ID: 919981294

View in Genome Browser
Species Human (GRCh38)
Location 1:202644098-202644120
Sequence CCGCGGGCTGCCGGAGCCCT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 241
Summary {0: 3, 1: 0, 2: 18, 3: 33, 4: 187}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
919981294_919981303 3 Left 919981294 1:202644098-202644120 CCGAGGGCTCCGGCAGCCCGCGG 0: 3
1: 0
2: 18
3: 33
4: 187
Right 919981303 1:202644124-202644146 CCACCCTCAGTCTGTCCTGGAGG 0: 1
1: 0
2: 3
3: 31
4: 258
919981294_919981312 27 Left 919981294 1:202644098-202644120 CCGAGGGCTCCGGCAGCCCGCGG 0: 3
1: 0
2: 18
3: 33
4: 187
Right 919981312 1:202644148-202644170 TGAGGTAAAGGCTGGTGCCAGGG 0: 1
1: 2
2: 2
3: 33
4: 252
919981294_919981299 0 Left 919981294 1:202644098-202644120 CCGAGGGCTCCGGCAGCCCGCGG 0: 3
1: 0
2: 18
3: 33
4: 187
Right 919981299 1:202644121-202644143 TCCCCACCCTCAGTCTGTCCTGG 0: 1
1: 0
2: 3
3: 30
4: 318
919981294_919981307 9 Left 919981294 1:202644098-202644120 CCGAGGGCTCCGGCAGCCCGCGG 0: 3
1: 0
2: 18
3: 33
4: 187
Right 919981307 1:202644130-202644152 TCAGTCTGTCCTGGAGGGTGAGG 0: 1
1: 0
2: 3
3: 39
4: 302
919981294_919981311 26 Left 919981294 1:202644098-202644120 CCGAGGGCTCCGGCAGCCCGCGG 0: 3
1: 0
2: 18
3: 33
4: 187
Right 919981311 1:202644147-202644169 GTGAGGTAAAGGCTGGTGCCAGG 0: 1
1: 2
2: 0
3: 17
4: 213
919981294_919981308 15 Left 919981294 1:202644098-202644120 CCGAGGGCTCCGGCAGCCCGCGG 0: 3
1: 0
2: 18
3: 33
4: 187
Right 919981308 1:202644136-202644158 TGTCCTGGAGGGTGAGGTAAAGG 0: 1
1: 0
2: 2
3: 33
4: 285
919981294_919981310 19 Left 919981294 1:202644098-202644120 CCGAGGGCTCCGGCAGCCCGCGG 0: 3
1: 0
2: 18
3: 33
4: 187
Right 919981310 1:202644140-202644162 CTGGAGGGTGAGGTAAAGGCTGG 0: 1
1: 0
2: 2
3: 79
4: 483
919981294_919981304 4 Left 919981294 1:202644098-202644120 CCGAGGGCTCCGGCAGCCCGCGG 0: 3
1: 0
2: 18
3: 33
4: 187
Right 919981304 1:202644125-202644147 CACCCTCAGTCTGTCCTGGAGGG 0: 1
1: 0
2: 4
3: 18
4: 217

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
919981294 Original CRISPR CCGCGGGCTGCCGGAGCCCT CGG (reversed) Intronic
900171897 1:1273468-1273490 CGGCGGGCTCCCGGAGCTCCGGG - Intronic
900523109 1:3115680-3115702 CCGGGGGCTGCCGCTGGCCTGGG + Intronic
900940941 1:5798274-5798296 CCTCGGGATGCCCGTGCCCTTGG - Intergenic
901447279 1:9316217-9316239 CCTGGGGGTGCCGGAGCCCCAGG - Intronic
901686448 1:10946156-10946178 CTGCGGGCAGCCGCTGCCCTGGG - Intergenic
901870424 1:12135538-12135560 CCGGGGGCTGCCAGACTCCTTGG + Intronic
903652558 1:24930491-24930513 CCCCGGGCTCCCAGAGCTCTCGG - Intronic
903831360 1:26177320-26177342 GCGCGAGATGCCAGAGCCCTAGG + Intergenic
904160292 1:28518124-28518146 TCCCGGGCTGGGGGAGCCCTTGG - Intronic
