338-83537360 AAAGAGAAAAGAAGAGAGGGAGG - Intergenic
1011118468 6:83923000-83923022 AGAGAGAAAAAAAATAAGGGGGG - Intronic
1011227378 6:85122543-85122565 AAGGACTAAACAAATGACAGAGG - Intergenic
1011307816 6:85948022-85948044 AAGAAAAAAACAAAAGAGGGAGG + Intergenic
1011396829 6:86919142-86919164 GAGGAGAAAACACTTGAGGAGGG - Intergenic
1011561598 6:88623080-88623102 AAGAAGGAAAGAAAGGAGGGAGG + Intronic
1011692151 6:89879987-89880009 AAGGAGAAAATAAATAAAGGAGG - Intergenic
1011713222 6:90076499-90076521 AAGGAGAATACAAAATAGGCAGG + Intronic
1012330965 6:97986600-97986622 AGGAAGAACAAAAATGAGGGTGG + Intergenic
1012362312 6:98397802-98397824 AAAGAGAAAAAAAAAGGGGGGGG - Intergenic
1012970335 6:105722328-105722350 AAGGAGGAGACAAAGAAGGGAGG + Intergenic
1013541386 6:111113723-111113745 AAGAGGAATACAAATAAGGGAGG + Intronic
1013668823 6:112376151-112376173 GAGGAGAAGGAAAATGAGGGAGG + Intergenic
1013934236 6:115573613-115573635 AAGGAGAAGTCAACTGAGAGAGG + Intergenic
1014214570 6:118740216-118740238 AAGCAGAAAATGAATGAGTGAGG - Intergenic
1014348055 6:120300669-120300691 AAGCAGAAAAAAAATGACAGAGG - Intergenic
1014596719 6:123352519-123352541 AAGGTAAAAAAAAATGAAGGAGG - Intronic
1014629832 6:123774590-123774612 GAGGAGTAGACAAATGAGAGTGG - Intergenic
1014683903 6:124470457-124470479 AAGGTGAAAACAGATGAGTGAGG + Intronic
1014761175 6:125358348-125358370 AAGGAGGGAACAAATGAGGAAGG - Intergenic
1015817187 6:137222406-137222428 ATGAAGAAAACAAATTGGGGTGG + Intergenic
1015845688 6:137518538-137518560 AAGGAGAAAAAAAAAGTGGGGGG - Intergenic
1015885129 6:137910081-137910103 AAGAAGAAAAGAATTGAGGAAGG - Intergenic
1016014635 6:139171226-139171248 AAAGAGAAAAAAAAGGAAGGAGG + Intronic
1016331143 6:142952901-142952923 AAGGGGAAAAGAAGAGAGGGAGG + Intergenic
1016404338 6:143714721-143714743 GAGAAGAAAAGAAATGAAGGGGG - Intronic
1016943181 6:149501260-149501282 AAGGAGAAAACAGAAGTGGCAGG + Intergenic
1017240542 6:152163516-152163538 AAAGAAAGAATAAATGAGGGAGG + Intronic
1017736645 6:157370854-157370876 AAGGAGAGAAGAAAAGGGGGGGG + Intergenic
1018337017 6:162803215-162803237 AAGGAGAAAAGAAAAGAGTGAGG + Intronic
1019993603 7:4709103-4709125 AAGGAAAAAAGAAAAGAGGCTGG + Intronic
1020201822 7:6086027-6086049 AAAGAAAAAAAAAAAGAGGGTGG - Intergenic
1020394282 7:7696222-7696244 AAGGAGAAAACAAATTACACTGG - Intronic
1020481236 7:8664191-8664213 AAAGAGAAAGCACTTGAGGGAGG - Intronic
1020669122 7:11083886-11083908 TAGGAGAAAATAAATAATGGAGG + Intronic
1020836932 7:13165282-13165304 AAGGAGAAAATAAAGGAGTGAGG + Intergenic
