ID: 919983472

View in Genome Browser
Species Human (GRCh38)
Location 1:202657173-202657195
Sequence TGTCATGACCATGATGAGGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 163
Summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 152}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
919983472_919983476 8 Left 919983472 1:202657173-202657195 CCAACCTCATCATGGTCATGACA 0: 1
1: 0
2: 1
3: 9
4: 152
Right 919983476 1:202657204-202657226 TTTTCATCAGGTCCAGTCTCTGG 0: 1
1: 0
2: 1
3: 7
4: 159
919983472_919983474 -4 Left 919983472 1:202657173-202657195 CCAACCTCATCATGGTCATGACA 0: 1
1: 0
2: 1
3: 9
4: 152
Right 919983474 1:202657192-202657214 GACACAGAAGCCTTTTCATCAGG 0: 1
1: 0
2: 0
3: 15
4: 150

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
919983472 Original CRISPR TGTCATGACCATGATGAGGT TGG (reversed) Intronic
904325276 1:29724047-29724069 TGTGATGACAATGATGATGATGG - Intergenic
907236661 1:53055488-53055510 TGTCAAGTCCATGTAGAGGTGGG + Intergenic
912677116 1:111693231-111693253 TGCCATAACCATAATGGGGTGGG + Intronic
913414976 1:118595235-118595257 TGGCAGGAAAATGATGAGGTTGG - Intergenic
913541431 1:119824932-119824954 TGTCAGGAGCTTGAGGAGGTAGG + Intergenic
914771550 1:150690689-150690711 TATCATGAGCTTGATGAGTTTGG - Intronic
915873009 1:159581804-159581826 GACAATGACCATGATGAGGTGGG + Intergenic
918383487 1:183982228-183982250 TGTTAGGACCAAGATGGGGTAGG + Intronic
919983472 1:202657173-202657195 TGTCATGACCATGATGAGGTTGG - Intronic
920030509 1:203034762-203034784 TGCCATCACCCTGATGAGGGTGG + Intronic
922004147 1:221511795-221511817 TGTGGGGACAATGATGAGGTAGG - Intergenic
923338396 1:232988847-232988869 TGTCAGGACCTAGATGAGGCTGG + Intronic
1068713686 10:60162414-60162436 TGCCATTACACTGATGAGGTAGG - Intronic
1071480065 10:86058356-86058378 TGTAATGAACATGGAGAGGTTGG - Intronic
1073903553 10:108250653-108250675 TGTCATGACCAGGAAGAATTAGG - Intergenic
1074183701 10:111083773-111083795 TGCCATCCCCAAGATGAGGTTGG - Intergenic
1076030543 10:127154016-127154038 TTCCATGACCATGATGAGCTTGG - Intronic
1076942183 10:133617258-133617280 TGGCCTGACCTTGATGAGGACGG - Intergenic
1079226619 11:18611916-18611938 CTTCATGACCATCATGAGGTGGG + Intronic
1081027056 11:38028511-38028533 TTTTATGACAATGATAAGGTAGG + Intergenic
1081609502 11:44551844-44551866 TGTGATGACGATGATGAAGATGG + Intergenic
1087567595 11:99881890-99881912 TGTGATGAACAAGATGAGATAGG - Intronic
1088685672 11:112282531-112282553 TGTGATGACCATGATGTGAAAGG + Intergenic
1089473558 11:118740334-118740356 TTTCATGACCATGAAGAAGAGGG - Intergenic
1090744786 11:129696869-129696891 TGTCATGTCCATGAGGCTGTGGG + Intergenic
1093679840 12:21989377-21989399 TATTATGACCCTAATGAGGTAGG - Intergenic
1093705774 12:22273529-22273551 TCTCATGACCAGGAAGAAGTAGG - Intronic
1093932402 12:24967278-24967300 TCCCATGACCATGATGGAGTTGG + Intergenic
1097827971 12:64194073-64194095 CGTCATGATCATGATGACATTGG + Exonic
1099021001 12:77404524-77404546 TTTCATGTCCATATTGAGGTTGG + Intergenic
1100882084 12:99030290-99030312 TGTTATGACCATGGTGATGGTGG + Intronic
