ID: 919983420

View in Genome Browser
Species Human (GRCh38)
Location 1:202656806-202656828
Sequence TGGGAAGAGCATAATGTGGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 199
Summary {0: 1, 1: 0, 2: 1, 3: 23, 4: 174}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
919983420_919983426 7 Left 919983420 1:202656806-202656828 CCCACCACATTATGCTCTTCCCA 0: 1
1: 0
2: 1
3: 23
4: 174
Right 919983426 1:202656836-202656858 GACATCTTTAAGAGTTACAGTGG 0: 1
1: 0
2: 0
3: 15
4: 179

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
919983420 Original CRISPR TGGGAAGAGCATAATGTGGT GGG (reversed) Intronic
902051197 1:13564898-13564920 TGGGAAGAGCATGGTGGTGTAGG - Intergenic
904101052 1:28027795-28027817 TGGGATAAGAATAATGTGCTGGG + Exonic
905635532 1:39548895-39548917 TGGGAAGAGGATAAAGAGGAAGG - Intergenic
907318832 1:53589946-53589968 TGGGAAGGGCAGTATGTGGGTGG - Intronic
907498621 1:54861957-54861979 TGGGAGGACCATAGGGTGGTGGG - Intronic
907579512 1:55558877-55558899 TGGGAATAGCATTATGTCCTAGG + Intergenic
910332477 1:86090100-86090122 TGGGAAGTCCATCATGTGCTTGG + Intronic
911072787 1:93846166-93846188 TGGGAAGAGTCCAGTGTGGTAGG - Intronic
911823680 1:102451702-102451724 AGGGAAGAGCATCAGGAGGTGGG + Intergenic
912372431 1:109184421-109184443 TGGGAAGAACCTTATGTGTTAGG + Intronic
913057518 1:115176010-115176032 TGGGAATAGGAGAATGGGGTGGG + Intergenic
913660318 1:121001344-121001366 TGTGAAGAGAAGAATGTGCTGGG + Intergenic
914011683 1:143784501-143784523 TGTGAAGAGAAGAATGTGCTGGG + Intergenic
914166149 1:145176633-145176655 TGTGAAGAGAAGAATGTGCTGGG - Intergenic
914650309 1:149693160-149693182 TGTGAAGAGAAGAATGTGCTGGG + Intergenic
915276135 1:154789451-154789473 GGTCAAAAGCATAATGTGGTAGG - Intronic
915790669 1:158666852-158666874 TAGGAGAAGCATAATGAGGTTGG + Intronic
917045277 1:170852873-170852895 TGGGAAGAGCATAAGAGGGAAGG + Intergenic
919026675 1:192180673-192180695 GGGGAAGAGAAAAAGGTGGTAGG - Intronic
919983420 1:202656806-202656828 TGGGAAGAGCATAATGTGGTGGG - Intronic
920704167 1:208239830-208239852 TGGGAAGAGTATGCTGGGGTAGG + Intronic
921036042 1:211379091-211379113 TGAGAAGAGGATAGTGTGGTGGG + Intergenic
921366061 1:214375179-214375201 TGGGAAAAGTATAGTATGGTTGG - Intronic
922054620 1:222028918-222028940 TGGGAAGAGATTCATCTGGTTGG + Intergenic
922717752 1:227886084-227886106 CAGGAAGAGCAAAATGGGGTGGG + Intergenic
923418002 1:233783900-233783922 TGAGATGAGCAGAATGTGATAGG + Intergenic
1063009410 10:2007815-2007837 TGGGAAGGGCATGAGTTGGTGGG + Intergenic
1066550082 10:36546454-36546476 TAGTAAGAGCATAGTCTGGTAGG + Intergenic
1067613197 10:47739003-47739025 GGAGAAGAGCAAAATGAGGTTGG - Intergenic
1068858032 10:61817422-61817444 TGGGAAGAGCAGCATGGGATGGG - Intergenic
1069241018 10:66139266-66139288 TGGGAAGAACATATTGTGTGAGG - Intronic
1069746665 10:70719240-70719262 TGGGCAGAGAATGATGTGCTGGG + Intronic
1071437968 10:85664391-85664413 AGGGAAGAGCATTTTGAGGTAGG - Intronic