1020887719 7:13840066-13840088 GAGGAGAAAAGAAAGGAGGAAGG + Intergenic
1021105329 7:16632056-16632078 AAGGAGAAAGAGAAGGAGGGAGG - Intronic
1021352965 7:19617704-19617726 AAGGAGGAAAGAAAGGAGGAAGG - Intergenic
1021847715 7:24778882-24778904 AAGGAGAAAATAAATTTGGAGGG + Intergenic
1021971042 7:25966539-25966561 AAGGAGGAAAGAAAGGAGGAAGG + Intergenic
1022212359 7:28224140-28224162 AAGGAGAAAAGAAATGGGGTCGG - Intergenic
1022225562 7:28358970-28358992 AAGAAGAAAAGAAAGGAGAGGGG - Intronic
1022575537 7:31493431-31493453 ATGGAGAAAACACAAGATGGTGG - Intergenic
1022664304 7:32396115-32396137 AAAGAGAAAAGCTATGAGGGTGG + Intergenic
1022903271 7:34831453-34831475 AGGGAGAAAAGAAAGGAGGGGGG + Intronic
1023488831 7:40715544-40715566 AGATAGAAAACACATGAGGGGGG - Intronic
1023502462 7:40865149-40865171 AAGGAGAAAAGAGAGGAGGAGGG - Intergenic
1023910079 7:44547691-44547713 AAAGAGAAAAGAAAGGAGGAAGG + Intergenic
1024055993 7:45660197-45660219 AAGGATCAACCAAATGAGGGGGG - Intronic
1024278872 7:47701507-47701529 AAGAAGAAAAGGAAGGAGGGAGG + Intronic
1024859892 7:53826274-53826296 AAAGAGAAAAGAAAAGAAGGAGG + Intergenic
1025173205 7:56780250-56780272 AAGAAAAAAAGAAAGGAGGGAGG + Intergenic
1025296195 7:57776736-57776758 AATGATAAAATAAATGATGGCGG - Intergenic
1025698900 7:63797927-63797949 AAGAAAAAAAGAAAGGAGGGAGG - Intergenic
1026191869 7:68136285-68136307 AAGGAGAAAGAGAAGGAGGGGGG + Intergenic
1026192236 7:68140086-68140108 AGAGAGAAAGCAAAAGAGGGAGG + Intergenic
1026517297 7:71084107-71084129 AAGGAGAAAGGAAAAAAGGGAGG - Intergenic
1026533048 7:71216872-71216894 AAGGAGAAAATAAATGACTAAGG - Intronic
1026654575 7:72246014-72246036 AGGGAGAAAAGAAAGGAGGCTGG - Intronic
1026793488 7:73350534-73350556 ACGGAAAAAGCAAAGGAGGGGGG - Intronic
1026890876 7:73981500-73981522 AAGGAAGGAACAAAGGAGGGAGG + Intergenic
1026950750 7:74344916-74344938 AAGGAGGAGACAGAGGAGGGTGG + Intronic
1027047636 7:75001591-75001613 AAGGTGATACCACATGAGGGCGG + Intronic
1027146170 7:75696344-75696366 AAGGACAAAGAAAATGAGAGAGG - Intronic
1027353991 7:77338974-77338996 AAGGAGAAAAGAAATAAGTTTGG + Intronic
1027550715 7:79590855-79590877 AAGGAAAGAACAAATGAGCCAGG - Intergenic
1027576281 7:79934867-79934889 CAGGAGAACACAGACGAGGGTGG + Intergenic
1027646704 7:80810586-80810608 AAGTAGACAACGAAAGAGGGAGG - Intronic
1027768936 7:82382026-82382048 AAGAAAAAAACATATCAGGGAGG + Intronic
1028271427 7:88795522-88795544 AACAAGAAAACAAATAAAGGGGG - Intronic
1028505551 7:91566524-91566546 AAGAAGAAAACAAGAGAGTGAGG - Intergenic
