ID: 919987487

View in Genome Browser
Species Human (GRCh38)
Location 1:202685995-202686017
Sequence CAAGCACATCCACCAGAGAG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 215
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 201}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
919987474_919987487 20 Left 919987474 1:202685952-202685974 CCTGGGGAGGAGTGCTCCTGCCA 0: 1
1: 0
2: 3
3: 20
4: 301
Right 919987487 1:202685995-202686017 CAAGCACATCCACCAGAGAGAGG 0: 1
1: 0
2: 0
3: 13
4: 201
919987481_919987487 0 Left 919987481 1:202685972-202685994 CCAGGAAACCCCCAGGGTAGGGG 0: 1
1: 0
2: 2
3: 26
4: 240
Right 919987487 1:202685995-202686017 CAAGCACATCCACCAGAGAGAGG 0: 1
1: 0
2: 0
3: 13
4: 201
919987473_919987487 30 Left 919987473 1:202685942-202685964 CCTCTACACTCCTGGGGAGGAGT 0: 1
1: 0
2: 0
3: 15
4: 143
Right 919987487 1:202685995-202686017 CAAGCACATCCACCAGAGAGAGG 0: 1
1: 0
2: 0
3: 13
4: 201
919987478_919987487 4 Left 919987478 1:202685968-202685990 CCTGCCAGGAAACCCCCAGGGTA 0: 1
1: 0
2: 2
3: 13
4: 141
Right 919987487 1:202685995-202686017 CAAGCACATCCACCAGAGAGAGG 0: 1
1: 0
2: 0
3: 13
4: 201
919987484_919987487 -9 Left 919987484 1:202685981-202686003 CCCCAGGGTAGGGGCAAGCACAT 0: 1
1: 0
2: 1
3: 16
4: 151
Right 919987487 1:202685995-202686017 CAAGCACATCCACCAGAGAGAGG 0: 1
1: 0
2: 0
3: 13
4: 201
919987483_919987487 -8 Left 919987483 1:202685980-202686002 CCCCCAGGGTAGGGGCAAGCACA 0: 1
1: 0
2: 1
3: 11
4: 172
Right 919987487 1:202685995-202686017 CAAGCACATCCACCAGAGAGAGG 0: 1
1: 0
2: 0
3: 13
4: 201
919987485_919987487 -10 Left 919987485 1:202685982-202686004 CCCAGGGTAGGGGCAAGCACATC 0: 1
1: 0
2: 0
3: 12
4: 142
Right 919987487 1:202685995-202686017 CAAGCACATCCACCAGAGAGAGG 0: 1
1: 0
2: 0
3: 13
4: 201

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
919987487 Original CRISPR CAAGCACATCCACCAGAGAG AGG Intronic
900169606 1:1260189-1260211 CGGCCACATCCACCAGGGAGAGG + Intronic
900529214 1:3144512-3144534 CAAGGTCATCCACCTCAGAGTGG - Intronic
900885870 1:5414970-5414992 CAACAACATCCAGCAGTGAGAGG + Intergenic
900909751 1:5586696-5586718 CAAGCACAGCCATCAGGAAGTGG + Intergenic
901190435 1:7406914-7406936 CACGCACATCCAACTGTGAGAGG + Intronic
901421483 1:9154201-9154223 CCAGCACTGCCACCAGAGGGAGG + Intergenic
901550071 1:9989469-9989491 CAAGCTCAGCCAGCAGAGAGTGG + Intergenic
902406690 1:16187924-16187946 CCAGCCCAGCCACCAGAGGGCGG - Intergenic
905027286 1:34859543-34859565 CCAGAACACCCGCCAGAGAGGGG + Intronic
907662160 1:56403155-56403177 CAAGCAAATCCATCAAAAAGGGG + Intergenic
910194078 1:84622481-84622503 TAACCACATCCTGCAGAGAGGGG - Intergenic
912389431 1:109292070-109292092 GACGCACATCCACCACAAAGAGG - Intergenic
915230356 1:154441327-154441349 GAAGCACATCCACCTGAGGCTGG - Intronic
916725882 1:167523423-167523445 CAAACACATACATCAGACAGAGG + Intergenic