1101735929 12:107463147-107463169 TGTAGTGACAATGATGAGGGTGG + Intronic
1102331806 12:112039220-112039242 TGTTATTACCATGATGATGCTGG + Exonic
1103269931 12:119664861-119664883 TGCCATGACCATGATGTAGTGGG + Intergenic
1103681726 12:122699627-122699649 TGTCATGACTATGGTGGAGTGGG - Intergenic
1103683478 12:122713091-122713113 TGTCATGACTATGGTGGAGTGGG - Intergenic
1109095720 13:58113720-58113742 TGTCATGACCTTAATGAATTCGG + Intergenic
1111100601 13:83579739-83579761 TGTCATGAACACGAGGAGGTAGG + Intergenic
1116000821 14:39241186-39241208 TTTCATGAGCATGATAATGTTGG + Intronic
1117046745 14:51820029-51820051 TGTATTGACCATGTTGAGTTCGG - Intergenic
1117301576 14:54434556-54434578 TCTCATGACAATCCTGAGGTAGG - Intronic
1118735260 14:68696543-68696565 TGCCATGCCAATGAGGAGGTTGG - Intronic
1119056750 14:71430107-71430129 TGTGGTGTCCATAATGAGGTAGG - Intronic
1119096145 14:71833526-71833548 TGTCATGACCATGTAGGGGTGGG - Intergenic
1119735822 14:76981139-76981161 TCTTATTCCCATGATGAGGTTGG - Intergenic
1121405365 14:93716353-93716375 TGTCATGAGCCTGGTGATGTGGG + Intergenic
1122823449 14:104358599-104358621 TTTCAGGAGCATGAGGAGGTGGG + Intergenic
1127123506 15:55790951-55790973 TGTCATGTCCGGGATGAGTTGGG + Intergenic
1130050267 15:80478572-80478594 TGTCAGGAACAAGATGAGGCTGG + Intronic
1130080982 15:80733200-80733222 GGTCATGACCATGAGGAGGTCGG - Intronic
1130653828 15:85777962-85777984 AGTCATAACCATGTTGAGCTTGG - Intronic
1133112649 16:3557772-3557794 TGTCCAGACCCTGATGATGTGGG - Intronic
1134082403 16:11334117-11334139 TGTCATGGCCATGGTGGGGCTGG - Intronic
1137327824 16:47460140-47460162 GGTGATGACCAAGATGAGGAAGG + Intronic
1137521875 16:49201749-49201771 TGTCATCCCCATCATCAGGTCGG + Intergenic
1138766708 16:59613906-59613928 TGTCATCACCATGACAAGGCTGG + Intergenic
1139176754 16:64698667-64698689 TGTGTTGCCCATGAGGAGGTTGG + Intergenic
1141903265 16:87006573-87006595 GGTCATGATCATGATGAGATTGG - Intergenic
1142140264 16:88469621-88469643 TGGCAAGACCAGGATGAGGCAGG + Intronic
1145824977 17:27870034-27870056 TCTCATGACCAGGAAGAAGTAGG - Intronic
1147773645 17:42885061-42885083 TCCCATCACCATGATGTGGTGGG - Intergenic
1151700886 17:75742077-75742099 TGTCCAGCCCTTGATGAGGTGGG + Intronic
1152812015 17:82386645-82386667 AGTCCTGCCCATGGTGAGGTGGG - Intergenic
1153663418 18:7346349-7346371 TGTAGTGACCAGGATGAGATTGG - Intergenic
1155787021 18:29914233-29914255 TGGGATCACAATGATGAGGTGGG + Intergenic
1157634474 18:49137199-49137221 TGGCACCACCATGATGAAGTAGG - Intronic
1160027237 18:75228544-75228566 TGTCAGGAGCATGATGCTGTGGG + Intronic
1162364303 19:10238523-10238545 TGTCATGAGCATGCTGGGGTGGG - Intergenic
925409872 2:3633800-3633822 TGTGCTGACCATGAGGAGGAAGG - Intronic
925567753 2:5274519-5274541 TGCCATGACCTGGATGAGATTGG - Intergenic
925656200 2:6152178-6152200 TGTCAGGACCAGGATGAAGAGGG - Intergenic
929055787 2:37875104-37875126 TGTAAGGACCTGGATGAGGTGGG + Intergenic
929227410 2:39525013-39525035 TGCCAGGCCCATGATGACGTAGG - Intergenic
931344978 2:61438144-61438166 TGTAATAACCATGATGAACTGGG + Intronic
931835833 2:66097627-66097649 TGTCATGTGCATGATATGGTGGG + Intergenic