905726173 1:40253710-40253732 CCTTGGGCTGCCGGAGTGCTGGG + Intergenic
907091458 1:51729629-51729651 CCGCGAGCTGCCAGCTCCCTCGG + Intronic
912361673 1:109100627-109100649 CTGCGGGCTGCCGGTGGCGTAGG + Intergenic
912473948 1:109924075-109924097 CTGCGGGCTGAAGGATCCCTCGG - Exonic
916412525 1:164559798-164559820 CCGGGGGCTGCCGTAGCCTTTGG + Exonic
919981294 1:202644098-202644120 CCGCGGGCTGCCGGAGCCCTCGG - Intronic
920190495 1:204190655-204190677 CTGGGGGCTCCCGGAGCTCTCGG + Exonic
922447435 1:225709248-225709270 CCGCTGGCTGCCGGAGCTACTGG - Intergenic
923698915 1:236281801-236281823 CCGCGGCCAGCCGGACCCCTCGG + Exonic
1064978793 10:21145803-21145825 TCTCCAGCTGCCGGAGCCCTTGG - Intronic
1065881840 10:30043795-30043817 CCCCGGGCTGCCAGATGCCTTGG - Intronic
1069729263 10:70600591-70600613 GCGCTGGCAGCCAGAGCCCTGGG + Exonic
1070570726 10:77637963-77637985 CCGCGGGCCGCCCGCGCCCGGGG + Intronic
1071857912 10:89644858-89644880 CAGCGGGCAGCAGGAGCGCTCGG - Exonic
1075129542 10:119726226-119726248 CCGCGGGCCGCCGCCTCCCTGGG + Exonic
1076626579 10:131824719-131824741 CTGAGCTCTGCCGGAGCCCTGGG - Intergenic
1077101506 11:824517-824539 CCGCAGGCTGCCGGAGCAGGTGG + Exonic
1077889780 11:6410798-6410820 CCCAGGGCTGCCTGAGCCCCTGG - Exonic
1078316256 11:10294903-10294925 GCTCGGGCTGCGAGAGCCCTGGG - Intergenic
1078317765 11:10306511-10306533 GCGCCGGCGGCCGTAGCCCTGGG - Exonic
1083306909 11:61766098-61766120 CAGCGGGGTGCCGTAGCCCGGGG - Exonic
1083707532 11:64526490-64526512 CCGTGGGCATCCGAAGCCCTTGG + Intergenic
1084178398 11:67435028-67435050 CCCCAGCCTGCCGGAGCCCACGG + Exonic
1084385590 11:68841352-68841374 CCGCAGGCTGACCGACCCCTGGG + Intronic
1085332723 11:75667393-75667415 CCGCGGGCTGCCCGGGGCCCAGG - Intronic
1090208731 11:124900363-124900385 CCTCGGGCTGCAGGAGCCTCTGG - Intergenic
1091318446 11:134632593-134632615 CCGAGGGCTGCTGGGGCTCTGGG - Intergenic
1091460941 12:643052-643074 CCGCAGGCGGCCGTAGCCCGCGG - Intronic
1091583876 12:1805136-1805158 CCGTGGGCTGCCTGAACTCTGGG + Intronic
1092276964 12:7068673-7068695 CCGTGGGCTGCCAGGGCCGTGGG + Intronic
1095310575 12:40692778-40692800 GTGCGGGATGCCGGAGCCCTGGG + Intronic
1096125342 12:49115195-49115217 CCTCGGCCTGCCAGAGCACTGGG - Intergenic
1096647710 12:53047514-53047536 CCGCGGCCAGCCAGAGCCCCCGG - Intronic
1099365101 12:81758774-81758796 CCGCGTGCAGCTGGAGCCCCGGG + Intronic
1101427416 12:104599358-104599380 CCGCGCGGTCCCGGAGCCATGGG + Intronic
1101603887 12:106233310-106233332 GCTCGGGCTGCAGGAGCCCACGG - Intergenic
1101910603 12:108857760-108857782 CTGAGGGCTGCCCGAGGCCTCGG + Intergenic
1103742361 12:123099459-123099481 CTGTGGGCTGACGAAGCCCTGGG + Intronic
1103950714 12:124549551-124549573 CAGCGGGCTGAGGGAGCCCCAGG + Intronic
