ID: 919981904

View in Genome Browser
Species Human (GRCh38)
Location 1:202647064-202647086
Sequence TGGCAGAGCCATGGTGGCCA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 378
Summary {0: 1, 1: 0, 2: 6, 3: 30, 4: 341}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
919981895_919981904 6 Left 919981895 1:202647035-202647057 CCCCAGGCCTGGAGCTGTGGTAC 0: 1
1: 0
2: 1
3: 21
4: 266
Right 919981904 1:202647064-202647086 TGGCAGAGCCATGGTGGCCAGGG 0: 1
1: 0
2: 6
3: 30
4: 341
919981891_919981904 25 Left 919981891 1:202647016-202647038 CCTCGAGCGTCAGCACAAACCCC 0: 1
1: 0
2: 0
3: 4
4: 52
Right 919981904 1:202647064-202647086 TGGCAGAGCCATGGTGGCCAGGG 0: 1
1: 0
2: 6
3: 30
4: 341
919981897_919981904 4 Left 919981897 1:202647037-202647059 CCAGGCCTGGAGCTGTGGTACAG 0: 1
1: 0
2: 2
3: 22
4: 282
Right 919981904 1:202647064-202647086 TGGCAGAGCCATGGTGGCCAGGG 0: 1
1: 0
2: 6
3: 30
4: 341
919981896_919981904 5 Left 919981896 1:202647036-202647058 CCCAGGCCTGGAGCTGTGGTACA 0: 1
1: 0
2: 3
3: 24
4: 419
Right 919981904 1:202647064-202647086 TGGCAGAGCCATGGTGGCCAGGG 0: 1
1: 0
2: 6
3: 30
4: 341
919981899_919981904 -1 Left 919981899 1:202647042-202647064 CCTGGAGCTGTGGTACAGGCATT 0: 1
1: 0
2: 0
3: 24
4: 213
Right 919981904 1:202647064-202647086 TGGCAGAGCCATGGTGGCCAGGG 0: 1
1: 0
2: 6
3: 30
4: 341

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
919981904 Original CRISPR TGGCAGAGCCATGGTGGCCA GGG Intronic
900021335 1:188268-188290 TGGGAGGGCCAGGATGGCCAAGG + Intergenic
900411692 1:2515472-2515494 GGGCAAAGCCAAGGTGGCGAAGG - Intronic
900612081 1:3548516-3548538 GGTCAGAGCCAAGGTGCCCAGGG + Intronic
900719692 1:4167303-4167325 GGGCAGAGCCGGGGTGGCCGGGG - Intergenic
901829430 1:11883151-11883173 TGGCCTAGGCATGGTGGCCAGGG - Intergenic
902503536 1:16925621-16925643 TGGCAGAGCTAGGGTTGGCATGG + Intronic
903232651 1:21931372-21931394 TGGCAGGGCCAAAGAGGCCAAGG + Intronic
903526545 1:23995195-23995217 TGGCACAACCAGGGAGGCCATGG + Intergenic
904381899 1:30117043-30117065 TGACAGAGCCTTGGGGGACATGG + Intergenic
904450928 1:30611034-30611056 TGGCAGGGCCTTGCTGGCTATGG - Intergenic
904465282 1:30704007-30704029 AGGCAGAGCCAGGCTGGCCCTGG + Intergenic
904744258 1:32701744-32701766 TGGCAGAGGCAGGCTGCCCAGGG - Intronic
905178916 1:36155153-36155175 GGGCAGGGCCAGGGTGGGCAGGG + Intronic
905303715 1:37003566-37003588 TGGCAGTGCCATTTGGGCCAGGG - Intronic
905886653 1:41495454-41495476 TGGCAGAGACATCCTGGGCAGGG + Intergenic
906280526 1:44550200-44550222 TGGCAAAGCCAAGAGGGCCAGGG + Intronic
906319319 1:44806648-44806670 GGGCAGAGGCCTGCTGGCCATGG + Exonic
907441574 1:54481760-54481782 GGGCAGAGACAGGGTGGTCAAGG + Intergenic
907518061 1:55005971-55005993 TGGCTGTGCCATGGGAGCCAGGG - Intronic
908710062 1:67005172-67005194 TGGAAGAGCCAGGGAGGACAGGG - Intronic
910548906 1:88454044-88454066 AGGCAGAGGATTGGTGGCCAAGG - Intergenic
911120725 1:94293748-94293770 TGGCACACCCATGGAGGGCATGG - Intergenic
913660369 1:121001684-121001706 TGGCAGAGAAAGGGTGGGCATGG - Intergenic
914011734 1:143784841-143784863 TGGCAGAGAAAGGGTGGGCATGG - Intergenic
914166099 1:145176293-145176315 TGGCAGAGAAAGGGTGGGCATGG + Intergenic
914650360 1:149693500-149693522 TGGCAGAGAAAGGGTGGGCATGG - Intergenic
915082362 1:153360875-153360897 GGCCACAGTCATGGTGGCCACGG + Exonic
915232979 1:154459489-154459511 TGGCTGAACCATGGTTACCATGG + Intronic
915251110 1:154589293-154589315 TGTCAGAGCCATGTGGGGCAGGG + Intronic
915279710 1:154814076-154814098 AGGGAGGGCCATGGTGGGCATGG + Intronic