1074711593 10:116182568-116182590 TGGGAACAGCTTGATCTGGTTGG - Intronic
1078753688 11:14188653-14188675 TGGCAACAGCATGATGTGGAGGG + Intronic
1080278693 11:30531748-30531770 ATGGAAGAGCATTATGAGGTAGG - Intronic
1082251883 11:49991653-49991675 TGGGAAGGGCAGAATGAGATTGG - Intergenic
1087198854 11:95325726-95325748 TGGGAAGAACAGATTGTGGGAGG - Intergenic
1087267211 11:96073676-96073698 TGGAAAGAGTATGATGTGGTTGG + Intronic
1089294644 11:117460355-117460377 TGGGCAGAGCAGAATCTGGATGG + Intronic
1089670382 11:120052677-120052699 AGGGAGGAGCAGATTGTGGTGGG + Intergenic
1092967687 12:13660287-13660309 AGGGAAGAATATGATGTGGTAGG - Intronic
1096355516 12:50937933-50937955 TGGGAAAAGCATTATCTGATTGG + Intergenic
1096444386 12:51675644-51675666 TGGGCAGAGCATTCTGTGCTTGG + Intronic
1098241974 12:68477337-68477359 AGGTAAGGGCAAAATGTGGTTGG - Intergenic
1098780105 12:74676352-74676374 TGGGAAAAGCATAGTGTGCCTGG - Intergenic
1100665427 12:96746818-96746840 AGGGAAGAGAATGATATGGTAGG - Intronic
1103341597 12:120224014-120224036 TGGGAAGAGCAGTGTCTGGTTGG + Intronic
1104047025 12:125170695-125170717 TGGGAACAGCATAGTATGTTTGG + Intergenic
1106670797 13:31903085-31903107 TGGGAGGAGTATAATGTGCTTGG - Intergenic
1107578135 13:41749791-41749813 TGGGAAATGAACAATGTGGTGGG + Intronic
1107936322 13:45348245-45348267 AGTGAAGAGCATAGTGAGGTGGG + Intergenic
1109123319 13:58486138-58486160 TGGAAAGAGCATGAGGTTGTTGG - Intergenic
1113357107 13:109591413-109591435 TGGTAAGAGCAGTATCTGGTAGG + Intergenic
1114301037 14:21378151-21378173 TGGTAACAGGATAATGTGGGGGG + Intronic
1114441037 14:22747922-22747944 TTGGAAGGGCAAAATGTGTTAGG + Intergenic
1116836746 14:49776035-49776057 TGGGAGGAGCATATGGTGTTAGG + Intronic
1119104312 14:71909743-71909765 TGGGGAGAGGATAATTGGGTTGG + Intergenic
1119453575 14:74734594-74734616 TGAGGAGAGCACAATGTGGTGGG + Intronic
1121663553 14:95654159-95654181 TGGGAAGAGCATTCCGGGGTGGG - Intergenic
1122106101 14:99456205-99456227 TGAGAAGAGCAAAATGTGTCTGG - Intronic
1125318393 15:38456829-38456851 TGGAAGGAGGCTAATGTGGTTGG + Intronic
1127483573 15:59399371-59399393 TGGGCTGAGCATAAAGTGCTTGG - Intronic
1128019653 15:64379371-64379393 TGGGAAGAGCCTGAAGTGGGAGG + Intronic
1129256476 15:74336859-74336881 AGGGAAGAGGATTTTGTGGTGGG + Intergenic
1134832360 16:17333909-17333931 AGGGAAGAGTATTAAGTGGTGGG + Intronic
1140269520 16:73452662-73452684 TGTGAAGACCAAAATGTGGGTGG + Intergenic
1144066894 17:11632517-11632539 TGTGAGGAGCATAGTGGGGTTGG + Intronic
1146022807 17:29293480-29293502 TGGGAAAAGAATAATGAGGTTGG + Intronic
1146940541 17:36841304-36841326 GGAGAAGAGGAAAATGTGGTTGG - Intergenic
1149639737 17:58194977-58194999 GGGGAAGCGCACAATCTGGTTGG - Exonic
1150158795 17:62876268-62876290 AGGGAAGAGCTTAATGTGGCTGG - Intergenic
1150874945 17:68960703-68960725 TGGAAAGACCATAATATGTTTGG + Intergenic
1151097150 17:71511421-71511443 TGGGAAGAGCAGAGTGTTGTGGG + Intergenic