917492685 1:175511601-175511623 CAAGCACATCTTGCAGTGAGAGG + Intronic
917634561 1:176922369-176922391 CAGGCACATCCTCCAGAGGTGGG - Intronic
918838944 1:189509240-189509262 CAAGCACAGCCACATCAGAGAGG + Intergenic
918865943 1:189900141-189900163 TTAGCACCTTCACCAGAGAGTGG + Intergenic
919987487 1:202685995-202686017 CAAGCACATCCACCAGAGAGAGG + Intronic
923102169 1:230825444-230825466 CAAGCACAGTCAACAGAGACTGG - Intergenic
924188779 1:241525660-241525682 CAAGGACATCATCCAGAGAAAGG + Intergenic
924682385 1:246251043-246251065 CAAGCACATCAACAAGAATGGGG + Intronic
924755187 1:246933964-246933986 TCAGCACATCCAACAGAGGGTGG - Intergenic
1062922434 10:1290282-1290304 CGGGCACCTCCAGCAGAGAGTGG + Intronic
1063138992 10:3240089-3240111 CAACCACGTTCACCACAGAGAGG - Intergenic
1065343711 10:24728038-24728060 TAAACACCTCCACCAGAGGGAGG + Intergenic
1066107495 10:32168582-32168604 GAAGGACACACACCAGAGAGTGG + Intergenic
1066504075 10:36023852-36023874 CAAGGACATGGATCAGAGAGGGG - Intergenic
1067465322 10:46494020-46494042 CAAGCACATGAAACAGAGAAGGG + Intergenic
1067621865 10:47890581-47890603 CAAGCACATGAAACAGAGAAGGG - Intergenic
1068423244 10:56822672-56822694 CAGGCCCAGACACCAGAGAGAGG + Intergenic
1069890058 10:71646977-71646999 TGAGCACAGGCACCAGAGAGGGG + Intronic
1073287252 10:102396391-102396413 CCAGCCCCTCCCCCAGAGAGAGG - Intronic
1073978518 10:109127438-109127460 CAATCATATCCAATAGAGAGTGG - Intergenic
1074838004 10:117317778-117317800 CAAGAACAGCCACCAAAGAAAGG + Intronic
1074982578 10:118631560-118631582 CAGGCACAGCCACCAGAGTTAGG + Intergenic
1075320136 10:121484957-121484979 CAGGCACAACCACCAGGGAAAGG + Intronic
1075648286 10:124110648-124110670 AAAGAACATTCACCAGAGATGGG + Intergenic
1076313942 10:129527669-129527691 CAGCCACAACCACCAGAGACAGG - Intronic
1076788868 10:132765905-132765927 CACGCAGATGCACCAGAGACTGG - Intronic
1078073229 11:8133155-8133177 CAAGCACATACAAAAGAGGGAGG - Intronic
1080411041 11:32025128-32025150 CAATCAGATCCACCTGGGAGTGG - Intronic
1083102698 11:60326597-60326619 CAGGCTCAGCCAGCAGAGAGAGG - Intergenic
1084651130 11:70490126-70490148 CCAGCCCACCCACCAGAGGGTGG - Intronic
1085701234 11:78747644-78747666 CAAGCAAATCCCACAGTGAGGGG - Intronic
1088373132 11:109113033-109113055 CCAGCACTGCCAGCAGAGAGTGG + Intergenic
1088545330 11:110953343-110953365 CCAGCTCAGCCAACAGAGAGAGG - Intergenic
1096713991 12:53480088-53480110 CAAGCACTTCCACTAGGGAGGGG + Intronic
1099788638 12:87300883-87300905 GAAGCAAAGCAACCAGAGAGTGG + Intergenic
1100407361 12:94283299-94283321 CAGGCACATCCAGCAGGGAAGGG + Intronic
1101432805 12:104640968-104640990 CAGGCTCAGCCAACAGAGAGGGG + Intronic
1101872384 12:108576916-108576938 CAAGCTCATCCCACAGCGAGTGG + Intergenic
1103404462 12:120665607-120665629 CAACCACATCCCACACAGAGTGG - Intronic
1106079538 13:26488659-26488681 TAAGCATATGCCCCAGAGAGCGG + Intergenic