915561954 1:156692816-156692838 TGGCAGTGCCAAGGGGGACAGGG + Intergenic
915598123 1:156906773-156906795 AGGCAGGGCCATAGTAGCCAGGG - Exonic
915776655 1:158496179-158496201 GAGCTGAGCCATGATGGCCAGGG + Intergenic
919211101 1:194487830-194487852 TGTCAGTGCATTGGTGGCCATGG + Intergenic
919881792 1:201905839-201905861 GGGCAGAGCCAAGGAGGGCAGGG + Intronic
919921303 1:202168100-202168122 TGGCAGAGGTAAGGTGGGCATGG + Intergenic
919981904 1:202647064-202647086 TGGCAGAGCCATGGTGGCCAGGG + Intronic
920274996 1:204798118-204798140 TGGCAGAGCCATGAAAGTCAGGG - Intergenic
920543112 1:206794085-206794107 TGGCCTGGCCATGGTGTCCAAGG - Intergenic
920913001 1:210234308-210234330 TGCCCGAGCCCTGGTGCCCAAGG - Intronic
921080282 1:211733549-211733571 TGGGAAAGCTATGGTGGGCATGG - Intergenic
921297645 1:213719738-213719760 GGGCAGTGGCATGGTGGCAAGGG + Intergenic
923094923 1:230767571-230767593 AGGCAGCGCCATCGAGGCCATGG + Exonic
1062814939 10:492337-492359 TGGCAGAGCACGGGTGGCCAAGG - Intronic
1066637020 10:37513831-37513853 TGGCAGGACCATTTTGGCCATGG - Intergenic
1067407621 10:46037336-46037358 TGGCAGAGCATTGGTGTCAAGGG - Intronic
1067838203 10:49654571-49654593 AGGCACAGCCATGGTGCCCATGG + Intronic
1067944569 10:50682007-50682029 TGACAGAGGCCCGGTGGCCATGG + Intergenic
1068588257 10:58825222-58825244 TGGCAGAGCCATGGGGGCTGTGG + Intronic
1068764282 10:60745911-60745933 TGCCACAGGCATGGTGGCCTAGG - Intergenic
1069661019 10:70123549-70123571 GGGCAGAGCCAGGCTGCCCACGG + Intronic
1069711477 10:70491768-70491790 ATGCAGATCCATGGTTGCCAAGG - Intronic
1069842861 10:71350727-71350749 TGGCACAGAAGTGGTGGCCAGGG - Intronic
1069908382 10:71745533-71745555 TGGCCGAGCCAAGGTGGGGATGG + Intronic
1069959726 10:72072679-72072701 TGGCAGGGCCTGGGTGGACAGGG - Intronic
1069964007 10:72098633-72098655 AGGAAAAGCAATGGTGGCCAAGG - Intronic
1070525731 10:77294376-77294398 TGGCAGAGCCCTGCTGAGCATGG + Intronic
1070673689 10:78397277-78397299 TAGGAGAGCCAGCGTGGCCAGGG + Intergenic
1070743175 10:78915937-78915959 GGGCAAAGCCATGGTGTTCAGGG + Intergenic
1071480413 10:86061044-86061066 GGCCAGTGCCATGGGGGCCAAGG - Intronic
1071632976 10:87231099-87231121 TGACAGAGGCCCGGTGGCCATGG + Intronic
1071646425 10:87363317-87363339 TGACAGAGGCCCGGTGGCCATGG + Intronic
1073444095 10:103570716-103570738 TGGCAGAAGGATGGTGGCAAGGG + Intronic
1074135218 10:110619966-110619988 TGGCTGAGCCAAGGTGTCAAGGG + Intergenic
1074211375 10:111338405-111338427 TGGCAGAGCCAAAGGGGACATGG - Intergenic
1074638265 10:115345769-115345791 TAGCAGAGCAGTGGTTGCCAGGG - Intronic
1075481788 10:122788485-122788507 TGGCATCCTCATGGTGGCCACGG - Intergenic
1075894619 10:125984180-125984202 TGGCCGACCCACGGTGGGCATGG - Intronic
1076034643 10:127188915-127188937 TGGCAGAGCCAGGAGGGCAAAGG + Intronic
1076342034 10:129755866-129755888 TGGCAGAGCCAGGCTGGTCCCGG + Intronic
1076990116 11:268331-268353 TGGGAGAGCCAGGGGGGCCGAGG - Intergenic
1079144812 11:17841202-17841224 TGGCCTACCCTTGGTGGCCATGG + Intronic
1079328027 11:19511274-19511296 TGCCAGAGCCATGGTGCCACTGG - Intronic
1080569843 11:33545756-33545778 TGGCAGAACCATGGTTTCCTGGG - Intronic
1081335896 11:41866443-41866465 TGGCAGAGCCTTGCTACCCAAGG + Intergenic
1083748290 11:64746875-64746897 TGGCAGGGCTTTGGTGGCCCTGG - Intronic
1083847664 11:65345417-65345439 TGGAAGAGCAGTGGTGGCCATGG + Intronic
1083945376 11:65920104-65920126 AGGCAGAGCCTGGGTGGCGAGGG + Intronic
1084507316 11:69576291-69576313 GGGCAGAGCCTGGCTGGCCAAGG + Intergenic