937421382 2:121758931-121758953 TGTCATGACCATTATTAGTTCGG - Intronic
938324020 2:130385475-130385497 TGTCATGTCAATGACGGGGTGGG - Intergenic
940817661 2:158313557-158313579 TGTCCTGTCCATAACGAGGTGGG - Intronic
945046798 2:205789015-205789037 TCTCATGAACATGAAGAAGTGGG - Intronic
945974246 2:216258381-216258403 TGTCCTGGCCATGGTGGGGTTGG + Exonic
946005698 2:216522857-216522879 GGTCATCATCATGATGATGTTGG + Intronic
946811754 2:223532859-223532881 GATCATGACCAGGAAGAGGTAGG + Intergenic
1168955754 20:1833050-1833072 TATCATCATCATCATGAGGTGGG - Intergenic
1169317840 20:4608196-4608218 TGTCATGACAGTGGTGAGGGTGG + Intergenic
1169530069 20:6475586-6475608 TGACATCAACAAGATGAGGTAGG - Intergenic
1174503846 20:51004305-51004327 TGTCATCACCATGACGACGGTGG - Exonic
1175169694 20:57071490-57071512 TGTCATGGCCCAGATGATGTCGG + Intergenic
1177054006 21:16276812-16276834 TGTGATGAAAATGATGATGTTGG + Intergenic
1177170012 21:17644664-17644686 TGTCAGGGCAATGATGAGGTTGG + Intergenic
1178433829 21:32539709-32539731 TGTCCTTACCATGTAGAGGTAGG - Intergenic
1180032435 21:45221668-45221690 TGTCATCACCCTGATGACCTCGG - Intronic
1180153108 21:45962516-45962538 TGTCATGACCAGGACAAGTTAGG + Intergenic
1183693021 22:39401772-39401794 TGTCCTGATCATCATGAGGGCGG - Intronic
1185003468 22:48261460-48261482 GGTGATGATCATGATGAGGATGG - Intergenic
1185103924 22:48856608-48856630 TGTCAAGACTATGGTGGGGTGGG - Intergenic
949651332 3:6163477-6163499 TGTGATCACTATTATGAGGTTGG + Intergenic
950151517 3:10691312-10691334 TGCCATGAGTACGATGAGGTGGG + Intronic
950181239 3:10914931-10914953 TGTCAGCACCATGAGGACGTGGG + Intronic
950394202 3:12721219-12721241 TGTCACAACCATGGTGAGGAGGG - Intergenic
957637587 3:82806873-82806895 TGTAATGATCATGATGAGAATGG - Intergenic
964874121 3:161346896-161346918 TGTGATGACACTGAAGAGGTGGG + Intronic
964917967 3:161858779-161858801 TGTCACTTCCATGATTAGGTTGG - Intergenic
966258411 3:177946162-177946184 TATCATGTCCAAGATTAGGTTGG - Intergenic
966538996 3:181068108-181068130 TGTCAGGGACATGATGGGGTTGG + Intergenic
967097867 3:186192522-186192544 TCACATGAACATGATGAGGGAGG + Intronic
968811127 4:2800118-2800140 TGACGTGACCAGGATGGGGTCGG + Intronic
970723496 4:19015724-19015746 TGTGAGGACCATTAAGAGGTGGG + Intergenic
973784626 4:54323552-54323574 GGTCATGACCTTCCTGAGGTGGG + Intergenic
974782821 4:66575326-66575348 TGGAATGCCCATTATGAGGTTGG - Intergenic
979694736 4:123600157-123600179 TGTCTTAACCAGGATGTGGTTGG - Intergenic
979705977 4:123721253-123721275 TGCCATGACCTGGATGAGATTGG + Intergenic
986436773 5:7741830-7741852 GGTGATGACGATGATGAGGATGG - Intronic
993419575 5:87684034-87684056 TGCCAGGACCCTGATGAAGTTGG - Intergenic
994157188 5:96516924-96516946 TGACATGACGAAGATGAGGATGG + Intergenic
994282709 5:97925223-97925245 GTTCATGACCATGATGGGATGGG + Intergenic
995968655 5:117940529-117940551 TGTCAGGACCTGAATGAGGTGGG + Intergenic
996234558 5:121109188-121109210 TGTCATAACCATGAGAAAGTGGG - Intergenic
996818766 5:127602375-127602397 TGTCAGGGACAAGATGAGGTGGG - Intergenic
997587650 5:135053152-135053174 TCTCATGACCATGAAGCTGTGGG - Intronic