1106821883 13:33473913-33473935 CAAGCTCAACCAACTGAGAGAGG + Intergenic
1108383342 13:49875216-49875238 CAAGCCCAACCAATAGAGAGAGG + Intergenic
1108595668 13:51946448-51946470 CAAGCACATCTCCCAGACAGAGG - Exonic
1109102464 13:58202754-58202776 TAAGCACATGCAGCACAGAGTGG + Intergenic
1114529413 14:23386488-23386510 CAAGCGCAACCACCAGCGGGTGG - Exonic
1114842607 14:26282851-26282873 CAACCACATATACCAGGGAGAGG + Intergenic
1115358172 14:32472122-32472144 GAAGTAAATCAACCAGAGAGAGG + Intronic
1116788852 14:49318240-49318262 CAAGCTCATTGCCCAGAGAGGGG + Intergenic
1117824681 14:59688731-59688753 TAATCACATCCTCCAGGGAGGGG + Intronic
1118659477 14:67992162-67992184 CAAGCACATCCAGAAGAAAATGG + Intronic
1121721866 14:96115004-96115026 CAAGCTCATCCACTAGAAATGGG - Intergenic
1123804397 15:23856145-23856167 CAAGGACATCCGCCAGAGGTCGG - Intergenic
1124158258 15:27247351-27247373 CAAGCAAGGCCACCTGAGAGGGG - Intronic
1125030239 15:35068776-35068798 CAACCACCCCTACCAGAGAGAGG + Intergenic
1125892893 15:43279306-43279328 CCAGGACATGGACCAGAGAGAGG + Intronic
1126380446 15:48041291-48041313 GCAACCCATCCACCAGAGAGTGG - Intergenic
1130691848 15:86088303-86088325 TGAGAACATCCACCACAGAGAGG - Intergenic
1131519569 15:93103305-93103327 CAAGCAAATCCTCCAGACATTGG - Intergenic
1131814783 15:96211203-96211225 CAGGCTCAGCCAGCAGAGAGAGG + Intergenic
1135525412 16:23210190-23210212 CAAGGCCATCATCCAGAGAGGGG - Intronic
1135830461 16:25768409-25768431 CAAGCAAAACAAACAGAGAGAGG - Intronic
1138442808 16:57045457-57045479 CCAACACATCCTCCTGAGAGGGG + Exonic
1140298955 16:73737817-73737839 TTAGCACCTCCCCCAGAGAGTGG + Intergenic
1144668508 17:17118257-17118279 CCAGCACATCCTCAAAAGAGAGG - Intronic
1146319368 17:31834569-31834591 GAAGCACCGCCAACAGAGAGAGG + Intergenic
1148842989 17:50511034-50511056 TAAGAACATGCACCAGAGTGAGG + Intronic
1149454804 17:56779362-56779384 AAAGCTCATCCTCCAGAGAAAGG + Intergenic
1152277189 17:79364751-79364773 CCAGCACAGCCTCCAGGGAGAGG + Intronic
1153544621 18:6193156-6193178 CAAGGACATCCAAGAGAGAAGGG + Intronic
1155077502 18:22373076-22373098 CAAGCACATGAGACAGAGAGAGG - Intergenic
1155162660 18:23208274-23208296 GAGGCACATCCAACAGTGAGGGG + Intronic
1156016888 18:32556444-32556466 CAAGCACCTTCTTCAGAGAGCGG - Intergenic
1156488654 18:37483360-37483382 CAGGCACGCCCACCAGAGGGAGG - Intronic
1157333736 18:46722068-46722090 CATGGACCTCCACCAGACAGTGG + Intronic
1157815742 18:50728447-50728469 CAAGCAGATCCACCAGGGCAGGG + Intronic
1159028216 18:63206138-63206160 CGAGCACATCCCCCTGGGAGAGG - Intronic
1160988312 19:1850248-1850270 CCATCACCTCCACCAGAGTGGGG - Intergenic
1168316746 19:55487956-55487978 CACTCAGATCCACCAGTGAGTGG + Intergenic
1168479296 19:56705134-56705156 CAAGAACATACACCAGAAAAAGG + Intergenic
926766303 2:16325454-16325476 CCAGCACATCCACCTGGGATGGG + Intergenic