1155814054 18:30281363-30281385 TGTGAAGAGCTTAATGTTTTAGG + Intergenic
1157483471 18:48070789-48070811 TGGGAAGGGCAGGATGGGGTGGG - Intronic
1157891808 18:51425348-51425370 GGGGAAGAGAAGAATGTGATGGG + Intergenic
1160433280 18:78826995-78827017 TGGAAAGAGCAAAATGAGGGTGG - Intergenic
1160496224 18:79377411-79377433 TGGGAAGGGCAGAAGGTGCTGGG - Exonic
1162331523 19:10032700-10032722 TGGGAGGGGCATAAGGGGGTGGG + Intergenic
1163251934 19:16131222-16131244 TGGGAAGGGTATGATGGGGTGGG + Intronic
1163343762 19:16727008-16727030 TGGGAAGGGCAGAATGGGGTGGG + Intronic
1164714006 19:30378521-30378543 TGGGAAGACCCAAATGTGGCAGG - Intronic
1164760010 19:30721575-30721597 GGGGAAGAGAAAAAGGTGGTTGG - Intergenic
1166219623 19:41356040-41356062 TGGCTAGAGCAGAATGAGGTGGG + Intronic
1166573866 19:43818332-43818354 AGGGAAAAGTATAGTGTGGTAGG + Intronic
928234761 2:29529915-29529937 TGGGAAGAGGATAAGTTGGGTGG + Intronic
928791417 2:34960164-34960186 TTGGAAGAGCACAATTTGATAGG + Intergenic
930019674 2:46994008-46994030 TGGGAAGAGCATAATGCCACAGG - Intronic
930444328 2:51451247-51451269 TGGAAAGGAAATAATGTGGTTGG + Intergenic
931840871 2:66146721-66146743 GGGGAAGATGAAAATGTGGTTGG - Intergenic
933290451 2:80432704-80432726 TGGTAAGAGAATCATTTGGTTGG - Intronic
939933576 2:148260675-148260697 TGGGTAGAGCAGCATCTGGTTGG - Intronic
940781015 2:157933696-157933718 TGGAAAGAGACTAATGTGGCTGG + Intronic
941091793 2:161185352-161185374 TGGGAAGGGCAGATTGTAGTAGG + Intronic
944359896 2:198841494-198841516 TGGCAAGAGCATGAGGTGCTGGG + Intergenic
947028536 2:225765976-225765998 TGGGAAAAACATAATGTTCTAGG - Intergenic
1170442275 20:16391076-16391098 TGTGATGAGCATAGTGTGGGTGG + Intronic
1175156887 20:56977229-56977251 AGGGAAGAGCATGCTCTGGTGGG + Intergenic
1176904967 21:14489262-14489284 TGGGAAGTCCATAATTTTGTAGG - Intronic
1177854933 21:26390160-26390182 CTGGAAGAGCATGATGAGGTGGG - Intergenic
1178922672 21:36748476-36748498 TTGGAAGAGCGGACTGTGGTAGG - Exonic
1183864420 22:40692918-40692940 TGGGAAGAGCTGGATGTGGAGGG + Intergenic
950898180 3:16472738-16472760 TGTGAAGATCATCATGTGTTGGG - Intronic
951193166 3:19794099-19794121 TGGAAAGAGGAGAATGTGCTAGG - Intergenic
954715991 3:52527259-52527281 TGGGGAGAGCAGCATGTGGTGGG - Intronic
957360875 3:79155938-79155960 TGGGAAGTGAATTATTTGGTGGG - Intronic
963765775 3:149334638-149334660 TGGGAAGAGAATAACATTGTTGG + Intergenic
964762962 3:160151983-160152005 TGGGAAGAGAAAGATGTGGAAGG + Intergenic
967091226 3:186136468-186136490 TGAGAAAAGCAGAATGTGATGGG + Intronic
971893750 4:32562237-32562259 TGGGCACAGCATCATGTGGTAGG - Intergenic
972969763 4:44558969-44558991 TTGGAAGATCAGAATGAGGTCGG + Intergenic
973220358 4:47719240-47719262 TGGGAAGAGCAAAAGGTAGAAGG - Intronic
973655244 4:53040681-53040703 TTGGAAGAACTTAATGTGGTTGG - Intronic
975270941 4:72432323-72432345 TGTGAACACCATAGTGTGGTCGG - Intronic
975650943 4:76592229-76592251 TGGGTGGAGCAGAATGTGGCGGG + Intronic