1001511562 5:172326534-172326556 TTTCATGATCATGTTGAGGGAGG + Intronic
1001686098 5:173596057-173596079 GGACATGAGCATGATGAGATAGG + Intergenic
1002047959 5:176552682-176552704 CCTCATGATCATGATGAGGCTGG - Intronic
1003318366 6:5031428-5031450 TATCATGTCCATGCTGGGGTGGG - Intergenic
1005878514 6:30034903-30034925 TGTCTTCACAAAGATGAGGTTGG - Intergenic
1006606484 6:35260727-35260749 CATCATGACTGTGATGAGGTTGG + Intronic
1007387095 6:41527658-41527680 TGACATGTCAATGATGAGGCAGG + Intergenic
1007908016 6:45483735-45483757 TGTGATGACCAAGTTGAGCTTGG + Intronic
1011706214 6:90003865-90003887 TGGCATGACCAGGATGAGAAGGG - Intronic
1015232497 6:130931971-130931993 TCTCATCACCATTATAAGGTGGG - Intronic
1015681438 6:135813171-135813193 TCTCATGACCAGGAAGAAGTAGG + Intergenic
1017351495 6:153448076-153448098 GGTCATGACCCTGAAGAGCTAGG - Intergenic
1019332476 7:467226-467248 GGTGATGGCCATGAGGAGGTAGG - Intergenic
1019481949 7:1270915-1270937 TGCTATGCCCATGCTGAGGTGGG - Intergenic
1020366370 7:7384898-7384920 TGTCATGAAGATGAATAGGTGGG + Intronic
1020650129 7:10864948-10864970 TGAAATGACCATGAGGTGGTAGG + Intergenic
1020703532 7:11513004-11513026 TGCCATGACCTGGATGAGATTGG + Intronic
1027699694 7:81454613-81454635 TGCCATGACCTGGATGAGATTGG + Intergenic
1028182482 7:87742500-87742522 TGTGATGACCTGGATGAGATTGG - Intronic
1028953619 7:96664693-96664715 TGTCTTTACAATGATGTGGTAGG - Intronic
1030386394 7:108872485-108872507 TGTGATGATGATCATGAGGTTGG - Intergenic
1036149372 8:6283647-6283669 TCTCCTGACCATGGTGGGGTGGG - Intergenic
1037526574 8:19730447-19730469 TATTATGTCCATGCTGAGGTTGG + Intronic
1038072244 8:24030008-24030030 TGATATGACCAAGATGAGGAGGG + Intergenic
1039074739 8:33679849-33679871 TGTAATGACCTGGATGAGATTGG + Intergenic
1043680954 8:83023774-83023796 TCTCATGACCAGGAAGAAGTAGG + Intergenic
1045191539 8:99889053-99889075 TGTCATGACCAGGAGGAATTAGG - Intronic
1049329404 8:142042338-142042360 TGTCCTGAGCAAGATGAGGCAGG + Intergenic
1053040436 9:34866062-34866084 TGTCATGAATATCAGGAGGTGGG + Intergenic
1055036835 9:71826588-71826610 TGTCATGTCCAGGATGGGGAGGG + Intergenic
1057162007 9:92895487-92895509 TGACAGGGCCATGATGGGGTGGG + Intergenic
1057297474 9:93857796-93857818 TGTGATGACCATGAGAAGGAAGG - Intergenic
1062519956 9:136953637-136953659 TGGCAGGTCCATGCTGAGGTGGG - Intronic
1062714990 9:138005157-138005179 TGCCATGAGCATGAGGAGGCAGG - Intronic
1187809168 X:23156742-23156764 TGGCGTGACAATGCTGAGGTTGG + Intergenic
1188080497 X:25833515-25833537 TTTAATTACCATGATGTGGTCGG + Intergenic
1189033451 X:37472425-37472447 TGAAATGACCATGATGAGAAAGG + Intronic
1189063069 X:37775203-37775225 TGATATGACCATGATGATGATGG - Intronic
1190262585 X:48806689-48806711 TGGCATGGCCATCATTAGGTAGG + Exonic
1195556964 X:106237930-106237952 TGTGGTGACCTGGATGAGGTTGG + Intergenic
1196177226 X:112652369-112652391 TGTCTTTACCTTGAGGAGGTTGG + Intronic
1198010936 X:132553324-132553346 TGTCATGATCACCATGAGATAGG + Intergenic
1198138551 X:133779806-133779828 AGTCAGGACCAGGATGTGGTAGG - Intronic
1201505129 Y:14690063-14690085 TGTCATTTCCATGATGGGGATGG - Intronic