ID: 919986595

View in Genome Browser
Species Human (GRCh38)
Location 1:202680041-202680063
Sequence TTAGTTCAGTACAGCGATAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 53
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 48}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
919986595_919986601 21 Left 919986595 1:202680041-202680063 CCCATATCGCTGTACTGAACTAA 0: 1
1: 0
2: 0
3: 4
4: 48
Right 919986601 1:202680085-202680107 CAGGATATGCACTCTCTGAAAGG 0: 1
1: 0
2: 0
3: 9
4: 102
919986595_919986604 26 Left 919986595 1:202680041-202680063 CCCATATCGCTGTACTGAACTAA 0: 1
1: 0
2: 0
3: 4
4: 48
Right 919986604 1:202680090-202680112 TATGCACTCTCTGAAAGGAGGGG 0: 1
1: 0
2: 0
3: 10
4: 151
919986595_919986602 24 Left 919986595 1:202680041-202680063 CCCATATCGCTGTACTGAACTAA 0: 1
1: 0
2: 0
3: 4
4: 48
Right 919986602 1:202680088-202680110 GATATGCACTCTCTGAAAGGAGG 0: 1
1: 0
2: 0
3: 4
4: 83
919986595_919986597 2 Left 919986595 1:202680041-202680063 CCCATATCGCTGTACTGAACTAA 0: 1
1: 0
2: 0
3: 4
4: 48
Right 919986597 1:202680066-202680088 GTTTGCATGTCAGTTTCCCCAGG 0: 1
1: 0
2: 2
3: 11
4: 182
919986595_919986603 25 Left 919986595 1:202680041-202680063 CCCATATCGCTGTACTGAACTAA 0: 1
1: 0
2: 0
3: 4
4: 48
Right 919986603 1:202680089-202680111 ATATGCACTCTCTGAAAGGAGGG 0: 1
1: 0
2: 1
3: 18
4: 189

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
919986595 Original CRISPR TTAGTTCAGTACAGCGATAT GGG (reversed) Intronic
908642781 1:66243784-66243806 TTGATTCAGTCCAGGGATATTGG + Intronic
919438760 1:197599972-197599994 TTATTTCACTACAGCTATATAGG + Intronic
919986595 1:202680041-202680063 TTAGTTCAGTACAGCGATATGGG - Intronic
1073111481 10:101065480-101065502 TTAGTTCAGTGCAGAGAGATAGG + Exonic
1081253861 11:40868849-40868871 TTAATTCAGTACAGAGAGAAGGG - Intronic
1100999494 12:100343664-100343686 TCAGTTCACTGCAGCGATCTCGG + Intergenic
1102289164 12:111685257-111685279 TTAGTACAGTGCTGGGATATAGG + Intronic
1111256295 13:85673570-85673592 TTAGATTAGTACAGCCATTTTGG + Intergenic
1116825345 14:49668217-49668239 GTAGTTCAGTAGTGCGATCTTGG - Intronic
1120106395 14:80500406-80500428 TTAGATCTGTATAGAGATATAGG - Intronic
1126280044 15:46936879-46936901 TTATTTCAGTAGTGCAATATAGG - Intergenic
1127823307 15:62679976-62679998 CTAGTTCAGCACATCTATATGGG + Intronic
1133661230 16:7919792-7919814 CTAGTTCTGGACTGCGATATTGG + Intergenic
1137686405 16:50390081-50390103 TGAGTTCAGTGCAGGGATTTGGG - Intergenic
1152943321 17:83184171-83184193 TTAGTTCAGGGCAGGGATGTTGG + Intergenic
1156920094 18:42511612-42511634 TTAGGTCTGTACAGAGATAGTGG + Intergenic
1158062040 18:53355996-53356018 TGAGTTGAGAACAGTGATATTGG - Intronic
1160886372 19:1350843-1350865 TGAGTGCAGTGGAGCGATATCGG + Intergenic
927924608 2:27002447-27002469 ATAGTTTAGTACAGCCATTTTGG - Intronic
928350304 2:30546490-30546512 GTGGTTCAATACAGTGATATGGG + Intronic
931364364 2:61606089-61606111 ATGGTTCAGAACAGAGATATTGG + Intergenic
940510019 2:154602144-154602166 GGAGTTCAGTGGAGCGATATCGG + Intergenic
941840476 2:170077634-170077656 TGAGTGCAGTAGAGCGATCTTGG + Intronic
942385983 2:175443560-175443582 TTAGTTCAACGCAGCGATCTGGG - Intergenic
943559769 2:189446911-189446933 GTACTTCAGTACAGCAATAGTGG + Intronic
943657558 2:190525799-190525821 TTAATTCAGTTTAGAGATATTGG + Intronic
946165342 2:217860125-217860147 TAAGTTTGGTACAGCGAGATTGG + Intronic
948680393 2:239630136-239630158 TTAGGTCAGAACAGAGATATGGG + Intergenic
1177404182 21:20645022-20645044 TTTGATCAATAAAGCGATATTGG - Intergenic
1183433449 22:37779907-37779929 TTGGCTCAGAACAGCGATCTTGG + Intergenic
950341081 3:12245280-12245302 TTAGTTCAATACTGTGATACAGG + Intergenic
952442949 3:33351361-33351383 GTAGTTCATTACAGGTATATAGG - Intronic
955581557 3:60428414-60428436 ATGGTTCAGTAAAGGGATATAGG - Intronic
959836761 3:110926879-110926901 GTAGTTCAGTTCAGCTATCTTGG - Intergenic
960453407 3:117839308-117839330 TTAGTTTTGTACAGGGCTATAGG + Intergenic
963975943 3:151480778-151480800 TTACTTCAGTTCAGCCCTATAGG - Intergenic
964612020 3:158625057-158625079 TTAGGTCAGTACAGCCTTATGGG + Intergenic
965208638 3:165755190-165755212 TAAGTTCAGTGGAGAGATATTGG - Intergenic
975976316 4:80100760-80100782 TTAGTTCAGAAAAGGGATGTTGG - Intronic
993532808 5:89044810-89044832 TTACTACAGTATAGCAATATGGG - Intergenic
1011211964 6:84964957-84964979 TTAGGTCAGTACAGCCTTCTGGG + Intergenic
1012610749 6:101216417-101216439 TTAGTACACTCCAGCCATATGGG - Intergenic
1016887569 6:148972148-148972170 ATAGCTCAGTGCAGCCATATAGG + Intronic
1022625239 7:32029250-32029272 TTAGTACAGTACAGCCATTATGG + Intronic
1023086813 7:36579182-36579204 TGAGTTCAGTTCAGCTACATAGG - Intronic
1024190868 7:47008176-47008198 TTAGTGCAGTACAGTCCTATGGG - Intergenic
1030497425 7:110316929-110316951 TTACTTCAGTACAGAGAAAAGGG + Intergenic
1038982855 8:32778301-32778323 TATGTTCAGGACAGCGATTTAGG + Intergenic
1044363283 8:91313468-91313490 TTAGTGCTGTTCAGAGATATGGG - Intronic
1055311655 9:74988959-74988981 TTAGGTAAGTACAGTGAGATGGG - Intronic
1186002249 X:5025946-5025968 GTAGTTCAGGACAGAGAAATAGG + Intergenic
1188706571 X:33340470-33340492 CTATTTCAGAATAGCGATATTGG - Intergenic
1193335838 X:80287753-80287775 TTAATTCAGTACAGATATAATGG + Intergenic