1084971027 11:72772135-72772157 TGGCACTGCCATAGTGGGCATGG + Intronic
1084971044 11:72772213-72772235 TGCCATAGCCATAGTGGGCATGG + Intronic
1085305302 11:75482392-75482414 AGGCAGAGCCTGGGTGGCCTTGG - Intronic
1085317285 11:75553289-75553311 TGGCTCTGCCATGGTGCCCATGG - Intergenic
1085510519 11:77085849-77085871 TAGCACAGCCCTGGAGGCCAGGG - Intronic
1085730991 11:78998635-78998657 TGGCAGAACTGTGCTGGCCAAGG - Intronic
1085791604 11:79501723-79501745 TGGCAGAGCACTGGTGCCCGCGG + Intergenic
1086395491 11:86411204-86411226 TGGCTGAGGCATAGTGACCAAGG - Intronic
1088465615 11:110134435-110134457 TGGGAGCGCCATGAAGGCCATGG + Intronic
1089171600 11:116515606-116515628 TAGAAGAGCCAACGTGGCCAAGG + Intergenic
1089443013 11:118531791-118531813 AGGCAGCGCCATGGTGGCCCGGG - Exonic
1091296607 11:134478223-134478245 TGGCTGAGGGATGGTGGTCAGGG + Intergenic
1091374700 12:17861-17883 TGGGAGGGCCAGGATGGCCAAGG + Intergenic
1093752832 12:22820154-22820176 TGGCAGAGCCTTTGTGGACAGGG - Intergenic
1096530971 12:52242763-52242785 TGGAAGAGCCCTGGGGTCCATGG + Intronic
1096609124 12:52789598-52789620 AGGCAGAGGCAGGGAGGCCAGGG + Intergenic
1099016261 12:77347597-77347619 TGGCACATCCATGGAGGGCATGG - Intergenic
1099982578 12:89623717-89623739 TGGCAGGGCCCTGCAGGCCATGG + Intronic
1101199096 12:102416104-102416126 TGGCAGAGGCATGGAGGACCAGG + Intronic
1102474373 12:113179289-113179311 TGGCAAGGACGTGGTGGCCATGG - Exonic
1103322197 12:120098781-120098803 TGGCAGAGCCACAGTGGCCCAGG + Intronic
1103507152 12:121449246-121449268 TGGCAGGGACATGGTGGAGAGGG + Intronic
1104671941 12:130686627-130686649 TGGCACAGCCGTGCTGGCCCCGG + Intronic
1104919947 12:132285499-132285521 AGGCAAAGCCGTGGCGGCCAGGG + Intronic
1105069445 12:133225819-133225841 TGGCAGAGACCTGGGGGACATGG + Intronic
1106311635 13:28559805-28559827 AGGTAGAGCGGTGGTGGCCAGGG - Intergenic
1107711835 13:43158239-43158261 GGGCACCTCCATGGTGGCCATGG + Intergenic
1107970082 13:45633124-45633146 TGAGAGAGGCATGGAGGCCAAGG + Intergenic
1110000199 13:70187646-70187668 TCGCGGGGCCATGGTGCCCATGG - Intergenic
1112327769 13:98454719-98454741 TGCCAAAACCACGGTGGCCATGG - Intronic
1112482147 13:99785982-99786004 TGGCAGAGACAAGGTGGAGAGGG - Intronic
1113411448 13:110093855-110093877 GAGCAGAGCCAGGGTGGCCTCGG - Intergenic
1114050083 14:18914868-18914890 TGGAAGAGGCCTGGTGGGCAGGG + Intergenic
1114112475 14:19487063-19487085 TGGAAGAGGCCTGGTGGGCAGGG - Intergenic
1114268018 14:21084008-21084030 TGGCAGAGACCTGCTGGCCGTGG + Exonic
1114883950 14:26824172-26824194 TGGGAGAGCTTTGGTGGCAAAGG + Intergenic
1115917900 14:38337513-38337535 TGTCAGAACCATGGGGGGCATGG - Intergenic
1117317950 14:54592132-54592154 TCACAGAGCTATGGTGGTCAAGG - Intronic
1118321119 14:64753925-64753947 TGGGAGAGCCAGGGTGGGCCAGG - Intronic
1118722557 14:68604627-68604649 CGGCAGCGCCATGGTCCCCAGGG + Intronic
1118814934 14:69304634-69304656 TGTCAGATTCATGGTTGCCAGGG - Intronic
1119167152 14:72503924-72503946 CAGCAGAGCCATGGTGGACTGGG - Intronic
1120239105 14:81928918-81928940 TGTCAGAGCCTGGATGGCCAAGG + Intergenic
1121636186 14:95455343-95455365 TGGCCGAGTCATGGAGCCCAGGG - Intronic
1123403145 15:20005426-20005448 TGTCAGAGCCAGGCAGGCCAGGG + Intergenic
1123512484 15:21012080-21012102 TGTCAGAGCCAGGCAGGCCAGGG + Intergenic
1126749542 15:51862874-51862896 TGGCAGTGCCATGATGTGCAGGG - Exonic
1128587866 15:68866842-68866864 TGGCAAATGCATGGTGGTCAGGG + Intronic
1128605422 15:69033214-69033236 CGCCAGCGTCATGGTGGCCAAGG + Exonic
1129161724 15:73751602-73751624 CTGCAGAGGGATGGTGGCCAGGG + Exonic