1104448774 12:128853377-128853399 CCTCGGGCGGCGCGAGCCCTGGG - Intergenic
1104602346 12:130162307-130162329 CCGCGGGCTCCCGGGCCCCGCGG - Intergenic
1104638652 12:130453312-130453334 CCACAGGCTGGAGGAGCCCTGGG + Intronic
1104942065 12:132399822-132399844 CCGCGGGCTCCCGGACGCCTGGG + Intergenic
1105839906 13:24245119-24245141 GCGTGGGCTGCCGGGGCCCACGG - Intronic
1107312507 13:39094169-39094191 CCGTGGGCTCCCAGAGCTCTGGG + Intergenic
1108696657 13:52907838-52907860 GTCTGGGCTGCCGGAGCCCTGGG + Intergenic
1113082828 13:106535550-106535572 CCGCGCGCGTCCGGAGCCCGCGG - Intergenic
1114627932 14:24141477-24141499 CCGCCGGCTCCCGGCGCCCTGGG + Exonic
1116886976 14:50231432-50231454 CGGCGGGCTGGCGGAGACCCCGG + Exonic
1117029455 14:51652721-51652743 CGGCGCGCTGGCGGAGCCCCAGG + Intronic
1119236826 14:73026832-73026854 CCGAGGGCAGCCTGAGCCCCAGG + Intronic
1123044414 14:105504244-105504266 CCCCGGGCTGGTGGAGCCCTGGG + Intergenic
1124496996 15:30192833-30192855 CCGCGGGCTGCCGGAGCCCTCGG - Intergenic
1124746580 15:32345814-32345836 CCGCGGGCTGCCGGAGCCCTCGG + Intergenic
1127898163 15:63321192-63321214 CCGAGGGCTGTGGGAGCTCTGGG + Intergenic
1128173215 15:65530913-65530935 CCGAGGGCTGCAGGAACCTTCGG + Intronic
1129322377 15:74782312-74782334 CCTCTGGCCGCCGGAGCCCGCGG + Exonic
1130642019 15:85685740-85685762 CTGCAGGCTTCCGAAGCCCTGGG + Intronic
1131174401 15:90201163-90201185 CCGGCGGCCGCCGGAGCGCTGGG - Intronic
1131513997 15:93065643-93065665 CTGCGGGCTGCCGGGGGCCGGGG + Intronic
1132694164 16:1194686-1194708 AAGCGGGGTGCAGGAGCCCTCGG - Intronic
1132761197 16:1509357-1509379 CCCCAGGCTGCAGGAGGCCTTGG + Intronic
1133046254 16:3089892-3089914 GCGGCGGCTGCCGGAGCCTTCGG + Exonic
1135321627 16:21501710-21501732 CCTCGGGCGGGCGGAGGCCTAGG - Intergenic
1136428370 16:30183797-30183819 CCGCGGGCTGCGGGGGCGCGCGG + Intronic
1136580673 16:31149212-31149234 CTGCGGGCGCCCTGAGCCCTCGG - Exonic
1138343629 16:56306921-56306943 CCGCGGGGGGCTGCAGCCCTTGG + Intronic
1139392593 16:66614363-66614385 CCTCAGGCAGCCGGAACCCTGGG + Intergenic
1141132293 16:81444762-81444784 CGCCGGGCTCCCGGAGCCCGGGG - Intergenic
1142350415 16:89576881-89576903 CCGGGGGCAGCCGGAACCCTGGG - Intronic
1142395355 16:89828589-89828611 CGCAGGGCGGCCGGAGCCCTGGG + Exonic
1142879646 17:2874428-2874450 CCCCGGGCTGACGGAGGCATTGG + Intronic
1143491834 17:7289538-7289560 CTGCGGGCTGCCGGGGGCCAGGG + Exonic
1144778343 17:17795960-17795982 CCGGGGGCTGCCCGAGGCCGAGG + Exonic
1148048749 17:44759156-44759178 CCGCTGGCAGCCGCAGCCCCCGG + Exonic
1148131400 17:45264525-45264547 CCGGGGGCTGGCAGATCCCTGGG + Exonic
1148555849 17:48578104-48578126 ACGCGGCCTGCCGGGACCCTGGG - Exonic
1148615143 17:48996114-48996136 CCTCCGGCTCCCGGAGCCCGAGG - Intergenic