1029165277 7:98584864-98584886 AAGGAGAAAAGGAAGGAAGGAGG - Intergenic
1029273548 7:99391344-99391366 AAGGAAGAAAAAAAGGAGGGAGG - Intronic
1029846419 7:103416744-103416766 AAGGAGGAAGAAAATGAGAGAGG - Intronic
1030066029 7:105659861-105659883 AAAGAGAAAAGAAATGTGAGTGG - Intronic
1030177110 7:106665948-106665970 GAGGAGAAAAAATATGAGGCTGG + Intergenic
1030719133 7:112848625-112848647 AAGGAGAAGACTATTGAGGTGGG + Intronic
1030828479 7:114190699-114190721 GAGGAAAAAAGAAAAGAGGGAGG - Intronic
1030942445 7:115670934-115670956 AGAGAAAAAATAAATGAGGGAGG + Intergenic
1031318484 7:120289112-120289134 AAAGAGAAAGAAAGTGAGGGGGG + Intronic
1031564850 7:123283273-123283295 AAGGAGAAAACACATGTTCGAGG - Intergenic
1031870660 7:127086999-127087021 AAGGAAAAAATAAATAAGGGTGG + Intronic
1031925587 7:127635183-127635205 ATGGAGAAAACAAAGATGGGTGG + Intergenic
1032282586 7:130516548-130516570 AAGGAGAGAACAAAAGATGGAGG + Intronic
1032356889 7:131219596-131219618 AAGGAAAAAAAAAAAGTGGGAGG + Intronic
1032437921 7:131916852-131916874 AAATAGAAAACAAATAAGGCTGG + Intergenic
1032491406 7:132327043-132327065 AGGGAGAGAAGAAAGGAGGGAGG + Intronic
1032491411 7:132327063-132327085 AGGGAGAGAAGAAAGGAGGGAGG + Intronic
1032771783 7:135066730-135066752 ATGGATAAAAAAGATGAGGGGGG + Intronic
1033551491 7:142451874-142451896 CAGGAGAGAAAACATGAGGGTGG - Intergenic
1033712128 7:143958607-143958629 AAGTAGGAAACAAATGAGGCAGG - Intergenic
1034432992 7:151050259-151050281 AGGGAGCACACAAATGAGGCTGG + Intronic
1034461615 7:151200699-151200721 AAAGAGATAGCAAATCAGGGTGG - Intronic
1035516107 8:233065-233087 GAGGAGAAAACAGAGGAGGGAGG + Intronic
1035743593 8:1946177-1946199 ATGGAGGAAAGAAATGAGGAGGG + Intronic
1036156418 8:6346414-6346436 AAAAAGAAAGAAAATGAGGGCGG + Intergenic
1036279859 8:7391498-7391520 AAGGAGGAAAGGAAGGAGGGAGG - Intergenic
1036341663 8:7920385-7920407 AAGGAGGAAAGGAAGGAGGGAGG + Intergenic
1036448781 8:8846598-8846620 AAGGAGAAAAGAGATCAGAGAGG - Intronic
1036494559 8:9258481-9258503 AAGGACAAAGAAAATGATGGAGG + Intergenic
1036571142 8:9980577-9980599 AGGGAGAAAACAAGGGAGGGAGG - Intergenic
1036932711 8:12972147-12972169 AAAGAGGGAACAAATGAGGCAGG + Intronic
1037008113 8:13806869-13806891 AGGGAGAAAGCAAAGGAGGGAGG - Intergenic
1037008153 8:13806989-13807011 AGGGAGAAAGCCAAGGAGGGAGG - Intergenic
1037008158 8:13807009-13807031 AGGGAGGAAGCAAAGGAGGGAGG - Intergenic
1037008164 8:13807029-13807051 AGGGAGGAAGCAAATGAGGGAGG - Intergenic
1037704037 8:21301396-21301418 AAGGACCAAACATATGACGGTGG + Intergenic
