ID: 919981808

View in Genome Browser
Species Human (GRCh38)
Location 1:202646488-202646510
Sequence GGCCAGTAGGCTCGGTGAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 106
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 101}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
919981808 Original CRISPR GGCCAGTAGGCTCGGTGAGC AGG (reversed) Intronic
901409476 1:9072181-9072203 GGCCTGCAGGCTCCGCGAGCAGG + Intronic
902378126 1:16039781-16039803 GGCCAGAGGACTTGGTGAGCTGG - Intergenic
903510984 1:23874789-23874811 GGCCACTACGCTCAGTGACCAGG - Exonic
904249506 1:29212972-29212994 AGCCAGTGGGCTAGGTGAGGAGG - Intronic
906862010 1:49371092-49371114 GGCCAGTAGCCTGGGTGCCCAGG - Intronic
911180607 1:94857016-94857038 GGCAAGTAGGCTGGGTGTGGTGG - Intronic
917920649 1:179746910-179746932 GGACAGCAGGCTCTCTGAGCTGG + Intronic
919981808 1:202646488-202646510 GGCCAGTAGGCTCGGTGAGCAGG - Intronic
1064843851 10:19629001-19629023 GGGAAGAAGGCTTGGTGAGCTGG - Intronic
1066362244 10:34742483-34742505 GGCCTGTAGGGTCTGTGAGACGG - Intronic
1067068389 10:43116112-43116134 TGCCAGCAGGCAGGGTGAGCGGG + Intronic
1070605079 10:77892977-77892999 GGCCAGTATGCTGTGTGTGCAGG + Intronic
1072460474 10:95613957-95613979 GGTCACCAGGCTAGGTGAGCTGG - Exonic
1073672735 10:105610110-105610132 GACTAGTAGGCTGGGTGCGCTGG - Intergenic
1076371880 10:129960370-129960392 AGGCAGGAGGCTGGGTGAGCGGG - Intronic
1077298018 11:1835054-1835076 GCCCAGGAGGCTGGGTCAGCTGG - Intronic
1077479701 11:2807823-2807845 GGCCAGGAGGCATGGTGGGCAGG - Intronic
1077992539 11:7424856-7424878 GGGCAGGAGGCTCAATGAGCTGG - Intronic
1080038711 11:27736458-27736480 GGCCAGTAGCCCCAGTGACCTGG - Intergenic
1083202567 11:61129446-61129468 GGGCAGGTGGTTCGGTGAGCGGG - Intergenic
1083986824 11:66221026-66221048 GTCCAGAACGCCCGGTGAGCAGG - Intronic
1084208879 11:67611775-67611797 GGCCAGAACGCTGGGTGGGCTGG + Intronic
1085392688 11:76190456-76190478 GGGCAGCAGGCTCTGTGAGGAGG - Intronic
1089522318 11:119073404-119073426 GGCCACCAGGCTCGCAGAGCTGG + Intronic
1090459865 11:126881390-126881412 GGCCAGTTGGCTGGGAGACCTGG - Intronic
1093980397 12:25469449-25469471 AGCTAATAGGCTCGGTGAGGTGG - Intronic
1104859322 12:131916429-131916451 GGCCAGCAGGTTCTGGGAGCTGG - Exonic
1104908318 12:132227364-132227386 GGCCAGCAGGGTCGGGGAGCTGG - Intronic
1116803081 14:49463869-49463891 GCCCAGTATGCTAGGGGAGCAGG + Intergenic
1119257302 14:73209240-73209262 GGGCAGCATGCTCTGTGAGCTGG - Intronic
1122218217 14:100218348-100218370 GCCCAGCAGGTTCTGTGAGCAGG - Intergenic
1122298810 14:100720285-100720307 GGCCAGGACCCTCGGTGGGCGGG + Intergenic