928370564 2:30737233-30737255 AAAGCACAGCCAGCAGAGACAGG + Intronic
929115171 2:38437932-38437954 CAGGTTCATCCACCGGAGAGAGG + Intergenic
929321742 2:40551999-40552021 CAGGCACCTCCCTCAGAGAGGGG - Intronic
935056713 2:99573858-99573880 CCAGCACTTCCTCCAGGGAGCGG + Intronic
935114299 2:100121245-100121267 CAGGCTCAACCAGCAGAGAGAGG + Intronic
936010720 2:108923705-108923727 TAAACACAGCCACCAGAGAGAGG - Intronic
936064853 2:109323117-109323139 CCAGCATATGCTCCAGAGAGAGG + Intronic
936820403 2:116512887-116512909 CAAGCACATCAATCAAAGAGAGG - Intergenic
937357713 2:121208825-121208847 CAAGTCCATCCACAATAGAGGGG + Intergenic
938659508 2:133471218-133471240 TAAGCACACCCACAAAAGAGGGG - Intronic
940058796 2:149541961-149541983 CAAGCACCTCTAGAAGAGAGGGG - Intergenic
940259680 2:151766809-151766831 CAAGGGCATCCACCAGAGATGGG - Intergenic
940507849 2:154578625-154578647 CATGCACATCCACCCAAGGGTGG - Intergenic
942051153 2:172142237-172142259 CATGCTCTTCCTCCAGAGAGCGG + Intergenic
948096982 2:235343354-235343376 CAAGCAGCTCCCCCAGGGAGAGG - Intergenic
1169406592 20:5326454-5326476 CAGGCAGAGCCCCCAGAGAGGGG - Intergenic
1170960438 20:21020554-21020576 CAGGCACGTCCAGGAGAGAGGGG - Intergenic
1171288580 20:23966134-23966156 CAAGCCCAACGAACAGAGAGAGG - Intergenic
1172479693 20:35263798-35263820 CATGCACAGCCACCAGGAAGAGG - Exonic
1173318783 20:41968984-41969006 GAAACACAGCCACCAGAAAGAGG + Intergenic
1173383836 20:42570357-42570379 CAACCAAATCCACCAGCCAGGGG + Intronic
1174562103 20:51438708-51438730 CATGCACACCCACCAGAGGTGGG - Intronic
1175374035 20:58512852-58512874 CAGACACAGCCACCAGAAAGGGG - Intronic
1177934785 21:27330870-27330892 CAAGAACCTCCAACAGTGAGAGG - Intergenic
1178121627 21:29475437-29475459 CACACACATGCACCAGAGAAAGG - Intronic
1179639341 21:42736876-42736898 AAAGCACATCCGCTGGAGAGTGG - Intronic
1184207718 22:43015396-43015418 CAAGGACCACCACCAGCGAGCGG - Intergenic
1184846388 22:47090383-47090405 CGAGCACATCCACCCTGGAGTGG - Intronic
1184940787 22:47763277-47763299 CAGCCACATACAGCAGAGAGGGG - Intergenic
1185377110 22:50487703-50487725 CATGCACACGCACCAGACAGTGG + Exonic
949911506 3:8913351-8913373 CAAACACAACCAGCAGAGAAAGG + Intronic
950206639 3:11085862-11085884 CACGCACATCCTCCAGAGGGTGG - Intergenic
951782247 3:26376857-26376879 CAACTACGTCCACCAGAGTGGGG + Intergenic
952146754 3:30541603-30541625 TCAGGACATCAACCAGAGAGGGG - Intergenic
953125695 3:40089724-40089746 CAGCAACATCCAACAGAGAGAGG - Intronic
956648743 3:71483377-71483399 CGAGCAGAAACACCAGAGAGCGG + Intronic
958823872 3:99007177-99007199 CAGTCACATCCCCTAGAGAGGGG - Intergenic
959019442 3:101172206-101172228 TCAGCACATCCACTAGAAAGCGG + Intergenic
961065311 3:123870179-123870201 CAACCACATCCCCCAGAAAAAGG + Intronic
962527199 3:136247535-136247557 CAAACACAGCCACCAGCGGGGGG + Intergenic