1129619217 15:77128521-77128543 ATGCAGAGCCATGGTGGTGATGG + Intronic
1130242901 15:82213383-82213405 TGGCAGAGCCAAGGCTGCCTTGG + Intronic
1131575609 15:93587598-93587620 TTGCAGAGCCATGGTTGAGATGG - Intergenic
1131837473 15:96405571-96405593 TGGCAGATTCAGAGTGGCCAAGG - Intergenic
1132454999 16:17429-17451 TGGGAGGGCCAGGATGGCCAAGG + Intronic
1132886624 16:2185074-2185096 GGCCAGGGCCAGGGTGGCCAGGG - Intronic
1133002636 16:2858783-2858805 TGGCCGAGCCCTGGTGCCCATGG - Intergenic
1134549138 16:15131195-15131217 TGGCAGAGCTGCGGTGGCCCCGG + Intronic
1135792297 16:25408268-25408290 TGGCAGAGTGATAGAGGCCAAGG + Intergenic
1136230939 16:28884920-28884942 TGACAGAGACAGGGTGGCCCAGG - Intronic
1137489894 16:48923595-48923617 AGGCAGGGCCATGGTGGCCATGG + Intergenic
1137539894 16:49355132-49355154 AGGCAGAGGCCAGGTGGCCATGG - Intergenic
1137613082 16:49832099-49832121 TGACCCAGCCTTGGTGGCCAGGG - Intronic
1138415405 16:56868561-56868583 TGGCAGAGGCACGCTGGACATGG + Intronic
1139191686 16:64871198-64871220 TGTCTAAGCCATGGTGCCCACGG - Intergenic
1141278518 16:82609285-82609307 GGGCAGAGCCGGAGTGGCCAGGG + Intergenic
1141659516 16:85434525-85434547 TGTCAGAGCCAGGCTGGTCACGG + Intergenic
1142854244 17:2721182-2721204 TGGCTGAGCTGTGGGGGCCAGGG + Intergenic
1143529928 17:7496758-7496780 TGGAAGGGCCATGGTGGCTGTGG + Exonic
1143790449 17:9290967-9290989 TTGCATAGCCATGGTGAACATGG + Intronic
1144025365 17:11272174-11272196 AGGCAGAGCTTTGGTGTCCATGG - Intronic
1144680293 17:17188801-17188823 TTGCAGGGCCCTGGAGGCCAAGG + Exonic
1144951511 17:18996900-18996922 TGGCAGAGCCAGGGAGGCCCAGG - Intronic
1145301907 17:21646693-21646715 TGGCAGCAGCATGGTGTCCAGGG + Intergenic
1145868026 17:28253185-28253207 TGGCAGAGGCAGGGAGGCCTGGG + Intergenic
1146142692 17:30381226-30381248 TGACAGAGCTGTGATGGCCAGGG + Intronic
1146160131 17:30555170-30555192 GTGCAGAGCCAGCGTGGCCAAGG - Intergenic
1146939929 17:36837289-36837311 TGCCAGGGCCCTGATGGCCAAGG - Intergenic
1147863692 17:43539165-43539187 ATGCAGAGCCTTGGAGGCCAAGG - Intronic
1148748590 17:49931872-49931894 TGGCAGAGCCAGGAGGGCCAGGG - Intergenic
1148748669 17:49932209-49932231 GGGCAGAGCCAGGGTGGGCCAGG - Intergenic
1149783347 17:59415569-59415591 AGGCAGAGCCATGGGAGTCAAGG + Intergenic
1150231048 17:63550667-63550689 GTGCAGGGACATGGTGGCCACGG - Exonic
1150462146 17:65361825-65361847 TGGCAGGGCCCTGGAGGACAGGG - Intergenic
1150490884 17:65573509-65573531 TGGCAGAGCACTGTGGGCCACGG + Intronic
1150496691 17:65613242-65613264 TGGCAGAGACATGGAGGCAGTGG + Intronic
1151554846 17:74841619-74841641 TGACAGTGCCATGGTGGCAGAGG - Intergenic
1151824546 17:76516726-76516748 TGGCTGAGCCCTGGAGGTCAAGG + Intergenic
1151892426 17:76958614-76958636 TGGGGGAGCCATGGGGGCCAGGG - Intergenic
1152462086 17:80446775-80446797 CGAGAGAGCCATGGTGGCGATGG - Intergenic
1152523031 17:80871468-80871490 TGGCAGATCCCTGGTGGCGCTGG + Intronic
1152813755 17:82394849-82394871 CGGCCGAGCCTTGGTGTCCAGGG - Intronic
1154176223 18:12088339-12088361 TGGCAGAGCCAAGGTAGCACAGG - Intergenic
1154273148 18:12937195-12937217 TGGCAGAGGCATTGTGTACAGGG + Intergenic
1154332407 18:13440826-13440848 TGTCAGAGCCATTGTGTACACGG + Intronic
1154485052 18:14866556-14866578 CAGGCGAGCCATGGTGGCCAAGG - Intergenic
1154980526 18:21499378-21499400 TGTCAGGCCCACGGTGGCCAGGG - Intronic
1156474179 18:37395162-37395184 TGGCAGAGCCTTAGTGGACAGGG + Intronic
1157622729 18:49025671-49025693 TGGCAGAGCAGGGGTGTCCAGGG - Intergenic