1037731590 8:21529641-21529663 AATGAGAAAACAATTGAAGCTGG - Intergenic
1038280720 8:26161716-26161738 AAGGAGGAAAGAAATAAAGGAGG + Intergenic
1038378683 8:27070780-27070802 GAGGAAAAAACAAATAAAGGTGG + Intergenic
1038415083 8:27389266-27389288 AAGGAAAGAAGAAAGGAGGGAGG + Intronic
1038463739 8:27740898-27740920 AAGGAGGAAACACATCAGTGTGG + Intronic
1038481538 8:27905170-27905192 CAGGGGAAAACAAAGGAGAGGGG + Intronic
1038521385 8:28235403-28235425 AAAAAGAAAACAAACTAGGGAGG + Intergenic
1038689198 8:29746013-29746035 AAAGAGGAAACAAAAGAGTGAGG - Intergenic
1038835653 8:31119165-31119187 AAGAAGAAAAGAAAGGAGGGAGG - Intronic
1038980280 8:32752056-32752078 AAGAAGAAAACAATAGAGGACGG + Intronic
1039160932 8:34618865-34618887 AAGGAAAAAAGAAAGGAGGGAGG + Intergenic
1039182069 8:34878088-34878110 AGGGAGAAAAGAAGGGAGGGAGG + Intergenic
1039727788 8:40238490-40238512 AGGGAGAGAAGGAATGAGGGAGG - Intergenic
1039824520 8:41161700-41161722 AAGGAGAAAAGGAAGGAGAGAGG - Intergenic
1040441877 8:47451781-47451803 AAGGAGAAGAGAAGAGAGGGAGG + Intronic
1040537178 8:48320625-48320647 AAGGGGAAAATAAAGGAGGAAGG + Intergenic
1040675873 8:49749587-49749609 AAGGAGCAAAGAAGTGAGGGAGG + Intergenic
1041554419 8:59136703-59136725 AAAAAGAAAAGAAATGAGGAGGG + Intergenic
1041573938 8:59371116-59371138 AAGGAAAAAGGAAAGGAGGGAGG - Intergenic
1042098056 8:65240717-65240739 AAGGAGACCACAAAAGAGGAAGG + Intergenic
1042165087 8:65937658-65937680 AGGGAGGAAAGAAAGGAGGGAGG - Intergenic
1042280437 8:67050295-67050317 TAGGAGAAAAAAAAAGAGGCCGG - Intronic
1042514161 8:69642351-69642373 AAGATGAAAACAAAGGAAGGTGG + Intronic
1042601730 8:70505632-70505654 AAAGAGAAAAATAAAGAGGGAGG - Intergenic
1042748301 8:72131537-72131559 AAGGAGAAGAAAAAGGAAGGAGG - Intergenic
1042847287 8:73181138-73181160 AAGGAGAAATCATATGGTGGTGG + Intergenic
1043209593 8:77494230-77494252 AAGGAGAAAAGGAGGGAGGGAGG - Intergenic
1043913527 8:85893076-85893098 AAGGAGAGAATAAGGGAGGGAGG + Intergenic
1044176824 8:89136371-89136393 AAAAAGAAAAGAAAAGAGGGTGG + Intergenic
1044387419 8:91605899-91605921 AAGGAATAAACAAATGAAAGTGG - Intergenic
1044592899 8:93931098-93931120 AAGGAACAAACAAAGGATGGTGG - Intergenic
1045039241 8:98205571-98205593 AAGGCAAAAACAATGGAGGGAGG + Intronic
1045089250 8:98722833-98722855 AGGGAGAAAACACATGAGAGAGG + Intronic
1045286771 8:100798455-100798477 AACAAGAAAACACATGAAGGTGG - Intergenic
1045325757 8:101116564-101116586 GAGGAGATAGCAAAGGAGGGAGG + Intergenic
1045669956 8:104539779-104539801 AAGATAAAAAAAAATGAGGGAGG + Intronic
1045773227 8:105770011-105770033 AAGGAAACAAAAAATGAAGGTGG - Intronic
