ID: 919988269

View in Genome Browser
Species Human (GRCh38)
Location 1:202690986-202691008
Sequence GTGAGTAGGACGAGAACTGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 172
Summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 154}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
919988269 Original CRISPR GTGAGTAGGACGAGAACTGG AGG (reversed) Intronic
901922710 1:12548194-12548216 GAGAGCAGGACGAGACCTGGCGG - Intergenic
902686338 1:18080052-18080074 AGGAGTGGGAGGAGAACTGGGGG - Intergenic
903025546 1:20427591-20427613 GTGACTACGAAGAGAACAGGGGG - Intergenic
903076755 1:20775228-20775250 TTGAGTGGGACAAGATCTGGAGG + Intronic
904452930 1:30628116-30628138 GTGGGTAGGGCAAGAGCTGGTGG - Intergenic
906460076 1:46030202-46030224 GAGAGCAGGAAGAGAACTGGCGG - Exonic
907644024 1:56223104-56223126 GAGAGTGGAACTAGAACTGGTGG - Intergenic
910792908 1:91069572-91069594 GTGTTTAGGGAGAGAACTGGTGG - Intergenic
915030568 1:152877327-152877349 GGGAGTAGGAAGAGAACCAGGGG + Intergenic
915141574 1:153771528-153771550 GGGAGGAGGAGGAGAACTGAGGG + Intronic
916278796 1:163025211-163025233 GTGTCTAGGAAGAGACCTGGGGG + Intergenic
919802749 1:201363368-201363390 GAGAGGAGGAGGAGAACAGGAGG - Exonic
919988269 1:202690986-202691008 GTGAGTAGGACGAGAACTGGAGG - Intronic
920271883 1:204771452-204771474 GTGACTAGGAGGAGACCCGGGGG - Intergenic
921308985 1:213824406-213824428 GTGAGGGGGTTGAGAACTGGGGG - Intergenic
922049681 1:221977544-221977566 GGGAGTAGGAGGAGGAATGGAGG + Intergenic
922154215 1:223028845-223028867 GGGAGTAGGAGGAGGAATGGAGG + Intergenic
923102282 1:230826221-230826243 CTGAGTAGAACGAGAGCTGGAGG + Intergenic
1062903805 10:1166288-1166310 GGGTGCAGGACGAGCACTGGGGG + Intergenic
1064772502 10:18738022-18738044 CTGAGTTGGCCGAGAACTGGTGG + Intergenic
1066747035 10:38610995-38611017 GTCAGTAGGACATGGACTGGTGG - Intergenic
1067116065 10:43436622-43436644 GTTAGGAGAACGAGAACTGCGGG - Intergenic
1068128295 10:52867694-52867716 GTGAGTATCACGAGATCTGATGG + Intergenic
1068332715 10:55592317-55592339 GAGAGAAGAACAAGAACTGGAGG + Intronic
1068875111 10:61987269-61987291 GGGAGTAGGATGAGAACAGAGGG + Intronic
1070982451 10:80660402-80660424 GTGGGTAGGACAAGAAGAGGAGG - Intergenic
1071662499 10:87518819-87518841 ATGAGTAGGGCGAGATATGGGGG + Intronic
1071814451 10:89218646-89218668 GTGAGTTGGAAGAGACATGGAGG + Intronic
1074370798 10:112899300-112899322 GTGGTTAGGGAGAGAACTGGGGG - Intergenic
1074618532 10:115093637-115093659 GTGAGGAGGAGGAGAAGCGGCGG + Exonic
1075455450 10:122582065-122582087 GTGCTCAGGACGAGCACTGGAGG + Intronic
1075457573 10:122594768-122594790 GTGCTCAGGACGAGCACTGGAGG + Intronic
1077451642 11:2651910-2651932 GTGAGTAGGAGGAGAGCAAGCGG - Intronic
1078658320 11:13263184-13263206 GTGAGTAGAAGCAGATCTGGAGG - Intergenic
1080587759 11:33696967-33696989 GTGAGAAGGAGGAGCACAGGTGG - Intergenic
1085147172 11:74211959-74211981 GTGGGGAGGACGACAAGTGGAGG - Intronic
1086794683 11:91084942-91084964 GTGAGTCTCACGAGATCTGGTGG + Intergenic