1158571249 18:58598482-58598504 TGGCAGAGGCAGGGAGGCCTTGG + Intronic
1159914427 18:74175997-74176019 GGGCAGAGCCATGGAGGCAAAGG + Intergenic
1160669091 19:348227-348249 TGACAGAGGCATGGTGTCCCGGG + Intergenic
1160858276 19:1227066-1227088 CGGCAGAGCCATGGAGGCCGCGG - Intronic
1162124679 19:8493141-8493163 AGTCAGAGCCCTGCTGGCCAAGG + Intronic
1162452660 19:10764259-10764281 TGGCGCTGCCATCGTGGCCATGG + Intronic
1162462336 19:10820526-10820548 AGGCGGAGCCCTGGTGGGCATGG + Intronic
1164523975 19:29000189-29000211 GGGCAGAGCCATGGTGCCAGGGG + Intergenic
1164608131 19:29614391-29614413 TGCTAGAGCAATGCTGGCCACGG - Intronic
1165118781 19:33545788-33545810 TGGCAGAGCCAGGCTGGCATGGG + Intergenic
1165410712 19:35659223-35659245 TGGCACAGAGAGGGTGGCCAAGG - Intergenic
1165748397 19:38244953-38244975 AGGCAGAGGCAATGTGGCCACGG + Intronic
1165830267 19:38727224-38727246 TGGCAGGGCCCTGCTGGCCCTGG - Intronic
1166570507 19:43793326-43793348 TCCCTGAGGCATGGTGGCCAAGG - Intergenic
1167090528 19:47340952-47340974 GGGCAATGCCATGGTGGCCTGGG + Exonic
1168122777 19:54262151-54262173 TGCCAGAGCCGTGATGGCCGTGG - Intronic
1168693972 19:58394842-58394864 TGGCATAGCCCTGGTGGCCTTGG + Intergenic
1168715988 19:58527698-58527720 TGCTGGACCCATGGTGGCCAAGG + Intronic
925786071 2:7432152-7432174 TGGCAGGGCCATGGCTACCATGG + Intergenic
926286156 2:11490228-11490250 AGGCAGAGTCGTGGTGGTCAGGG - Intergenic
926761462 2:16282286-16282308 TGGCAGAGCCTGGATGGCCTGGG + Intergenic
927206004 2:20610978-20611000 AAGCAGACCCATGGTTGCCAGGG - Intronic
933659465 2:84915815-84915837 GCCCAGAGCCCTGGTGGCCATGG + Intergenic
933817029 2:86076598-86076620 TCTCAGGGCCATGGTGGCCTGGG - Intronic
934123149 2:88859638-88859660 GGGCAGACACAGGGTGGCCACGG + Intergenic
936034834 2:109102676-109102698 TGGCAGAGCCTTGGGGGAGAGGG + Intergenic
936349492 2:111702174-111702196 TGACAGCAACATGGTGGCCATGG + Intergenic
936568109 2:113595669-113595691 TGGGAGGGCCAGGATGGCCAAGG - Intergenic
937071656 2:119067965-119067987 TGGCACAGCCTTGGTGACCTGGG + Intergenic
937346319 2:121128017-121128039 TGGATGGGCTATGGTGGCCATGG - Intergenic
938288112 2:130135666-130135688 TGGAAGAGGCCTGGTGGGCAGGG - Intergenic
938427472 2:131203226-131203248 TGGAAGAGGCCTGGTGGGCAGGG + Intronic
938468417 2:131537274-131537296 TGGAAGAGGCGTGGTGGGCAGGG + Intergenic
939096654 2:137840084-137840106 TTGCTGGGCCATGGTGGCGATGG + Intergenic
940866907 2:158826302-158826324 TGCCAGAGCCACGGGGGACAAGG + Intronic
942937983 2:181581603-181581625 TGACAGAAACATGGTGGGCAGGG + Intronic
946172986 2:217906284-217906306 GGGCTGGGCCCTGGTGGCCAGGG - Intronic
946255213 2:218437060-218437082 AGGCAGAGCCCTGTGGGCCAGGG + Intronic
946632931 2:221690853-221690875 TGGCAGAGCCAAAGTAGGCAGGG + Intergenic
948412593 2:237775428-237775450 AGGCAGGGCCCTGGAGGCCATGG + Intronic
948473672 2:238203237-238203259 GGGCCGAGCCGTCGTGGCCACGG - Intronic
1169665017 20:8023592-8023614 TGGCAGACCCCTGGAGGCCGAGG + Intergenic
1170101970 20:12711822-12711844 TGGCAAAACCATGGTGACCTAGG + Intergenic
1170859682 20:20091079-20091101 TGGGAGGGCCGGGGTGGCCAGGG - Intronic
1171518490 20:25758087-25758109 TGGCAGCATCATGGTGTCCAGGG + Intergenic
1171558364 20:26098120-26098142 TGGCAGCATCATGGTGTCCAGGG - Intergenic
1171961350 20:31497106-31497128 TGGCAGAGCCGGGGAGCCCAAGG - Intergenic
1172399548 20:34638070-34638092 AGGCAGGGCCATGTGGGCCATGG - Intronic
1173896500 20:46554989-46555011 TGGCTGAGCCATGGTGCCCAGGG + Intergenic
1175218504 20:57404089-57404111 GGGCAGCTCCTTGGTGGCCAAGG + Intronic