1046392725 8:113597660-113597682 AAGAAGGAAAGAAAGGAGGGAGG + Intergenic
1046521847 8:115335154-115335176 AGGGAGAAAACCAATGTGGCGGG - Intergenic
1046686391 8:117232249-117232271 CAGCAGAAAACAAATAAGAGGGG + Intergenic
1046785221 8:118258611-118258633 ATGTAGAAATCATATGAGGGGGG - Intronic
1047048329 8:121080030-121080052 AAGGAGAAGTCAAATTAGAGTGG - Intergenic
1047489850 8:125365451-125365473 ATGGAGAATACAAAACAGGGAGG - Intronic
1047517193 8:125565248-125565270 AAAAAGAAAACAGAAGAGGGAGG - Intergenic
1047556503 8:125937593-125937615 AAGGAGAGAACCAAGGAGGGAGG + Intergenic
1047767032 8:127998577-127998599 AAAAAGAAAAGAAAAGAGGGAGG - Intergenic
1048146096 8:131845259-131845281 AAGGAAAAAAGTAAGGAGGGAGG - Intergenic
1048366412 8:133742589-133742611 AAGGAGAAAAGAAGGGAGGAAGG + Intergenic
1048525478 8:135198426-135198448 AAGGAAAGAACAAAGAAGGGAGG + Intergenic
1048601870 8:135927015-135927037 AAAGAGAAAGTAAAGGAGGGGGG + Intergenic
1048717076 8:137282452-137282474 AAGGAGAAAGGCAATCAGGGCGG - Intergenic
1048821845 8:138387453-138387475 AAGGAGAAAAGAGAGGAAGGTGG - Intronic
1048828364 8:138451954-138451976 AAGGTGAAAAAGAATGAAGGAGG - Intronic
1049335997 8:142085698-142085720 AAAGAAAAAAGAAAGGAGGGAGG + Intergenic
1049484644 8:142848742-142848764 AAGGAGACAGTAAATCAGGGTGG - Intronic
1050089767 9:2006066-2006088 AAGAAGGAAAGAAAAGAGGGAGG - Intergenic
1050128393 9:2383473-2383495 CAGGAGCAAGAAAATGAGGGAGG + Intergenic
1050327143 9:4508707-4508729 CAGGAGAAAATCACTGAGGGAGG - Intronic
1050667388 9:7956056-7956078 AAGTAAAAAATAAATGATGGTGG - Intergenic
1050702652 9:8358269-8358291 AAGAAAAAAAAAAATGATGGGGG - Intronic
1050708971 9:8438042-8438064 AAGCAGGAAAAGAATGAGGGAGG + Intronic
1051164759 9:14249718-14249740 AAAGGGAAAAGAAATGAGGAAGG + Intronic
1051189256 9:14493797-14493819 AAGGAGAAGAACAAGGAGGGAGG - Intergenic
1051398613 9:16655163-16655185 AAGGAGGAAAAAACTGGGGGAGG + Intronic
1051438481 9:17057414-17057436 AGGGAGGCAACAGATGAGGGAGG + Intergenic
1051613706 9:18986605-18986627 AAGGAGAAAAAAAAAAGGGGGGG + Intronic
1051661075 9:19427628-19427650 GAAGAGAAAAGAAAGGAGGGGGG - Intronic
1051744634 9:20283737-20283759 AAAGAGAAAAAAAAAGGGGGGGG + Intergenic
1052505460 9:29348537-29348559 AGGGAGATAACAAACAAGGGAGG + Intergenic
1052590406 9:30485703-30485725 AAATAGAAAACAAATGATGGTGG - Intergenic
1053369459 9:37548589-37548611 AGGGAGAAAAGAAATCAAGGAGG - Intronic
1053466818 9:38314629-38314651 AGGGAGAGAACAAAAGAAGGAGG - Intergenic