1087083874 11:94197352-94197374 GTAAGTCTCACGAGAACTGGTGG + Intergenic
1089763374 11:120745134-120745156 GTGACCAGGATGAAAACTGGAGG - Intronic
1090375010 11:126282557-126282579 GTGTCTGGGACGGGAACTGGCGG + Intergenic
1095492813 12:42753023-42753045 GTGAGTATCACGAGATCTGACGG + Intergenic
1095587014 12:43860704-43860726 GAGAGTAGGAGGAGAAGTGGAGG + Intronic
1096841226 12:54380084-54380106 GTGAGTGGGAGGAGAACGAGGGG + Intronic
1100477737 12:94949462-94949484 GGGAGTAAGAAGAGAATTGGGGG + Intronic
1104328730 12:127824585-127824607 GTGAGGAGGAAGAGAAGTGCTGG - Intergenic
1105623449 13:22090673-22090695 GTGAGCAGGAGAAGAACAGGTGG + Intergenic
1109994921 13:70110538-70110560 GTGAGAAGGACGAGAAGAGAAGG + Intergenic
1111458984 13:88517251-88517273 GGGAGTAGGAGGAGGAATGGAGG + Intergenic
1111679390 13:91425397-91425419 GTGTTTAGGAAGAGACCTGGTGG + Intronic
1113446437 13:110371855-110371877 ATCAGTAGGATAAGAACTGGGGG - Intronic
1116815140 14:49576766-49576788 GTAAGTATCACGAGAACTGATGG + Exonic
1119060555 14:71469907-71469929 GTGAGTGGGATGGGAACTGAAGG + Intronic
1119554558 14:75543097-75543119 GTTGGTAAGACGGGAACTGGGGG - Intronic
1120389269 14:83885147-83885169 GTGAACAGCATGAGAACTGGAGG + Intergenic
1121600934 14:95202585-95202607 GTGAGTAGGGCCAGGACTGGGGG + Intronic
1122106492 14:99460833-99460855 GTGAGTGGGTGGAGGACTGGCGG - Intronic
1125361829 15:38872832-38872854 GTGAGGAGGAGGACCACTGGAGG + Intergenic
1126844454 15:52745960-52745982 GTGTGTAGGGAGAGAGCTGGTGG + Intergenic
1128126207 15:65194885-65194907 GTGAGTTTGAAGTGAACTGGTGG + Exonic
1129109724 15:73330350-73330372 GGTAGTGGGAGGAGAACTGGTGG - Intronic
1130017222 15:80196869-80196891 CTCAGTAGGAAGAGAGCTGGGGG - Intergenic
1130887780 15:88108474-88108496 GTGAGGAGGATGGGAACTAGTGG - Intronic
1134211973 16:12285184-12285206 GTGAGTGGAAGGAGAACTGAAGG - Intronic
1135617454 16:23924075-23924097 GTGTCTAGGGAGAGAACTGGTGG + Intronic
1135858930 16:26037483-26037505 GGGAGTAGGAAGAGAAGTGGAGG + Intronic
1140880818 16:79196648-79196670 GTGTACAGGATGAGAACTGGAGG - Intronic
1140959076 16:79895436-79895458 GTGAGTGGAAGGAGAACTTGGGG - Intergenic
1143906865 17:10216187-10216209 GGGAGTAGGACCAGCACAGGAGG + Intergenic
1144152441 17:12462909-12462931 GTGATTAGGAGAAGAGCTGGGGG + Intergenic
1145843077 17:28012817-28012839 GTGGGAAAGAAGAGAACTGGTGG - Intergenic
1146673857 17:34759741-34759763 GGGAGAAGGAGGAGGACTGGGGG - Intergenic
1147976810 17:44252718-44252740 CTGAGCTGGAAGAGAACTGGGGG + Intronic
1148274479 17:46291369-46291391 GTGAGCAGGACTAAAACTGCAGG + Intronic
1148477008 17:47935321-47935343 GTGAGTGGGAGGAGGCCTGGTGG - Intergenic
1148611908 17:48970275-48970297 GAGAGGAGGAGGAGAGCTGGAGG + Intergenic
1148713094 17:49696171-49696193 GTGAATATGAAGAGAACTGTGGG + Intergenic
1150408576 17:64923186-64923208 GTGAGCAGGACTAAAACTGCAGG - Intergenic
1150760211 17:67954589-67954611 GTGAGCAGGACTAAAACTGCAGG - Intronic
1152205291 17:78971448-78971470 GTGAGTAGGGCGACATCTGGTGG + Exonic