975801613 4:78065445-78065467 TCAGAGGAGCATAATCTGGTGGG + Intronic
975846794 4:78533716-78533738 AGGGAAGAGCATACTGAGTTTGG + Intronic
976409737 4:84699730-84699752 TAGGATGACCATAATGGGGTGGG - Intronic
980329466 4:131391168-131391190 TGGGCAGAGCATCATGTGTTAGG - Intergenic
981029487 4:140109941-140109963 TTTGAAGAGCATTATATGGTGGG - Intronic
982362235 4:154531718-154531740 TGAGAAGAGCAATATTTGGTTGG - Intergenic
983521712 4:168716018-168716040 TGTGAATGGCAAAATGTGGTAGG + Intronic
983648563 4:170016493-170016515 TAGGTAGAGCATGATGGGGTGGG - Intronic
984098469 4:175460689-175460711 TGGGAAGAACATATTGTTGAAGG + Intergenic
986498866 5:8376699-8376721 TCGGAACAGCATAATGAGGTGGG + Intergenic
989070601 5:37506911-37506933 TGGGAAGAGAAAAAGGTGGGAGG - Intronic
990534182 5:56703996-56704018 TGGGAAGGGTAGACTGTGGTGGG - Intergenic
990596715 5:57319516-57319538 AGTGAAGAGAATAATTTGGTGGG - Intergenic
990663122 5:58041245-58041267 TGTGAAGAATAAAATGTGGTGGG + Intergenic
991361305 5:65823714-65823736 TGAGAAGAGAAAAATGTGCTTGG - Exonic
993242533 5:85409069-85409091 TGGGAACACCAGAATGTGTTGGG - Intergenic
993356187 5:86911270-86911292 TGAGAAGGGCACATTGTGGTAGG - Intergenic
993599370 5:89901985-89902007 TGGGAAGAGCTTAATAATGTTGG - Intergenic
993991837 5:94667492-94667514 TGGAAAGAGCATACTGTGGGGGG - Intronic
994716850 5:103332075-103332097 TGGGAAGAGTGTAAACTGGTGGG - Intergenic
995367943 5:111384940-111384962 TGGGAAGAGAACAAAGTGGGTGG - Intronic
995422697 5:111984864-111984886 TAGAAAGAGCCTCATGTGGTTGG - Intronic
995468972 5:112480165-112480187 TGGGAAGAGCAACATTTGGAGGG - Intergenic
996037165 5:118771342-118771364 TGGAAAAATCACAATGTGGTTGG + Intergenic
998126602 5:139627298-139627320 TGGGTAGAGTTTAATCTGGTTGG - Exonic
998789464 5:145750441-145750463 TAGGGATTGCATAATGTGGTGGG - Intronic
998994068 5:147851562-147851584 TGGGAAGAGGATTGAGTGGTGGG + Intergenic
999941611 5:156549037-156549059 AGGGAAGGGAATAAGGTGGTGGG - Intronic
1000852914 5:166362315-166362337 TGGGAAAAGCAACATTTGGTTGG + Intergenic
1001975722 5:175996948-175996970 TGGGCAGAGCACACTGAGGTGGG - Intronic
1002241704 5:177846824-177846846 TGGGCAGAGCACACTGAGGTGGG + Intergenic
1003445348 6:6178629-6178651 TGGGAAGAACATCAGGTGGGTGG + Intronic
1004947089 6:20627526-20627548 TCGGAAAAGAATAATGTGGAAGG - Intronic
1005375954 6:25182527-25182549 TGGGTAGAGTTTAATCTGGTTGG - Intergenic
1006906675 6:37537629-37537651 TGGGGAGAGAATATGGTGGTGGG + Intergenic
1008465689 6:51828102-51828124 TGGTAAGAGAAGAATGTGGAGGG + Intronic
1008696614 6:54045710-54045732 TAGGAAGAGCGTAAAGTGGGAGG - Intronic
1008826431 6:55699895-55699917 AGAGAAGAGCAAAATGTAGTGGG + Intergenic
1012555445 6:100505895-100505917 TGGGAAGAGGATACGGTGGTGGG - Intergenic
1014785950 6:125619500-125619522 TGTGCAGAGCATAATCTGGGAGG + Intergenic
1015272181 6:131348408-131348430 TGGGAAAAGCAGAAGTTGGTGGG - Intergenic
1016295510 6:142569182-142569204 AAGGAAGACTATAATGTGGTTGG - Intergenic
