ID: 919987490

View in Genome Browser
Species Human (GRCh38)
Location 1:202686005-202686027
Sequence CACCAGAGAGAGGGTCCGCC CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 122
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 109}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
919987481_919987490 10 Left 919987481 1:202685972-202685994 CCAGGAAACCCCCAGGGTAGGGG 0: 1
1: 0
2: 2
3: 26
4: 240
Right 919987490 1:202686005-202686027 CACCAGAGAGAGGGTCCGCCCGG 0: 1
1: 0
2: 0
3: 12
4: 109
919987486_919987490 -1 Left 919987486 1:202685983-202686005 CCAGGGTAGGGGCAAGCACATCC 0: 1
1: 0
2: 1
3: 6
4: 125
Right 919987490 1:202686005-202686027 CACCAGAGAGAGGGTCCGCCCGG 0: 1
1: 0
2: 0
3: 12
4: 109
919987485_919987490 0 Left 919987485 1:202685982-202686004 CCCAGGGTAGGGGCAAGCACATC 0: 1
1: 0
2: 0
3: 12
4: 142
Right 919987490 1:202686005-202686027 CACCAGAGAGAGGGTCCGCCCGG 0: 1
1: 0
2: 0
3: 12
4: 109
919987474_919987490 30 Left 919987474 1:202685952-202685974 CCTGGGGAGGAGTGCTCCTGCCA 0: 1
1: 0
2: 3
3: 20
4: 301
Right 919987490 1:202686005-202686027 CACCAGAGAGAGGGTCCGCCCGG 0: 1
1: 0
2: 0
3: 12
4: 109
919987484_919987490 1 Left 919987484 1:202685981-202686003 CCCCAGGGTAGGGGCAAGCACAT 0: 1
1: 0
2: 1
3: 16
4: 151
Right 919987490 1:202686005-202686027 CACCAGAGAGAGGGTCCGCCCGG 0: 1
1: 0
2: 0
3: 12
4: 109
919987483_919987490 2 Left 919987483 1:202685980-202686002 CCCCCAGGGTAGGGGCAAGCACA 0: 1
1: 0
2: 1
3: 11
4: 172
Right 919987490 1:202686005-202686027 CACCAGAGAGAGGGTCCGCCCGG 0: 1
1: 0
2: 0
3: 12
4: 109
919987478_919987490 14 Left 919987478 1:202685968-202685990 CCTGCCAGGAAACCCCCAGGGTA 0: 1
1: 0
2: 2
3: 13
4: 141
Right 919987490 1:202686005-202686027 CACCAGAGAGAGGGTCCGCCCGG 0: 1
1: 0
2: 0
3: 12
4: 109

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
919987490 Original CRISPR CACCAGAGAGAGGGTCCGCC CGG Intronic
900539681 1:3196576-3196598 CACCAGAGAGGGGTTCAGCCAGG + Intronic
902801540 1:18833033-18833055 CACCAGACAGAGGAGCAGCCTGG - Intergenic
903202613 1:21754787-21754809 CACCTGAGAGAGTGTCCGGGAGG - Intronic
903494709 1:23757791-23757813 TTCCAGAGACAGGGTCGGCCGGG - Intronic
903735644 1:25528506-25528528 CACCAGGCAGATGGCCCGCCTGG + Intergenic
903789204 1:25881213-25881235 CACAGGAGAGAGAGTCCACCTGG + Intergenic
908561330 1:65309579-65309601 CACCGGAGAGAAGCTTCGCCGGG - Exonic
912720901 1:112019075-112019097 CACCAGATACAGGATCTGCCAGG + Intergenic
918184615 1:182115816-182115838 CCCCAGAGAGGGGGTCGCCCTGG - Intergenic
919987490 1:202686005-202686027 CACCAGAGAGAGGGTCCGCCCGG + Intronic