1148680449 17:49470518-49470540 CCGCGGGCAGCCTGGGGCCTGGG + Intronic
1151656674 17:75499479-75499501 CCGCTGTCTTCCTGAGCCCTGGG + Exonic
1152617379 17:81344236-81344258 GCGCGGGCGTCCGGAGCCCGGGG - Intergenic
1153985034 18:10343946-10343968 CGGCGGGCTGCAGGTTCCCTGGG + Intergenic
1158154216 18:54407125-54407147 CCGCGGGCTCACGGATGCCTTGG + Intergenic
1160662150 19:306197-306219 CCGCGGGCTGCCCCAGCCCTGGG - Exonic
1160719125 19:589882-589904 CCGCCGCCGGCCGGAGCCCGAGG - Exonic
1160782694 19:884871-884893 CCGCCGGCTGCGGAGGCCCTGGG - Intronic
1162445133 19:10718225-10718247 CCGGGGGCCGCCGGCGCCATGGG + Exonic
1162476916 19:10905760-10905782 CCTTGGGCAGCCTGAGCCCTCGG + Intronic
1162532339 19:11243200-11243222 CCGCTGGCTGCATTAGCCCTGGG - Intronic
1162738128 19:12757909-12757931 CCCCGGCCTGCCGGAGCCCGAGG + Exonic
1162790758 19:13061494-13061516 CCGCGCCCCGCCGCAGCCCTCGG + Intronic
1165419960 19:35717818-35717840 CCGCGGCCGGCCGGCGCCCTCGG - Intergenic
1165511379 19:36268560-36268582 CGTCGGGATGCCGGAGCCCTCGG + Intergenic
1165511927 19:36271083-36271105 CCTCGGGTTGCCGGAGCCCTCGG + Intergenic
1165512479 19:36273584-36273606 CCTCGGGTTGCCGGAGCCCTCGG + Intergenic
1165513026 19:36276125-36276147 CCTCGGGTTGCCGGAGCCCTCGG + Intergenic
1165513582 19:36278680-36278702 CCTCGGGTTGCCGGAGCCCTCGG + Intergenic
1165514132 19:36281214-36281236 CCTCGGGTTGCCGGAGCCCTCGG + Intergenic
1165514684 19:36283751-36283773 CCTCGGGTTGCCGGAGCCCTCGG + Intergenic
1165515236 19:36286284-36286306 CCTCGGGTTGCCGGAGCCCTCGG + Intergenic
1165515786 19:36288820-36288842 CCTCGGGTTGCCGGAGCCCTCGG + Intergenic
1165516337 19:36291357-36291379 CCTCGGGTTGCCGGAGCCCTCGG + Intergenic
1165516889 19:36293883-36293905 CCTCGGGTTGCCGGAGCCCTCGG + Intergenic
1165517442 19:36296406-36296428 CCTCGGGTTGCCGGAGCCCTCGG + Intergenic
1165517994 19:36298941-36298963 CCTCGGGTTGCCGGAGCCCTCGG + Intergenic
1165518545 19:36301476-36301498 CCTCGGGTTGCCGGAGCCCTCGG + Intergenic
1165519094 19:36304008-36304030 CCTCGGGTTGCCGGAGCCCTCGG + Intergenic
1165519644 19:36306523-36306545 CCTCGGGTTGCCGGAGCCCTCGG + Intergenic
1165520193 19:36309051-36309073 CGTCGGGATGCCGGAGCCCTCGG + Intergenic
1165623875 19:37269531-37269553 CGTCGGGATGCCGGAGCCCTCGG - Intergenic
1165624420 19:37272071-37272093 CGTCGGGATGCCGGAGCCCTCGG - Intergenic
1165624965 19:37274598-37274620 CGTCGGGATGCCGGAGCCCTCGG - Intergenic
1165625501 19:37277136-37277158 CGTCGGGATGCCGGAGCCCTCGG - Intergenic
1165626037 19:37279661-37279683 CGTCGGGATGCCGGAGCCCTCGG - Intergenic
1165626581 19:37282188-37282210 CGTCGGGATGCCGGAGCCCTCGG - Intergenic
1165627120 19:37284713-37284735 CGTCGGGATGCCGGAGCCCTCGG - Intergenic