1053946390 9:43313052-43313074 AGGGAGAAAGCAAGGGAGGGAGG + Intergenic
1054883209 9:70167146-70167168 AAGAACAAAACAAAACAGGGTGG - Intronic
1055202576 9:73684630-73684652 AAGGAGACACCAAATAAGAGTGG - Intergenic
1055399738 9:75910168-75910190 AAGGAGAAAACTATTGAGCTTGG - Intronic
1055544118 9:77349192-77349214 AGGGAGAGAACAAAGGAGGGAGG - Intronic
1055688796 9:78807949-78807971 AGGGAGAAAATAAATGGGGAGGG - Intergenic
1055723135 9:79197979-79198001 AAGGGGAAAAGAAAGGAGGTAGG - Intergenic
1056625219 9:88247734-88247756 AAAAACAAAACAAAAGAGGGAGG + Intergenic
1056998370 9:91484830-91484852 ATGGAGAAAATCAATCAGGGAGG + Intergenic
1057258452 9:93569354-93569376 AAGTAGAATAAAACTGAGGGAGG - Intergenic
1057289894 9:93798895-93798917 AAGGAGAAAGAGAAAGAGGGAGG - Intergenic
1057501943 9:95603090-95603112 AAGGAGAGAAGGAAGGAGGGTGG - Intergenic
1057730112 9:97601161-97601183 AAGGAGAAGCCAAATGGGGATGG - Exonic
1057925128 9:99139818-99139840 GAGGAGAAAAAAGATGAAGGGGG - Intronic
1058396959 9:104565275-104565297 AAGGAGAAATCATCTGAGAGGGG - Intergenic
1058569611 9:106326496-106326518 CAAGAGAAAAGAAAAGAGGGCGG - Intergenic
1058600944 9:106669565-106669587 AAGGAGGAATGAAAGGAGGGAGG + Intergenic
1058704748 9:107628962-107628984 AAGGTGAAAACAAGTAAAGGAGG - Intergenic
1058882370 9:109296877-109296899 AAAAAAAAAAAAAATGAGGGAGG + Intronic
1059050593 9:110920572-110920594 AAGGTAAAAACAAAAGAGGAAGG - Intronic
1059431533 9:114253417-114253439 GAGGAGAAAAAAGAGGAGGGAGG + Intronic
1059502425 9:114766608-114766630 AAGAAGGAAAGAAAGGAGGGAGG - Intergenic
1059623546 9:116035842-116035864 AAGCAGAAAACCAATGTGAGTGG + Intergenic
1059900684 9:118921798-118921820 AGGGAGAAATCAGATGAGGTGGG - Intergenic
1060273411 9:122164234-122164256 AAGGAGAAAAAGAAGAAGGGAGG + Intronic
1060734370 9:126057100-126057122 AAGGAAAAAAAAAAAGTGGGGGG + Intergenic
1060777195 9:126383681-126383703 AAAGAGAGAACAGATGGGGGAGG + Intronic
1060928716 9:127474232-127474254 AAGGATAAGACAAGTGAGTGGGG - Intronic
1060964588 9:127705605-127705627 AAAGAGAATAGAAATGGGGGAGG + Intronic
1060970810 9:127736660-127736682 AAAGAGAAAAGAAAGGAAGGAGG + Intergenic
1061563013 9:131418562-131418584 AAGAAGAAGACAAATCAGGCTGG - Intronic
1061689645 9:132315814-132315836 AAGGAGAAATCAAATGATGAGGG - Intronic
1061708652 9:132472111-132472133 AAGGAGAAAACATGTGGTGGTGG - Intronic
1203365146 Un_KI270442v1:249564-249586 AAGGAGAGAAGAACAGAGGGAGG + Intergenic
1203589520 Un_KI270747v1:41610-41632 AGGGAGAAAGCAAGGGAGGGAGG + Intergenic
1185700457 X:2227519-2227541 AAGCAGAGAAGAAAGGAGGGAGG + Intronic