1153008012 18:514371-514393 GTGAGCAGGGAGAGAGCTGGCGG - Intergenic
1153711215 18:7801398-7801420 GTGAGTGGGACAAGATGTGGAGG - Intronic
1154132721 18:11750771-11750793 GTGGGCAGGAGGAAAACTGGTGG + Intronic
1156244993 18:35289621-35289643 GTGAGAAGGACCCGAAATGGAGG - Intronic
1157358966 18:46961300-46961322 GTGGGTAGCAGGAGAAGTGGTGG + Intronic
1161225410 19:3142541-3142563 GAGAGTTGGAAGACAACTGGGGG + Intronic
1162757040 19:12866726-12866748 GAGAGCAGGAAGAGAACTGGCGG - Exonic
1162934236 19:13973155-13973177 GTCAGGGGGATGAGAACTGGGGG + Intronic
1163581073 19:18139088-18139110 GGGAGCAGGAGGAGAACTGGGGG - Exonic
1164863032 19:31578074-31578096 GTGAGTATCACGAGATCTGATGG + Intergenic
927458315 2:23276358-23276380 GTGAGTGGCACAAGCACTGGGGG - Intergenic
931286496 2:60836168-60836190 GTGACTTGAACGAAAACTGGTGG - Intergenic
932162775 2:69477393-69477415 GGGAGGAGGAAGAGAATTGGTGG + Intronic
933586470 2:84185069-84185091 GTGATTAGGAAGAAATCTGGTGG - Intergenic
936866630 2:117082102-117082124 GTGTCTAGGGAGAGAACTGGTGG - Intergenic
943593498 2:189827849-189827871 GGGAGAAGGAGGAAAACTGGAGG + Intronic
947680022 2:232022068-232022090 GTGAGTAAGACGAGATCTGTGGG + Intronic
947814936 2:233030474-233030496 GTGAGTGTGACCAGAACTGGTGG - Intergenic
948455507 2:238102732-238102754 GTAAGCAGGGCGAGGACTGGAGG - Intronic
1169595508 20:7194028-7194050 GTGAATAGAGCCAGAACTGGAGG + Intergenic
1173790766 20:45826543-45826565 GGGAGAAGGAGGAGCACTGGTGG - Intronic
1175691298 20:61067719-61067741 GTGAGCAGCAGTAGAACTGGGGG - Intergenic
1177306293 21:19321205-19321227 GTGAGAGGGAGGAGAACAGGAGG - Intergenic
1177470811 21:21559219-21559241 GTGAGTCTCACGAGATCTGGTGG + Intergenic
1178847811 21:36187956-36187978 TTGAGTAGGAGTAGAACTGAAGG - Intronic
1180871893 22:19150919-19150941 GTGAGGAGACGGAGAACTGGGGG - Intergenic
1181781247 22:25195172-25195194 GTGAGGAGGAAGAGAAATGAGGG - Exonic
1183744395 22:39684786-39684808 GAGAGGAGGAGGAGTACTGGAGG + Intronic
1184093334 22:42303766-42303788 GGGAGGAGGAAGAGGACTGGGGG + Intronic
953242430 3:41161524-41161546 ATGAGTAGGAAAAGAACTGGAGG + Intergenic
960480392 3:118180811-118180833 GTGAGTAGAAGGAGAAAAGGAGG - Intergenic
961543442 3:127616344-127616366 GGGACTAGGAAGAGAAGTGGGGG - Intronic
963076194 3:141348617-141348639 TTGAGTAAGACGAGAAAAGGAGG - Intronic
971699252 4:29948137-29948159 GTGTGGAGGAAGGGAACTGGTGG + Intergenic
973610969 4:52635749-52635771 GTGAGGAGGAGGGTAACTGGAGG - Intronic
975809574 4:78152905-78152927 CTGAGTAGGACGAGGGCTGATGG - Intronic
975934035 4:79558421-79558443 GGGAGTAGGAGGAGGAATGGAGG + Intergenic
976068076 4:81212879-81212901 GTGAGTAGGAGGAACACTGCAGG + Intronic
976551710 4:86403726-86403748 GTGAGTATCACGAGATCTGATGG - Intronic
981913566 4:150009834-150009856 CAGAGAAGGAAGAGAACTGGAGG - Intergenic
986193396 5:5516840-5516862 GGGAGAAGGAGGAGAAATGGAGG - Intergenic
986520222 5:8607787-8607809 GTGAGTGTGACTAGAACTGCAGG + Intergenic