1165627663 19:37287237-37287259 CGTCGGGATGCCGGAGCCCTCGG - Intergenic
1165628198 19:37289761-37289783 CGTCGGGATGCCGGAGCCCTCGG - Intergenic
1165628738 19:37292286-37292308 CGTCGGGATGCTGGAGCCCTCGG - Intergenic
1165629280 19:37294812-37294834 CGTCGGGATGCCGGAGCCCTCGG - Intergenic
1165629821 19:37297337-37297359 CGTCGGGATGCTGGAGCCCTCGG - Intergenic
1165630365 19:37299865-37299887 CGTCGGGATGCCGGAGCCCTCGG - Intergenic
1165630901 19:37302403-37302425 CGTCGGGATGCCGGAGCCCTCGG - Intergenic
1166882974 19:45940281-45940303 CCCCCGCCTCCCGGAGCCCTGGG - Exonic
1167578959 19:50330960-50330982 CAGGGGGCTGCGGGCGCCCTCGG + Intronic
1167792297 19:51689864-51689886 GGGCGAGCTGCCCGAGCCCTCGG + Intergenic
1168293985 19:55369960-55369982 CCGCGGGCTCCCTGGGGCCTGGG + Intronic
925230946 2:2233377-2233399 CAACGGGCTGCGGGAGCCCTAGG + Intronic
925389863 2:3487309-3487331 CTGGGGGCTCCCGGTGCCCTTGG + Intergenic
925842304 2:8003764-8003786 CCTGGGGCTGATGGAGCCCTGGG + Intergenic
926980188 2:18560287-18560309 CCGCGGCCTGGCGGAGCTCGCGG + Exonic
929107192 2:38376960-38376982 CCGCGCGCTGCGGGAGCGCGGGG + Intronic
931252885 2:60549700-60549722 CCGCGGGGTGACGGTTCCCTGGG + Intronic
932635748 2:73386251-73386273 CTGCGGGCGGGCGGAGCGCTCGG - Intronic
934245749 2:90304474-90304496 CCTCGGTCTCCCTGAGCCCTGGG - Intergenic
934262997 2:91492563-91492585 CCTCGGTCTCCCTGAGCCCTGGG + Intergenic
934670326 2:96208455-96208477 CCGCGAGCTTCCGGGGCCCAAGG + Exonic
935237570 2:101151372-101151394 CCGCGGGCTCTCAGAGCGCTGGG - Intronic
937221684 2:120345944-120345966 CCTCGGGCCCCCGGGGCCCTCGG + Intergenic
938970047 2:136423661-136423683 CCGCGGGCTGCGCACGCCCTTGG - Intergenic
940640869 2:156342761-156342783 CCGAGTGCTGCCGGGGCCCCGGG + Intergenic
944495929 2:200307052-200307074 CCGCCGCCTCCCGGAGCGCTGGG + Intronic
944803399 2:203258151-203258173 CCTCGGGCTCCCGAAGCACTAGG + Intronic
946433449 2:219637684-219637706 CCTCGGGCTGGGGGGGCCCTCGG - Exonic
946899064 2:224355008-224355030 CCGGGGGCTGTGGGAGCCCGGGG + Intergenic
947985439 2:234443895-234443917 CCGGGGGCTGCTGCATCCCTTGG - Intergenic
948525148 2:238566839-238566861 CCGGGGGCTTCAGGAGCCCCAGG - Intergenic
948694736 2:239727488-239727510 CCTCTGGCTGCCTGAGCCCCTGG + Intergenic
1169262555 20:4149083-4149105 CCCCGGGCCGGCCGAGCCCTCGG - Intronic
1172579480 20:36035664-36035686 CCCCGGGCTTCCGGGACCCTTGG - Intergenic
1173153416 20:40587195-40587217 CCGCAGGCTGCAGGAACACTAGG - Intergenic
1175866840 20:62183139-62183161 CCGCGGGGTACCGGGGCGCTGGG + Intronic
1175892590 20:62322152-62322174 CCACAGGCTGCCAGTGCCCTGGG - Exonic
1175946663 20:62562174-62562196 CCGGAGGCTGCTGGAGCCCTCGG + Intronic
1178555648 21:33588326-33588348 CCGCGAGCAGCCGGAGGCCCCGG - Exonic