921408795 1:214812440-214812462 CACAAGTGAGTGGGTACGCCAGG - Intergenic
1062793613 10:325532-325554 CACCAGTGACAGGGACCCCCGGG - Intronic
1062932882 10:1364057-1364079 CGCCAGAGAGAGGGAGCCCCTGG + Intronic
1065686759 10:28293508-28293530 TGCCAGAGAGAGGGTCCCCTGGG + Intronic
1071258374 10:83895769-83895791 CAGCAGAGTGAGGGTTTGCCAGG - Intergenic
1075713382 10:124542583-124542605 GACCAGAGAGAGGGGCAGGCTGG + Intronic
1080600856 11:33819664-33819686 CACCAGCGAGAGGGTCATGCTGG - Intergenic
1083852991 11:65378736-65378758 AAGCAGGGAGAGGGTGCGCCCGG - Intronic
1090832407 11:130428449-130428471 CGCCAGCCAGAGGGGCCGCCGGG - Exonic
1091916417 12:4274012-4274034 CAGGAGGGAGAGGGGCCGCCGGG + Exonic
1096516746 12:52160314-52160336 CACCAGAGAGAGTTCCTGCCAGG - Intergenic
1096564017 12:52460921-52460943 TACCAGAGGGAGGGTCAGTCAGG + Intergenic
1097822866 12:64145337-64145359 CATCAGAGAGAGGAGCCGCTGGG - Exonic
1099581046 12:84447216-84447238 CCCCAAAGAGAGGGACCGACTGG - Intergenic
1101259636 12:103014890-103014912 CACCAGAGAAATGCTCTGCCGGG + Intergenic
1103678261 12:122673629-122673651 CATCAGATGGAGGGTGCGCCAGG + Intergenic
1103705485 12:122868997-122869019 CACCACAGAGGAGGTCCGCCTGG + Intronic
1104505398 12:129327280-129327302 CAACAGACAGTGGGTCCGCATGG + Intronic
1107792599 13:44017166-44017188 CCTCAGAGAGAGGGTGCTCCAGG - Intergenic
1108253363 13:48588588-48588610 CACAAGAGAGAGGATGCCCCTGG + Intergenic
1111378533 13:87413921-87413943 CACTTAAGGGAGGGTCCGCCAGG - Intergenic
1113776353 13:112947826-112947848 CACCACAGAGAGTCTCCACCAGG - Intronic
1114422352 14:22595188-22595210 CAAGACAGAGAGGGTCCCCCAGG + Intergenic
1119662112 14:76459547-76459569 CTGCAGAGAGAGGGTGGGCCTGG + Intronic
1121027651 14:90628352-90628374 CTCCAGAGAGAAGGTCCTCTAGG - Intronic
1122802285 14:104237738-104237760 TTCCAGAGAGAGGGTCCGGAGGG - Intergenic
1123112737 14:105880759-105880781 CACCAGGGCCAGGGTCCCCCAGG + Intergenic
1123133269 14:106005500-106005522 CACCAAAAAGAGGATCCTCCAGG + Intergenic
1123583293 15:21735913-21735935 CACCAAAAAGAGGATCCTCCAGG + Intergenic
1123619943 15:22178510-22178532 CACCAAAAAGAGGATCCTCCAGG + Intergenic
1125420241 15:39497726-39497748 AACCAGGGAGAAGGTCCCCCAGG + Intergenic
1128133481 15:65246090-65246112 AAGCAGGGAGAGGGTCTGCCTGG - Intronic
1129770054 15:78197426-78197448 AAACAGAGAGAGGGCCCGCATGG + Intronic
1129850491 15:78790974-78790996 GACCTGAGAGAGGGTCAGTCAGG + Intronic
1130016691 15:80193004-80193026 CACCAAAGAGAGGGGCACCCTGG - Intergenic
1130251773 15:82304548-82304570 GACCTGAGAGAGGGTCAGTCAGG - Intergenic
1132073692 15:98801438-98801460 ACCCAGAGAGAGGGGCAGCCTGG + Intronic