1185766915 X:2732958-2732980 AGGGAGGAAGGAAATGAGGGAGG - Intronic
1186053665 X:5626726-5626748 AAGGAGAAAGGAAAGAAGGGAGG + Intergenic
1186091100 X:6049716-6049738 AAGGAAAAATAAAATGGGGGGGG + Intronic
1186270094 X:7877584-7877606 AGGGAGAGAAGAAAGGAGGGTGG + Intergenic
1186494631 X:10002415-10002437 AAGGTGAAAAGAAAAGAGAGAGG + Intergenic
1186544145 X:10431589-10431611 AGGAAAAAAGCAAATGAGGGAGG - Intergenic
1186590120 X:10921408-10921430 GAGGAGAAATAAAAGGAGGGAGG - Intergenic
1186659721 X:11657438-11657460 AAGGAGGAAACAAAAAAGGGAGG + Intronic
1186749464 X:12606777-12606799 AAGAAGAAAAGAAGGGAGGGAGG - Intronic
1186994721 X:15107717-15107739 AAGGAGATATCAAATCAGAGTGG - Intergenic
1187087094 X:16051956-16051978 AAAGAGAAAACAGAAGAGGTAGG - Intergenic
1187097705 X:16164934-16164956 AAGAAGAAAAGAAAAGAGGGAGG - Intergenic
1187465993 X:19528304-19528326 CAAGGGAAAACAAATGAAGGAGG + Intergenic
1187516596 X:19976899-19976921 AAGAAGTAAACACATGAGGTTGG - Intergenic
1187571635 X:20509618-20509640 AAGAAGAAAACAAAGGCAGGAGG + Intergenic
1187634271 X:21210076-21210098 CAGGAGAAAGAGAATGAGGGCGG - Intergenic
1187714228 X:22086237-22086259 AAGGAGACACCAAATCAGAGTGG - Intronic
1188211624 X:27432424-27432446 AGGGAGAAAACAGAAGAGGATGG + Intergenic
1188303045 X:28529027-28529049 AGGGAGAAAATGAAAGAGGGAGG + Intergenic
1188585426 X:31768519-31768541 AAGGAGAGAACAAAGAAGGGAGG - Intronic
1188591002 X:31834858-31834880 AAGGAGAAAAAAAAAAAGGAAGG + Intronic
1188619216 X:32199373-32199395 AAGGTGAAAACAAGTGAGTTTGG - Intronic
1189005822 X:36993622-36993644 AAGCAGAAAACATCTGAGGGGGG + Intergenic
1189472550 X:41325568-41325590 CAGCAGAGAACAGATGAGGGTGG - Intergenic
1190040640 X:47068766-47068788 AATGTGGAAACAAAGGAGGGGGG - Intergenic
1190107735 X:47571658-47571680 AAGAGGAAACCAAATGATGGAGG - Exonic
1190284742 X:48954655-48954677 AAGGGGAAAAGGAATGTGGGAGG + Intronic
1190627609 X:52351967-52351989 AAGGAGAAAACAAAAAAGAAAGG - Intergenic
1190704087 X:53011552-53011574 AAGAAGAAAAAAAAAGAGGCCGG - Intergenic
1190788896 X:53681669-53681691 AGGAACCAAACAAATGAGGGAGG + Intronic
1190887548 X:54542929-54542951 AAGGAGAAAAAAAAAGAGAATGG - Intronic
1191041942 X:56091259-56091281 AGAGAGAAAACAAGTGATGGGGG - Intergenic
1192224369 X:69218120-69218142 AAGGAGAAAATAAAAGTGTGGGG + Intergenic
1192627195 X:72742330-72742352 AGAGAGAAAATAAAGGAGGGAGG - Intergenic
1192654513 X:72978483-72978505 AGAGAGAAAATAAAGGAGGGAGG + Intergenic
1192759313 X:74079010-74079032 GAAAAGAGAACAAATGAGGGTGG - Intergenic