1176074939 20:63244174-63244196 AGGCAGGGCCTTGGTGGTCAGGG - Intronic
1176652636 21:9564494-9564516 TGGCAGCATCATGGTGTCCAGGG + Intergenic
1177624211 21:23638416-23638438 TGGCAGAGCTATTGTGGCAATGG - Intergenic
1178774005 21:35531587-35531609 TGGCAGGGCTATGCTTGCCATGG + Intronic
1179112597 21:38460267-38460289 TGGTAGAGCCTTGCAGGCCATGG + Intronic
1179274775 21:39882285-39882307 TGGCAGAGCCAATGTGGCCATGG + Intronic
1179310677 21:40193262-40193284 TGGCAGATCCATGGTGAGCCTGG - Intronic
1180468563 22:15637243-15637265 TGGAAGAGGCCTGGTGGGCAGGG + Intergenic
1181643044 22:24214873-24214895 TGGCAGTCCCAGGGTGGCCAAGG + Intergenic
1181952619 22:26565309-26565331 TGGCAGACCCTTGGTGGCCAAGG + Intronic
1182318975 22:29466099-29466121 AGGCAGAGCCCTGGGGCCCAGGG + Intergenic
1182883340 22:33752838-33752860 TGGCGAAGCCCTGTTGGCCATGG - Intronic
1183417413 22:37690612-37690634 TGCCAGAGCCATGGTGGCTCGGG + Intronic
1183419582 22:37703456-37703478 TGACGAAGCCATGGTGGTCAAGG - Intronic
1183431612 22:37769238-37769260 TGGGAGAGGCACGGTGGTCAGGG - Intronic
1184030850 22:41893647-41893669 TGGGAGAGACCTGGAGGCCAGGG - Intronic
1184099626 22:42335275-42335297 TGATAGAGGCAGGGTGGCCAGGG - Intronic
1184171996 22:42765325-42765347 AGGCAGAGCCTGGGTGGGCAAGG + Intergenic
1184646087 22:45896259-45896281 GGGCAGAGCCCTGGAGGACAGGG - Intergenic
1184657651 22:45949874-45949896 GGGCCCAGCCATTGTGGCCAGGG - Intronic
1184804313 22:46782657-46782679 TAGCAGCCCCATGGTTGCCAAGG - Intronic
1185129250 22:49028318-49028340 TGGCAGAGCCAGAGTGGACAAGG + Intergenic
949873501 3:8608660-8608682 TGGGACTGCCAGGGTGGCCAGGG + Intergenic
954293767 3:49663063-49663085 TGGCTGAGGCATGGCGGCCTGGG - Exonic
954387482 3:50251906-50251928 TGGCAGGGCCACAGTGGTCAAGG - Intronic
956674126 3:71718942-71718964 TGGAAGGGCCATGGTTGACAGGG - Intronic
961026381 3:123561644-123561666 TGGAAGAGGCATGGGGGCTATGG - Intronic
961108705 3:124264817-124264839 TGGTAAGGCCATGGCGGCCAAGG - Intronic
961475034 3:127140929-127140951 TGGCAGAGCCAGTGTGGACAGGG + Intergenic
961504554 3:127361423-127361445 TGGCAGAGGAAGGGTGGCCCAGG - Intergenic
961660959 3:128468613-128468635 TGGCCGGGCCAGGGTGGCCGGGG - Intergenic
962209732 3:133467291-133467313 TGGCTGAGCCTTGGGGGGCAGGG - Intronic
962708741 3:138068241-138068263 CGTCAGAGCCATGGCAGCCATGG - Exonic
968281431 3:197479824-197479846 TCATAGAGCCAGGGTGGCCACGG - Intergenic
968830030 4:2928549-2928571 TGGCAGAGCCAGGGTCGCTCCGG - Exonic
968983625 4:3864060-3864082 TGGCAGGGCCCCGGTGGGCAGGG + Intergenic
969575938 4:8035739-8035761 GGGCAGAGCCATGGCAGCGAGGG + Intronic
973954431 4:56049122-56049144 GGGGAGAGCAATGGAGGCCACGG + Intergenic
979158205 4:117425153-117425175 TGGGATAGGCATGGTGGACAGGG + Intergenic
981311159 4:143299278-143299300 TGGCAGAGCCAAGGTGGGCAGGG - Intergenic
985424313 4:189813369-189813391 TGGCAGAGCCTGGGTGGGAAAGG + Intergenic
985803515 5:2021673-2021695 AGGGAGAGCCATGGTGGGCTTGG - Intergenic
986240132 5:5953450-5953472 TGGCAGAGCCATTGTGCCCAGGG - Intergenic
986458435 5:7944006-7944028 AGGCCGAGCCAGTGTGGCCATGG + Intergenic
987493583 5:18614287-18614309 TTGCAGTACCATGTTGGCCATGG + Intergenic
987963240 5:24837779-24837801 TGGCGGATCTACGGTGGCCATGG + Intergenic
988856577 5:35233346-35233368 TGGCAGAGGCCTGGAAGCCAAGG - Intergenic
994100890 5:95891491-95891513 TGGTAAAGACATGGTGGCAATGG + Intronic
995387025 5:111599380-111599402 TGACCCAGTCATGGTGGCCAAGG - Intergenic
997405126 5:133639648-133639670 TGGAAGCCCCATGGTGGGCAGGG + Intergenic