962924399 3:139978052-139978074 CAAACACAAGCACCAGAGAAAGG + Intronic
965561181 3:170063625-170063647 CCAGCTCTTCCACCGGAGAGAGG - Intronic
966891958 3:184413635-184413657 CTAGCACATCAAGCAGAGTGAGG - Intronic
968707840 4:2091347-2091369 AAAGCCCATCCACAAGAGAGCGG + Intronic
969465713 4:7355193-7355215 CAGGCACCAGCACCAGAGAGAGG + Intronic
970759973 4:19473289-19473311 CAGACACATGCTCCAGAGAGAGG + Intergenic
971475657 4:27069303-27069325 CAAGCAAAGCCACCATATAGGGG - Intergenic
972170167 4:36335934-36335956 CAGGCACCTACACCAGAAAGAGG - Intronic
976217244 4:82726962-82726984 CAAGCTCATCCTGCAGAGTGGGG + Intronic
977620662 4:99133386-99133408 CAAGCACATCAAAAAGAAAGAGG + Intronic
978015769 4:103744356-103744378 CAAGCCTAACCAACAGAGAGAGG + Intergenic
978930976 4:114311873-114311895 CCAGCCCATCCGCCAGTGAGTGG - Intergenic
979436085 4:120693026-120693048 GAAGGACCTACACCAGAGAGTGG - Exonic
979555945 4:122047715-122047737 CAAGCATAAGCCCCAGAGAGTGG - Intergenic
981935064 4:150230406-150230428 CAAACACAGCCCCCAGGGAGAGG + Intronic
983389395 4:167110019-167110041 CAAGCAAATACCCTAGAGAGAGG - Intronic
986175651 5:5349824-5349846 CCAGCACATCCACGAGGGAGAGG + Intergenic
989457279 5:41658629-41658651 CAAGCAGATCAACCATAGATGGG - Intergenic
990086189 5:51980898-51980920 CAAGAATATCCACAAGTGAGTGG - Intergenic
991187759 5:63830445-63830467 CAAGCACATCCACAGGAGTTAGG + Intergenic
992522536 5:77569954-77569976 CAAGCACATCCAGCAGATCCTGG + Intronic
994767101 5:103932381-103932403 CTCTCACATCCACCAGAGATTGG - Intergenic
995134528 5:108666651-108666673 CAAACAAATCCACCAAAAAGTGG - Intergenic
995617523 5:113982439-113982461 CTAGAACATCCACTAGAGAAAGG - Intergenic
998344000 5:141444695-141444717 CAAGCAAATTCAACAGAAAGAGG - Intronic
999671710 5:153964512-153964534 CCAGCACATCGACCAGACAAAGG - Intergenic
1000517273 5:162253510-162253532 CAGGGACATGCATCAGAGAGTGG - Intergenic
1000866296 5:166518841-166518863 CAGACACAGCCAGCAGAGAGAGG - Intergenic
1001829521 5:174773914-174773936 CAAGCCCATTCCCAAGAGAGAGG - Intergenic
1003520885 6:6857341-6857363 CAAGCACAGCCAGCAGAAAGGGG - Intergenic
1004187155 6:13430713-13430735 CCAGCACAGCCTCCAGACAGTGG + Intronic
1005427366 6:25716856-25716878 CAAGCAAATCCCCCCCAGAGGGG + Intergenic
1006827422 6:36946382-36946404 CAAGCACATGGAGGAGAGAGAGG - Intergenic
1010901115 6:81428765-81428787 CAAGAACATCCACCGGAGTAAGG - Intergenic
1013688861 6:112616590-112616612 CTAGGACATCCAGCAGAGTGGGG - Intergenic
1015637339 6:135290331-135290353 CAAGGACAAATACCAGAGAGAGG - Intronic
1015852301 6:137586982-137587004 GAAGCAAAAGCACCAGAGAGTGG - Intergenic
1016741182 6:147530632-147530654 TAAGCAGAACCACCAGTGAGAGG + Intronic
1017840528 6:158218590-158218612 CAAGCACATGAAACAGAGTGGGG - Intergenic
1018553329 6:165024155-165024177 CGATCACATCCCCCACAGAGTGG - Intergenic
1019147297 6:169983533-169983555 CAGGCACTGTCACCAGAGAGTGG - Intergenic