1132947598 16:2540500-2540522 CCCCTGAGGGAGGGTCTGCCGGG + Intronic
1132968143 16:2671123-2671145 CCCCCGAGGGAGGGTCTGCCGGG - Intergenic
1134275679 16:12774119-12774141 GACCAGAAAGTGAGTCCGCCAGG + Intronic
1138414860 16:56865834-56865856 CCTCAGAGAGAGGGCTCGCCGGG + Intronic
1142033588 16:87850497-87850519 CACCAGAGCGTGCATCCGCCGGG + Intronic
1142184967 16:88690524-88690546 CACCAGAGCGATGGTCAGGCAGG - Intergenic
1142189573 16:88711743-88711765 CACCAGAGGGAGGATCCGCAGGG - Intronic
1147643171 17:42017530-42017552 TACCAGAGAGAGGCTCCGCTTGG + Exonic
1152279399 17:79376409-79376431 CTGCAGAGAGAGGGTCCTGCGGG - Intronic
1157322413 18:46644884-46644906 CACCAGGGAGAAGATCCACCAGG + Intronic
1157511565 18:48279133-48279155 CACCATGGAGACGGTCCCCCCGG + Intronic
1160610149 18:80078209-80078231 GACCAGCGAGAGGGGCCCCCAGG - Intronic
1160860924 19:1236988-1237010 CACCAGGGAAAGGAGCCGCCTGG + Intronic
1162183068 19:8883746-8883768 CACTACAGAGAGGGTCCTTCAGG - Exonic
1162183491 19:8886741-8886763 CACCACGGAGAGGGTCCTTCAGG - Exonic
1162184340 19:8892895-8892917 CACCACGGAGAGGGTCCTTCAGG - Exonic
1162185155 19:8898917-8898939 CACCACAGAGAGGGTCCTGCAGG - Exonic
1162186681 19:8910383-8910405 CACCACAGAGAGGGTCCTGCAGG - Exonic
1165018390 19:32901598-32901620 CACCGGAGAGAGGGTGTGGCTGG + Intronic
1166944937 19:46390707-46390729 CCCCAGAGAGAGGGTCAGCAGGG + Exonic
1167019082 19:46861056-46861078 CCCGCGAGGGAGGGTCCGCCCGG + Intergenic
937167163 2:119830755-119830777 CAGGAGAGAGAGGGTGAGCCAGG - Intronic
939110296 2:137998665-137998687 CCCCAGGGAGAGGGACTGCCTGG + Intronic
941820596 2:169840597-169840619 CACCAGAGAGAGTCTCCACAAGG - Intronic
948336364 2:237210536-237210558 AACCAGAGAGAGGGTCATGCTGG - Intergenic
948502886 2:238407849-238407871 AACCAGAGCCAGGGTCCGCCTGG - Intergenic
1170564167 20:17586055-17586077 CGCCCGAGAGAGGGTCTCCCTGG + Intronic
1170617743 20:17968219-17968241 GACCAGGGAGAGGGGCCGCCCGG + Intronic
1172229343 20:33326529-33326551 CCCCAGAGAGAGGGTTACCCAGG + Intergenic
1172886016 20:38231288-38231310 CACCAGAAGCAGGGGCCGCCCGG + Exonic
1181105639 22:20573444-20573466 AAAAAGAGAGAGGGTCCTCCAGG - Intronic
1181109194 22:20591451-20591473 GAGCAGAAAGAGGGCCCGCCAGG - Intergenic
1183474074 22:38026395-38026417 ACCCAGAGAGATGGTCTGCCTGG - Intronic
1184781933 22:46654009-46654031 CCCCAAAGGGAGCGTCCGCCTGG - Intronic
950414965 3:12863918-12863940 CCCCAGAGAGAGGGTCCCTGTGG + Intronic
950416711 3:12873058-12873080 CCCCAGAGAGAGGGTCCCTGTGG + Intergenic
950586170 3:13894211-13894233 CTCCAGAGAGAGGGTCTGATTGG - Intergenic