997460759 5:134050820-134050842 TGGCAGAGTCAAGGTGGGGATGG + Intergenic
998133299 5:139661837-139661859 GGGCAGAGCCAGGTTGGCTATGG - Intronic
998958920 5:147464672-147464694 TGAGAAAGCCATGGTGACCAGGG + Intronic
998963077 5:147509405-147509427 TGCCCGGGCCATGGCGGCCAGGG + Intronic
999299982 5:150485414-150485436 TGGCAGAGCACTGGTGGTCGGGG + Intergenic
999473355 5:151875774-151875796 TGGCAGAGCCAAGGGCACCAGGG - Intronic
999670234 5:153953249-153953271 TGGGAGAGGCATGATGGTCAGGG + Intergenic
1000005456 5:157179358-157179380 TGGAAGATCCATGGTCACCAGGG + Intronic
1000295628 5:159911207-159911229 TGGCTGACCCTTGCTGGCCATGG - Intergenic
1001531091 5:172462381-172462403 AGGCGGTGCCATGGCGGCCATGG - Intergenic
1002280169 5:178125110-178125132 TGGCACAGACCTGGTGCCCACGG - Exonic
1002549806 5:179979185-179979207 TGGCAGAGGAGTGGTGACCACGG - Intronic
1003872332 6:10412876-10412898 GGGCAGAGCGACGGTGGCCGGGG - Intronic
1004387894 6:15188234-15188256 TGGCACAACCAGGGAGGCCATGG - Intergenic
1005014055 6:21360862-21360884 AATCAGAGCAATGGTGGCCAGGG - Intergenic
1005123206 6:22413828-22413850 TGACGGAGCCCTGCTGGCCAAGG - Intergenic
1005870782 6:29972855-29972877 TAGCACAGCCATGCTGGTCATGG - Intergenic
1006577542 6:35057311-35057333 TGACAGAGCCAGAGTGGCCTGGG - Intronic
1006830037 6:36963094-36963116 AGGCAGAGCCTTGGTTGCCAGGG - Exonic
1010177933 6:73051320-73051342 GGGCAGAGTGCTGGTGGCCATGG - Intronic
1010230072 6:73526635-73526657 GGGCTTAGCCATGTTGGCCAGGG + Intergenic
1011744567 6:90397039-90397061 TGGCCCAGGCATGGTGGGCAGGG + Intergenic
1012222656 6:96668541-96668563 TGGCAGAAACATTGTGGACAGGG - Intergenic
1013072440 6:106741251-106741273 CAGCAGAGCAACGGTGGCCAAGG - Intergenic
1016383414 6:143508566-143508588 TGTGAGATCCATGCTGGCCAAGG + Intronic
1019085473 6:169471652-169471674 TGGAAAAGCCAAGGTGGTCAGGG - Intronic
1019179667 6:170178368-170178390 TGCCAGGGCCATGTTGGCCACGG + Intergenic
1019413958 7:919040-919062 AGGCAGTGCCATGGGGGCCTGGG - Intronic
1019481449 7:1268710-1268732 CGGAAGGGCCAGGGTGGCCAGGG - Intergenic
1019737682 7:2658744-2658766 TGGCTGGGCCAAGGTGGGCAGGG + Intronic
1020855169 7:13411754-13411776 TGGCAGAGCAGCGGAGGCCATGG + Intergenic
1022035445 7:26529651-26529673 TGGCAGTATCTTGGTGGCCACGG - Intergenic
1022036069 7:26535923-26535945 TGGCAGAGCCATCAGGGACAAGG + Exonic
1022136766 7:27456792-27456814 TGGCAGGGCCAGGGTGGCCTGGG - Intergenic
1022873336 7:34502546-34502568 TTTCAGACCCATTGTGGCCATGG + Intergenic
1023982102 7:45076268-45076290 TGGCTGAGCCCTGGTGGACAAGG - Exonic
1024048011 7:45598228-45598250 TGGCAGAGCCAGGGTGAGCCCGG + Intronic
1025733807 7:64129408-64129430 AAGCAGACCGATGGTGGCCAGGG + Intronic
1026926373 7:74196657-74196679 TGGCAGGGCCAGGGTGGCCTGGG + Exonic
1027192078 7:76002532-76002554 TGGCAGAGCCTTGTGGCCCAAGG - Intronic
1029092760 7:98061089-98061111 TGGCAGAGCCCAGGTTACCAGGG - Intergenic
1029312191 7:99677728-99677750 TGCCAAAGCCAGGGTGGCCTTGG + Intronic
1031573394 7:123386412-123386434 TGGCAGAGCCCTTATGGCAATGG + Intergenic
1032184496 7:129712548-129712570 TGGCACATGCAGGGTGGCCAAGG - Intronic
1032196760 7:129793922-129793944 GGGAAGGGCCATGGTGGCCCTGG - Intergenic
1033998541 7:147384143-147384165 TGGCTGAAACATGGTGACCAAGG + Intronic
1034348555 7:150402125-150402147 TTGCAGAGCAATTGTGCCCATGG + Intronic
1035604402 8:920189-920211 TGTGAGAGACATGGTGCCCAGGG + Intergenic
1035692264 8:1568048-1568070 GGGCAGTGGCATGGGGGCCATGG - Intronic
1035692386 8:1568692-1568714 GGGCAGTGGCATGGGGGCCACGG - Intronic