1179180295 21:39038953-39038975 CCGGGGGCTGCCTGAGACCTCGG - Intergenic
1180099969 21:45579533-45579555 CCCTGGGATGCCGGTGCCCTGGG + Intergenic
1180174118 21:46079236-46079258 CCCCGGGCTGCCGGTCCCCTGGG - Intergenic
1180835131 22:18925927-18925949 CCCCGGGCTTCCTGAGCCCTTGG - Intronic
1182441668 22:30368175-30368197 CTGAGGGCTGGAGGAGCCCTTGG + Intronic
1183546259 22:38455979-38456001 CCGCGGGCAGCCGGGGCTCCCGG - Intergenic
1184649032 22:45911243-45911265 CTGATGGCTGCCGGCGCCCTCGG - Intergenic
1185312274 22:50162747-50162769 ACGCTGGCTGCAGGAGCACTGGG - Intergenic
1185330741 22:50251108-50251130 CCGGGAGCAGCCGGAGGCCTGGG + Exonic
1203285220 22_KI270734v1_random:151226-151248 CCCCGGGCTTCCTGAGCCCTTGG - Intergenic
952241005 3:31532042-31532064 CCACGGGCTGCTGAACCCCTCGG + Intergenic
954630981 3:52047488-52047510 CCGCGGGCTTCCCCAGGCCTGGG + Intergenic
961178801 3:124859429-124859451 CCGTGGGCTTCCGAAGTCCTAGG + Exonic
961302774 3:125932994-125933016 CCGCGGGCTCCCAGAGTTCTAGG + Intronic
961556141 3:127697831-127697853 CAGCAGGCTGGCGGTGCCCTGGG + Intronic
961594678 3:128006903-128006925 CCTCTGGGAGCCGGAGCCCTGGG - Intergenic
964282328 3:155080053-155080075 CCACGGGCTCCCAGCGCCCTGGG - Intronic
966743487 3:183254360-183254382 GGGCGGGCTGCCGGGGCCCGCGG - Intronic
968599838 4:1503697-1503719 CCTGGGGCTGCCGGGGCCTTAGG - Intergenic
969488375 4:7485181-7485203 CCGAAGGCTGCAGGAGCCCCAGG - Intronic
969683421 4:8655920-8655942 CCCCGGGCTGGCAGAGCCCTAGG + Intergenic
969703789 4:8781428-8781450 CAGCTGCCTCCCGGAGCCCTGGG - Intergenic
969706228 4:8793807-8793829 CCCCGGCCTGGCTGAGCCCTTGG - Intergenic
970637104 4:18021668-18021690 CCGCTCAGTGCCGGAGCCCTCGG - Exonic
975706100 4:77113279-77113301 TCGCGCGGTGCCGGAGTCCTCGG + Intergenic
977908226 4:102501457-102501479 CCGCCAGCCGCCGCAGCCCTCGG + Exonic
980354444 4:131724521-131724543 CGTCGGGATGCCGGAGCCCCCGG + Intergenic
980354977 4:131727027-131727049 CGTCGGGATGCCGGAGCCCCCGG + Intergenic
980355525 4:131729514-131729536 CGTCGGGATGCCGGAGCCCCCGG + Intergenic
980356066 4:131732005-131732027 CGTCGGGATGCCGGAGCCCCCGG + Intergenic
980360913 4:131754364-131754386 CGTCGGGATGCCGGAGCCCCCGG + Intergenic
980361996 4:131759319-131759341 CGTCGGGATGCCGGAGCCCCCGG + Intergenic
980363081 4:131764281-131764303 CGTCGGGATGCCGGAGCCCCCGG + Intergenic
980378202 4:131976707-131976729 CGTCGGGATGCCGGAGCCCCCGG - Intergenic
985323277 4:188738425-188738447 CGGCGGGCTACCGGAGCTCAGGG - Intergenic
985764133 5:1768038-1768060 CCCTGGGCTGAGGGAGCCCTGGG + Intergenic
986066378 5:4238301-4238323 CCTCGGGCTCCCGGAGTGCTGGG + Intergenic
994367069 5:98928621-98928643 CCCCGAGACGCCGGAGCCCTAGG - Exonic