1122737877 14:103854241-103854263 GGCCAGCAGGCTCCATGAACAGG + Intergenic
1122893285 14:104742789-104742811 GACCACTAGGCTTTGTGAGCTGG - Intronic
1137732170 16:50697217-50697239 GCCCATTAGGCTGGGGGAGCAGG - Exonic
1142132040 16:88435598-88435620 GACCAGGAGGCTCTGTGTGCAGG + Exonic
1142470701 17:161791-161813 AGCCAGGAGGCTGGGAGAGCCGG + Intronic
1143780412 17:9226043-9226065 GGCCTGTGGGCTCGGGGCGCCGG + Intronic
1144381674 17:14705114-14705136 GGCCAGTGGTCTTGGTGTGCTGG + Intergenic
1146951184 17:36907644-36907666 GGCCAGGAGGCTGGATTAGCCGG - Intergenic
1148513352 17:48192529-48192551 TGCCAGCAGGATCAGTGAGCTGG - Intronic
1148736143 17:49865948-49865970 GGCCAGTGAGCTCTGAGAGCAGG + Intergenic
1149526984 17:57364213-57364235 GGCCAGAAGGCTCGGCTGGCTGG + Intronic
1149679461 17:58495269-58495291 GGCCAGTGGGCTCAGAGAGAAGG - Exonic
1151438998 17:74116070-74116092 GGGCACTAGGCTCTGGGAGCAGG + Intergenic
1152391973 17:80008684-80008706 TGCCAGGAGGCTTGCTGAGCTGG - Intronic
1158836215 18:61333964-61333986 GGCCGGTAGGCTCGTCGAGGTGG - Intronic
1162754028 19:12846587-12846609 GGCCACTAGGCTGGGTGCGGTGG + Intronic
1163565544 19:18049034-18049056 GGCCAATGGTCTCGGTGTGCTGG - Intergenic
1165419218 19:35714798-35714820 GGCCAGTGGGCTCTGGGAGAAGG + Exonic
1165867818 19:38949804-38949826 GGGCGGTAGGCCCGGTGGGCGGG - Exonic
1166091589 19:40512864-40512886 GGCCAGGAGGCGCGCTGTGCTGG - Exonic
927971116 2:27306855-27306877 GGAAAGAAGGCTCGGTGGGCGGG - Intronic
929419694 2:41777999-41778021 GGCAAGGAGGCAGGGTGAGCAGG + Intergenic
929562520 2:42964661-42964683 GCCCAGCAGGCCCTGTGAGCAGG + Intergenic
930096862 2:47571782-47571804 GGCTAGAGGGGTCGGTGAGCTGG - Intergenic
936084294 2:109456009-109456031 GGCCAAGGGGCTCCGTGAGCAGG - Intronic
944737390 2:202579909-202579931 GGCAGGTAGGCTCGGTGCGGTGG + Intergenic
946378573 2:219329241-219329263 GGCCAGGGGGCTCTGTGAGGAGG + Exonic
948255557 2:236566061-236566083 GGCCGGTAGGGTCTGTGATCTGG - Intergenic
1169113491 20:3047662-3047684 GGCCAGCAGGCTGGGTGGGCTGG + Intronic
1170582089 20:17706887-17706909 GGCAAGTAGACGCTGTGAGCAGG + Intronic
1174694152 20:52540663-52540685 TGCCAGAAGGCTCTGTGAACTGG - Intergenic
1175645974 20:60671971-60671993 GGCCAGTAGGCATGGTGACAGGG - Intergenic
1176139779 20:63539884-63539906 GGCCGGGAGGCTTGGTGACCTGG - Intergenic
1182612408 22:31559879-31559901 GGCCAGTGGTCTTGGTGTGCTGG - Intronic
1183933525 22:41249218-41249240 GGCCAGCAGGCTGGCTGGGCTGG + Intronic
959056951 3:101576527-101576549 GGCCAGTGGTCTTGGTGTGCTGG + Intronic
964790528 3:160450092-160450114 GGCCAGTGGGCCTCGTGAGCTGG + Intronic