1035692462 8:1569089-1569111 GGGCAGTGGCATGGGGGCCACGG - Intronic
1035692474 8:1569138-1569160 GGGCAGTGGCATGGGGGCCACGG - Intronic
1036335938 8:7869660-7869682 TGGCAGAGTCATGGTGACTCAGG + Intergenic
1036662222 8:10715800-10715822 GGGCAGAGCCAGGGTGGCGTTGG + Intergenic
1037085909 8:14850300-14850322 TGGCATAGTCATGGTTGTCAAGG + Intronic
1037959408 8:23084700-23084722 TGGCAGCGCCTTGGGTGCCAGGG - Intronic
1039354549 8:36800602-36800624 TACCTGAGCCATGGAGGCCATGG - Intronic
1040023346 8:42759920-42759942 TGGAAACCCCATGGTGGCCAAGG - Intronic
1040107616 8:43549432-43549454 CGGCAGATTCATGGGGGCCATGG - Intergenic
1040555202 8:48471995-48472017 TGCCTGAGTCATTGTGGCCAGGG + Intergenic
1041464201 8:58142631-58142653 TGGCAGAGCCAAGGTGCTAATGG - Intronic
1041513821 8:58677916-58677938 AGGCAGATCAATGGTTGCCAGGG - Intergenic
1041839728 8:62255384-62255406 TGGCAAACCCATGGAAGCCAGGG + Intronic
1044152301 8:88796492-88796514 CTGCAGAGACATGGAGGCCAAGG + Intergenic
1046193698 8:110832665-110832687 TAGTAGAGCCATGGTGACAATGG + Intergenic
1046577135 8:116044342-116044364 TGGCAGAGAAATGGTGGCAGAGG - Intergenic
1048930846 8:139314551-139314573 CGGCAGCCCCATGCTGGCCAGGG - Intergenic
1049233225 8:141494945-141494967 TGGCAGAGCAATGGTGGCTTGGG + Intergenic
1049478247 8:142806834-142806856 TGGCAGAGCCAAGGTGCACAGGG + Intergenic
1049665451 8:143840822-143840844 TGGCCGAACCATGGCGGCCCCGG - Exonic
1053019720 9:34686507-34686529 TGGCAGAGCAATGTTAGCAATGG + Intergenic
1053161265 9:35814916-35814938 GCGCAGAGCCGTGGCGGCCACGG - Exonic
1053418744 9:37963530-37963552 AGGCAGAGTCAAGGTGCCCAAGG + Intronic
1055025073 9:71711072-71711094 TGCCAGTTCCATGGTGGCAATGG - Intronic
1059958309 9:119541288-119541310 TGACAAAGCCTTGGAGGCCAGGG - Intergenic
1060037134 9:120265108-120265130 TGGCAGAGGAGTGGTGGCTAGGG - Intergenic
1060403585 9:123361990-123362012 TGGAAGCATCATGGTGGCCAGGG + Intronic
1061232368 9:129322202-129322224 AGGTAGAGCCATCTTGGCCATGG + Intergenic
1061368249 9:130183578-130183600 TGGGGGAGCCGAGGTGGCCATGG - Intronic
1061613758 9:131765843-131765865 AGGCACAGCCTTGGGGGCCAGGG - Intergenic
1061933834 9:133846646-133846668 TGGCTGGGCCCTGATGGCCATGG - Intronic
1062005168 9:134235262-134235284 TGGCAGTGCCCTGGGAGCCAGGG + Intergenic
1062193999 9:135263306-135263328 TGGCAGGGCCATGCTCCCCACGG - Intergenic
1062217959 9:135399340-135399362 TGGCAGAGCCATGGGAGACCAGG + Intergenic
1062519745 9:136952702-136952724 TGGCAGGGACATGGTGACCCTGG - Intronic
1062710941 9:137974878-137974900 TGGCAGAGCCATGGTGCCTTTGG + Intronic
1203630366 Un_KI270750v1:68035-68057 TGGCAGCATCATGGTGTCCAGGG + Intergenic
1186381950 X:9070115-9070137 TGGCAGGGCCATGTGGGCGAAGG - Intronic
1186761686 X:12729755-12729777 GGGAAGAGCCTTGGTGGGCATGG - Intergenic
1187352271 X:18531182-18531204 TACCAGAGCCTTGGTGTCCAGGG - Intronic
1188694928 X:33178356-33178378 GAGCAGGGCCATGGTGGTCAAGG - Intronic
1189186572 X:39060302-39060324 GTGCAGAGCCATGTTGGGCATGG - Intergenic
1189859492 X:45258394-45258416 TGGGTGGGGCATGGTGGCCACGG - Intergenic
1191100712 X:56724395-56724417 TGACAGCACCATGGAGGCCAAGG + Intergenic
1191816821 X:65254190-65254212 TGGCAGTGGCATGGTGGCATGGG - Intergenic
1198298521 X:135310465-135310487 GGTCAGAGCCATGGTGGATATGG + Intronic
1198300651 X:135331524-135331546 GGTCAGAGCCATGGTGGATATGG + Intronic
1199969901 X:152852056-152852078 AGGCTGAGCCATGGTGGGCATGG - Intronic
1199997231 X:153033008-153033030 TCCCAGAGCCATGGCCGCCAGGG - Intergenic
1200738744 Y:6830226-6830248 GTGCAGAGCTATGGTTGCCAAGG - Intergenic