997444803 5:133933324-133933346 CCTCAGGCTGAGGGAGCCCTAGG - Intergenic
998564586 5:143205635-143205657 ACGCTGGCTGCAGGAGCCCTGGG + Intronic
1000037450 5:157460087-157460109 CTGCGGGCGGCCCCAGCCCTGGG + Exonic
1004044347 6:12011535-12011557 ACGCGGGGGGCGGGAGCCCTGGG - Intronic
1004228992 6:13814248-13814270 CCGCGGGCCGCCGGGGCGCGAGG + Exonic
1014535778 6:122611119-122611141 CTGCGGCCTGCCGGGGTCCTAGG - Intronic
1017313561 6:153002590-153002612 CGGCGGGCTACCGGAGCTCAGGG + Exonic
1017738021 6:157381292-157381314 CCGCGAGCCGCCGCCGCCCTCGG + Exonic
1018769037 6:166956322-166956344 CCGGGTGCGCCCGGAGCCCTGGG + Exonic
1018962775 6:168459802-168459824 CCCCGGGCTGGGTGAGCCCTGGG + Intronic
1019523520 7:1470805-1470827 CCGAGGGCTGCCAGGGCCCTGGG + Intronic
1021452912 7:20798458-20798480 CCGCGGGGTGTGCGAGCCCTCGG - Intergenic
1025033036 7:55572549-55572571 CTGCGGGCTCCCGGAACCCGAGG + Intronic
1029437310 7:100570449-100570471 CCCCGGGCTTCCGGGGGCCTCGG + Intergenic
1029985192 7:104916603-104916625 CCAAGGGCTGCAGGAACCCTTGG + Intergenic
1035260531 7:157659044-157659066 CCCCGGGCTGCCGGCTTCCTTGG + Intronic
1036291498 8:7496548-7496570 CCTCGGCCTCCCAGAGCCCTGGG + Intronic
1036329991 8:7814995-7815017 CCTCGGCCTCCCAGAGCCCTGGG - Intronic
1037348359 8:17923329-17923351 CCCCGGGCTTCCCGTGCCCTAGG + Intronic
1039060274 8:33567020-33567042 GCCCGGGCTGCAGAAGCCCTCGG + Exonic
1039463130 8:37762615-37762637 CCACGGGCTGCCGGGGGCCTGGG + Exonic
1042146887 8:65739045-65739067 CCCCAGGCCGCTGGAGCCCTGGG - Intronic
1049259120 8:141629404-141629426 CCGCTGGCTCTCGGGGCCCTTGG + Intergenic
1049557614 8:143291004-143291026 CCGCGTGCTGCCACAGCCCCGGG + Intronic
1049798922 8:144508907-144508929 CCGCTGCCTCCCGGGGCCCTCGG - Intergenic
1052904048 9:33817971-33817993 CGGCGGGGAGCCGGAGGCCTCGG - Intronic
1053129167 9:35605556-35605578 GCGCGGCCTGCCCGGGCCCTGGG + Exonic
1053930899 9:43112892-43112914 CAGGAGGCTGCTGGAGCCCTTGG - Intergenic
1054891793 9:70259317-70259339 CCGCGCGCTGCCGGAGCCCCGGG - Intronic
1057030685 9:91773111-91773133 CAGAGGGCTGCAGGGGCCCTGGG - Intronic
1059327170 9:113511135-113511157 CCCAGGGCTGCTGGTGCCCTTGG + Intronic
1060424958 9:123496809-123496831 CTGTGTGCTGCCGGTGCCCTTGG + Intronic
1060811995 9:126615272-126615294 TCCCGGGCGGCCCGAGCCCTCGG + Intronic
1189262656 X:39689247-39689269 CCGGGGGCAGCCGCAGGCCTTGG - Intergenic
1196886532 X:120251191-120251213 CGAGGGGCTGCCGGTGCCCTGGG + Intronic
1198750138 X:139931509-139931531 CCGCCCGCTGGCTGAGCCCTAGG + Intronic
1199257135 X:145729780-145729802 CCGAGGGCTGGTGGAGCCCGGGG + Intergenic
1200233714 X:154458478-154458500 CCCCGGGCTGCCGGAGCCCCGGG - Intronic
1201354321 Y:13081920-13081942 CCGCGGCCTGCCAGAGTGCTGGG + Intergenic