1194085076 X:89516380-89516402 AAGGAAAACAAAAATTAGGGAGG - Intergenic
1194478855 X:94394841-94394863 AAAGCAAAAACAAATGAGGGGGG - Intergenic
1194536554 X:95111449-95111471 AAGGAGAAAATAAAGTAAGGTGG - Intergenic
1194638915 X:96378514-96378536 AAGGAGAAACAAAAGGAGGGTGG + Intergenic
1195433496 X:104815826-104815848 AAAAAAAAAAAAAATGAGGGGGG - Intronic
1195804069 X:108743083-108743105 AAGGAGAAAAGAAGAGTGGGAGG + Intergenic
1196522020 X:116685419-116685441 GAAGAGAAAACAATTGAGGAAGG + Intergenic
1196821405 X:119703986-119704008 AAGGAAAAAACAGATGAAGCTGG - Intergenic
1196943664 X:120802514-120802536 AAGGAGAAAAGAAGAGAGGAAGG + Intergenic
1196989079 X:121307967-121307989 AAGGAGAAAAGAAAAAAAGGAGG - Intergenic
1197013017 X:121590008-121590030 AAGGAGAGAACAAACTAGAGAGG - Intergenic
1197020106 X:121676642-121676664 AAGAAGAAAAGAAATCAAGGTGG - Intergenic
1197421733 X:126243986-126244008 TGGCAGAAAACAAATGAGGATGG - Intergenic
1197744528 X:129922711-129922733 AAGGAAAAAAAAAAGGAGGCTGG - Intronic
1197859114 X:130950544-130950566 AAGAAGAGAAGAAAGGAGGGAGG - Intergenic
1198041713 X:132859584-132859606 AAGAAGAAAAGAAAAGAGGAGGG + Intronic
1198069968 X:133138561-133138583 AGGGAGAAAAGAAAGGAGGGAGG + Intergenic
1198778553 X:140208253-140208275 AAGGAGAAACCAGATCAGGTAGG + Intergenic
1198871537 X:141180930-141180952 AAGGGGAAAGAAAATGAGGAAGG - Intergenic
1199265222 X:145820342-145820364 AAGGAGAAAACAGATAATGAAGG + Exonic
1199337248 X:146632713-146632735 AAGGAGAAAAGAAATAAAGATGG - Intergenic
1200012315 X:153128010-153128032 AAAGAGAGAACAAATCTGGGTGG - Intergenic
1200027285 X:153271909-153271931 AAAGAGAGAACAAATCTGGGTGG + Intergenic
1200082604 X:153585918-153585940 AAGGAGAAAAGAAGAAAGGGAGG + Intergenic
1200437724 Y:3172264-3172286 AAGGAAAACAAAAATTAGGGAGG - Intergenic
1200739696 Y:6840345-6840367 AAGGAGAACAGAAATAATGGTGG + Intergenic
1200881743 Y:8220501-8220523 AAGAAGGAAAGAAAGGAGGGAGG - Intergenic
1201073592 Y:10170862-10170884 AAGGAGAGAAGAACAGAGGGAGG - Intergenic
1201298489 Y:12486016-12486038 AAGAAGAAAACAAAGAAAGGAGG - Intergenic
1201341638 Y:12940749-12940771 AAGTAGAAAACAAATGAAGTGGG - Intergenic
1201428495 Y:13881249-13881271 AATATGTAAACAAATGAGGGTGG - Intergenic
1201625726 Y:16012354-16012376 AGGGAGGAAAGAAAGGAGGGAGG + Intergenic
1202273883 Y:23096218-23096240 AAGGACAGAAGAAATGAGGGAGG + Intergenic
1202292143 Y:23324459-23324481 AAGGACAGAAGAAATGAGGGAGG - Intergenic
1202426879 Y:24729963-24729985 AAGGACAGAAGAAATGAGGGAGG + Intergenic
1202443912 Y:24940131-24940153 AAGGACAGAAGAAATGAGGGAGG - Intergenic