961244114 3:125436673-125436695 CACCAGAGTTAGGGACCTCCAGG - Intergenic
961513352 3:127418024-127418046 CTCCCCAGAGAGGGTCCGTCTGG - Intergenic
961713294 3:128843112-128843134 CCCCAGAGAGAGGGTCCCTGTGG - Intergenic
966911388 3:184562147-184562169 CACCCGAGAGAGGGTGCGCTCGG - Exonic
968619142 4:1595880-1595902 CACCACAGAGAGGATCAGACTGG - Intergenic
968666831 4:1827061-1827083 AACCAGAGCGAGGGTCGGCATGG - Intronic
968705048 4:2073800-2073822 CAGCAGAGCGAGGGTCTCCCTGG + Intronic
968736604 4:2300528-2300550 CTCCAGAGAGGGGCTCCTCCTGG + Intronic
969618460 4:8267152-8267174 CTCCAGATACAGGCTCCGCCAGG - Intergenic
970372056 4:15418024-15418046 GACCAGAGAGAAGGTTCGTCAGG + Intronic
970546184 4:17132813-17132835 CAGAAGAGAGAGGAGCCGCCAGG - Intergenic
971478891 4:27097081-27097103 CAGCAGAGAGAAGGTCTGCAGGG + Intergenic
977917237 4:102607704-102607726 CAGCTGGGAGAGGGTCCACCAGG + Exonic
985615400 5:917019-917041 CACCATAGAGGGGTTCCTCCAGG + Exonic
985714318 5:1446785-1446807 CACCAGACACAGAGTCGGCCAGG - Intergenic
985924422 5:3004735-3004757 CACAAGAGAGAGGGTGGGCAAGG - Intergenic
988496578 5:31750753-31750775 CACCAGTGAGAGGGGCTGCCGGG + Intronic
989956381 5:50365864-50365886 CAGCAGAGAGAGAGATCGCCTGG + Intergenic
999261355 5:150240864-150240886 CAGCAGGGAGAGGGGCCTCCTGG - Intronic
999323923 5:150631475-150631497 CACTAGAAAGAGGGTCAGCATGG + Intronic
1003212355 6:4079157-4079179 TACCAGAGAGCGGGGGCGCCCGG + Exonic
1014678952 6:124404302-124404324 CAAAAGAGAGAGGGTTCACCAGG + Intronic
1017821914 6:158055094-158055116 CACAAGGGAGAGGGTGCGACGGG + Intronic
1019448609 7:1084344-1084366 CATCAGAGAATGTGTCCGCCTGG + Intronic
1025813547 7:64889911-64889933 CACCAGATAGAGGGTCCTGGAGG - Intronic
1029605736 7:101598529-101598551 CACCTGAAAGTGGGCCCGCCCGG - Intergenic
1034520570 7:151616214-151616236 CACCAGAGAGAGGCTCTGCTTGG + Intronic
1034974703 7:155441217-155441239 CACCAGAGAAAGGGGCATCCGGG + Intergenic
1035523442 8:293290-293312 CACCACAGAAAGGGTCAGCAAGG - Intergenic
1048299179 8:133238946-133238968 CACCAGCGAGGGGGCCCACCTGG - Exonic
1049287045 8:141781514-141781536 CACCCGAGAGAGGCTCGGCAGGG + Intergenic
1049693054 8:143971167-143971189 CACCGGAGTGAGGGTCAGACAGG + Intronic
1050430159 9:5554004-5554026 CCCCAGAGAGAGGGTGGGCTTGG - Intronic
1053428426 9:38026255-38026277 CACGAGAGAGAGGGTGCACTTGG - Intronic
1057991831 9:99778484-99778506 CAGCAGAGAGATGGTTCTCCTGG - Intergenic
1061482523 9:130903949-130903971 TACTGGAGAGTGGGTCCGCCAGG + Exonic
1062391961 9:136337437-136337459 CACCAGGGACAGGTTCCTCCTGG - Exonic
1186499408 X:10039175-10039197 CAGGAGAGAGAGGGTCCCCAGGG + Intronic