968285922 3:197508703-197508725 GGCCAAGAGGCTGTGTGAGCAGG - Intergenic
968519427 4:1028981-1029003 GGCCAGGAGGCTCGAAGGGCCGG + Intergenic
969870574 4:10102087-10102109 AGCCAGGCGGCTGGGTGAGCTGG - Intronic
971298755 4:25424747-25424769 GGTCAGGAGGCTGGGTGAGGCGG + Intergenic
977369375 4:96115677-96115699 GCCCAGTAGGCACAGTGAGCAGG - Intergenic
987370674 5:17189812-17189834 TGCCAGGAGGCTCAGGGAGCAGG + Intronic
990233921 5:53745956-53745978 GGCCAGTGTGCTCGCTGGGCAGG - Intergenic
997964253 5:138345238-138345260 GGGCTGTAGGGTCTGTGAGCTGG - Exonic
1005755767 6:28923856-28923878 GGCCGCGAGCCTCGGTGAGCCGG - Exonic
1006313276 6:33276406-33276428 GGCCAGTGGTCTTGGTGTGCTGG - Exonic
1006631752 6:35435413-35435435 TGCCAGGAGGTTCTGTGAGCTGG - Intergenic
1006641468 6:35491764-35491786 GGCTAGGAGGCTGGGTGAGCAGG + Intronic
1009653088 6:66501450-66501472 GACCAGTAGGCTGGGTAAGGTGG - Intergenic
1010124175 6:72413137-72413159 TGCCAGTAGGCTCCAGGAGCTGG - Intergenic
1013166231 6:107594860-107594882 GGGCAGGAGGCCCAGTGAGCAGG + Intronic
1020262293 7:6537064-6537086 GCCCAGGAGGCTGGGTGAGGAGG + Intronic
1024967502 7:55037064-55037086 GCTCAGAATGCTCGGTGAGCTGG - Intronic
1027131200 7:75592501-75592523 GCCCAGTATGCACGGTGAGGGGG + Exonic
1029503880 7:100950423-100950445 GGCCTGTAGGCTGGGTGGCCTGG - Intronic
1029704094 7:102266695-102266717 GCCCAGGAGGGTCGGTGACCTGG + Intronic
1034488624 7:151381397-151381419 GGCCAGGAGGCGCTGGGAGCGGG - Exonic
1035238278 7:157514374-157514396 GGCCAGTGGGCTCGGCCAGGCGG + Intergenic
1044895032 8:96882512-96882534 GTCGAGCAGGCTGGGTGAGCTGG + Intronic
1046262919 8:111794201-111794223 GGCCAGTAGGCTCTAGGACCAGG + Intergenic
1047225543 8:122952920-122952942 GGCCAGTCACCTCGATGAGCCGG - Exonic
1049765310 8:144352662-144352684 TTCCAGTGGGCACGGTGAGCGGG + Intronic
1049891445 9:73702-73724 GGCCAGCAGGCTCTGGGATCGGG - Intergenic
1056576725 9:87860134-87860156 GGCCACGAGGCTCGCTGTGCAGG + Intergenic
1057606409 9:96500882-96500904 GGCCAGTGTGCTCGCTGGGCTGG - Exonic
1058769311 9:108215038-108215060 GATCAGTAGGCTCGATGAGGAGG - Intergenic
1059716780 9:116920516-116920538 GGCAAGAAGGCACTGTGAGCAGG - Intronic
1060940435 9:127540261-127540283 GGCCTGGAGGCTTGGGGAGCTGG + Intronic
1061572798 9:131488036-131488058 GGCCAGCAGCCTGGCTGAGCTGG - Exonic
1188421188 X:29992237-29992259 AGCCAGTAGACTTGGTGAGGGGG - Intergenic
1189257404 X:39651144-39651166 GCCCAGTAAGCTCAGAGAGCTGG + Intergenic
1189396988 X:40631860-40631882 GGCCAGGACGCACGGGGAGCGGG + Intronic
1190717426 X:53115572-53115594 GGCCTGGAGGCTCGGTCTGCAGG + Intergenic