1022409762 7:30130147-30130169 CTAGCTCATCCTCTAGAGAGAGG - Intronic
1023998967 7:45178554-45178576 CAAGCAGTTCCCCCACAGAGTGG - Intronic
1025849327 7:65233071-65233093 CAGGCTCAGCCAGCAGAGAGAGG + Intergenic
1029196653 7:98810260-98810282 CAAACCCACCCCCCAGAGAGGGG + Intergenic
1030310352 7:108062901-108062923 CAAGGACATGCACCAGTGACAGG + Exonic
1031037986 7:116808781-116808803 AAAGGACATCCTCCATAGAGTGG + Intergenic
1032089964 7:128906589-128906611 CCAGCACATTCCCCAGAGAGGGG + Intronic
1035769960 8:2139096-2139118 CCAGCACCACCACCAGAGACCGG + Intronic
1036971061 8:13355526-13355548 TAAGAAGAGCCACCAGAGAGGGG - Intronic
1037808115 8:22069597-22069619 CGAGCATATACCCCAGAGAGTGG - Intronic
1038535141 8:28348397-28348419 CAAGCTAATCCCCTAGAGAGTGG + Exonic
1038564838 8:28611072-28611094 CAAGCACATGCAGCAAGGAGAGG - Intronic
1040810960 8:51452959-51452981 CACGCACACACACCAGAAAGGGG + Intronic
1041333017 8:56748892-56748914 CAATCACATCTACCAGATAGGGG - Intergenic
1042081557 8:65059748-65059770 CAGGCTCAGCCAGCAGAGAGGGG + Intergenic
1042823853 8:72960515-72960537 CCAGCACATCCATCATATAGTGG + Intergenic
1044109110 8:88249681-88249703 CAAACACCTCCTCCAGACAGTGG + Intronic
1044628077 8:94254072-94254094 GAAGCACCTCCCCCAGAGGGAGG - Intronic
1048207507 8:132427008-132427030 CAAACACATCAGCAAGAGAGTGG + Intronic
1049536531 8:143185166-143185188 CTATCACATCACCCAGAGAGAGG - Intergenic
1051786847 9:20754119-20754141 CAAGTACATCCAACTGAGAAAGG - Intronic
1053583910 9:39436370-39436392 CAGGCTCAGCCAGCAGAGAGAGG - Intergenic
1054105491 9:60995114-60995136 CAGGCTCAGCCAGCAGAGAGAGG - Intergenic
1055018785 9:71647087-71647109 CAAGCACATACATGATAGAGGGG + Intergenic
1055129468 9:72758324-72758346 CAAGTACATCAATAAGAGAGAGG + Intronic
1055240802 9:74183528-74183550 CAGGCTCAGCCAGCAGAGAGCGG - Intergenic
1057006856 9:91568413-91568435 CAGGCTCAGCCAGCAGAGAGAGG - Intronic
1058286151 9:103181521-103181543 CAAGCATATTCAACAGAGAATGG - Intergenic
1058453056 9:105114699-105114721 TGAGCACCTCCACCAGAGAGTGG - Intergenic
1060032686 9:120229039-120229061 CATGCACCACCACCAGAGACTGG + Intergenic
1060075557 9:120587706-120587728 CAAGCACATCCACCCAAAGGAGG + Intergenic
1187849149 X:23574282-23574304 AATGCACATCAACCAAAGAGTGG + Intergenic
1187941243 X:24384092-24384114 CAAGAACATACATCAGTGAGAGG - Intergenic
1189881663 X:45500074-45500096 CAAGAATAACTACCAGAGAGGGG - Intergenic
1192211229 X:69129132-69129154 CAAGCACAGACTCAAGAGAGAGG - Intergenic
1196191102 X:112795679-112795701 CAAGCACCTCCACCAAACACTGG - Intronic
1200303966 X:155006604-155006626 CAAACAGACACACCAGAGAGAGG + Intronic
1200317420 X:155148302-155148324 CAAACAGACACACCAGAGAGAGG - Intergenic
1200390581 X:155941907-155941929 CATGTAAATCCACCACAGAGAGG - Exonic
1201945018 Y:19502317-19502339 GAAGCAAAACTACCAGAGAGGGG + Intergenic