1017076047 6:150619766-150619788 TGTGAAGAACATAATGTAGAAGG - Intronic
1019164209 6:170087805-170087827 TGGGAGGAGCATGGTGTGGGGGG + Intergenic
1021930978 7:25581134-25581156 TGGGAAGAGCAGATGGTGGAGGG - Intergenic
1023007245 7:35885091-35885113 TGGGAGGAGCATGATGTGGGAGG - Intronic
1024425897 7:49226310-49226332 TGGGAAGAACATGAGATGGTTGG - Intergenic
1027667924 7:81061945-81061967 TGGGAAGTGGATGTTGTGGTGGG - Intergenic
1029432849 7:100542789-100542811 TGGGAAGTGAAAATTGTGGTCGG + Intronic
1030624337 7:111827759-111827781 GGGGTGGAGGATAATGTGGTTGG + Intronic
1031865561 7:127035495-127035517 TGGGAAGAGACTACTGTGGCTGG - Intronic
1032534033 7:132645747-132645769 TGGGAAGAGCACAAAGTGATGGG + Intronic
1037590946 8:20311535-20311557 TGGGAGGAGCATAAGGGGGCGGG + Intergenic
1039150894 8:34504432-34504454 TGGGAACAGTATTATGTGGTGGG - Intergenic
1041837413 8:62232166-62232188 TGGGAAGGGCATGAATTGGTGGG - Intergenic
1042690966 8:71498367-71498389 TGGCAAGAGACTAATGTGATTGG - Intronic
1045752544 8:105502640-105502662 TGTGAAGAGCAAATTGTGCTAGG + Intronic
1046789067 8:118301187-118301209 TGCAAAGAGCAAAAGGTGGTGGG + Intronic
1050029108 9:1366481-1366503 AGGAAAGAGCATAAGGTGGGTGG + Intergenic
1050495007 9:6231323-6231345 TGGGGAGAGCATAATGTGAAGGG - Intronic
1051488094 9:17630540-17630562 TGGGAAGGGCAGAATGTGGTAGG + Intronic
1051702706 9:19841508-19841530 AGGGGAGGGCATAATGTGCTAGG + Intergenic
1051858839 9:21601061-21601083 TGGAAAGAGCATGATCTGTTTGG + Intergenic
1052664523 9:31477788-31477810 TGGGAAAGGAATAAGGTGGTTGG + Intergenic
1055191749 9:73532914-73532936 TGGGAAGAGCAGGATGAGGAAGG - Intergenic
1057643648 9:96853198-96853220 TGAGAAGAGCAAAATGGGCTAGG - Intronic
1057989584 9:99754389-99754411 AGGGAAAAGCTTAATGTGGGAGG + Intergenic
1059365184 9:113781345-113781367 AGGAAAGAGCATAATGTGGAAGG - Intergenic
1059593964 9:115695855-115695877 TGGGAAGAGCAAGGAGTGGTAGG - Intergenic
1059901428 9:118930635-118930657 TTGGAAGAGGACAAGGTGGTGGG - Intergenic
1060912733 9:127363612-127363634 TGGGAGGAGCACAGTGTGGACGG + Intronic
1186969502 X:14825120-14825142 TGAGAAGATCTTAAAGTGGTTGG - Intergenic
1189126763 X:38456328-38456350 TGGGAAGAGGAAATTGGGGTGGG - Intronic
1189222780 X:39386579-39386601 TGGGAAAAGTATAAAGAGGTTGG - Intergenic
1192070193 X:67930819-67930841 TGGGAAGGGCAGTATGGGGTTGG + Intergenic
1192911072 X:75604792-75604814 TGAAAAGAGTATAATGGGGTAGG + Intergenic
1193690930 X:84641699-84641721 TGTCAAGAGCATAACCTGGTGGG + Intergenic
1195401327 X:104464506-104464528 TGGGAGGAGGAAAATTTGGTTGG + Intergenic
1196241599 X:113348352-113348374 TGGGTTGAGGATAATGTGGTAGG + Intergenic
1197697898 X:129570419-129570441 TGTGAAGAGCATAATGGGATAGG + Intronic
1198281617 X:135148332-135148354 TGGGATGCGCATAAGGTTGTTGG - Intergenic
1198289342 X:135224190-135224212 TGGGATGCGCATAAGGTTGTTGG + Intergenic
1200324102 X:155219671-155219693 TGGGAAATGCATAAAGTGGTGGG + Intronic