988099144 5:26656116-26656138 GTGTCTGGGAAGAGAACTGGTGG - Intergenic
991057283 5:62334493-62334515 GGGAGGAGGAGGAGAAGTGGGGG - Intronic
992941224 5:81764324-81764346 GTGAGTAGCATGGGATCTGGAGG - Intergenic
998402517 5:141855303-141855325 GTGTGTAAGAAGAGCACTGGGGG - Intronic
998762251 5:145445347-145445369 TTGAATAGGATGAGAAGTGGGGG - Intergenic
999549568 5:152671280-152671302 GTGAGTGGGAGGAGAAATGATGG + Intergenic
999868671 5:155728434-155728456 GGGAGGAGGACTAGAACAGGAGG + Intergenic
1002991290 6:2241417-2241439 GTGAGAAGGATGAGATCTGGGGG + Intronic
1003778742 6:9398893-9398915 GTGGGGAGGCTGAGAACTGGCGG + Intergenic
1005852794 6:29834880-29834902 GTCAGTAGGACCAGAGCTGAAGG + Intergenic
1005943522 6:30579169-30579191 GTGAGTGGCACTAGCACTGGAGG - Intronic
1007385364 6:41516837-41516859 GGGAGTAGGGCCAGAACTGGAGG + Intergenic
1007590541 6:43018122-43018144 CTGAGTAGGAAGAGAAAAGGAGG - Intronic
1008411053 6:51180220-51180242 GTGAGTCTGACGAGATCTGATGG + Intergenic
1010036299 6:71329315-71329337 GGGATGAGGACGAGAACTTGTGG + Intergenic
1012315678 6:97780863-97780885 GGGAGTAGGAGGAGGAATGGAGG - Intergenic
1013232332 6:108169442-108169464 GTGAGTGGGAGGAGCAGTGGTGG - Intronic
1014555699 6:122841106-122841128 GGGAGTAGGAGGAGGAATGGAGG - Intergenic
1014701482 6:124694254-124694276 GTGAGTAGGAATAGTACTTGAGG + Intronic
1015129386 6:129792748-129792770 ATGAGAAGGAGGAGTACTGGAGG + Intergenic
1015350616 6:132213822-132213844 CTGAGTAGGAGGGGAACAGGAGG + Intergenic
1018776738 6:167024063-167024085 GGGAGTGAGAGGAGAACTGGAGG + Intronic
1019506353 7:1393419-1393441 CTGAGTCTGAAGAGAACTGGGGG + Intergenic
1019526370 7:1482229-1482251 GAGAGGAGGAGGAGAAGTGGTGG - Intronic
1021936547 7:25637254-25637276 GTGGGTGGGACGAGAACAGTTGG + Intergenic
1026614291 7:71887807-71887829 GTGAGAAGGAGGAGAGCAGGTGG + Intronic
1028653187 7:93173394-93173416 GTGTTTAGGAAGAGAGCTGGTGG + Intergenic
1028914286 7:96241864-96241886 GAGAGGAGGAGAAGAACTGGAGG - Intronic
1034601156 7:152257658-152257680 TGGAGAAGGACAAGAACTGGAGG + Intronic
1039327631 8:36502698-36502720 TTGATTAGAACTAGAACTGGAGG - Intergenic
1039360980 8:36876634-36876656 GGGAGGAGGAGGAGAACTTGAGG - Intronic
1039720354 8:40157701-40157723 GGGAGTAGCAGGAGAATTGGAGG + Intergenic
1041009304 8:53525640-53525662 GAGAGCAGCAGGAGAACTGGTGG + Intergenic
1041643989 8:60232616-60232638 ATGAGGAGGAAGACAACTGGAGG + Intronic
1043886751 8:85609750-85609772 TTGAGTAGGACGGGAGCTGAAGG + Intergenic
1045800455 8:106095549-106095571 GTGAGTGGGATGAGAAGAGGTGG - Intergenic
1047331325 8:123890348-123890370 CTGAGTAGGAGAAAAACTGGGGG + Intronic
1047806632 8:128367754-128367776 GTGAATAGGACAAGGACAGGAGG + Intergenic
1052955616 9:34251300-34251322 GTGTGTGGGACGGGGACTGGGGG - Intronic
1055866600 9:80821706-80821728 GTGAGTGGGATGAGAAATGCTGG - Intergenic
1056386575 9:86101801-86101823 GTGAGAAGGATATGAACTGGGGG - Intergenic
1056522296 9:87412193-87412215 GGGAGTAGGAGGAGGAATGGAGG - Intergenic
1057501958 9:95603152-95603174 GAGACTAGGTGGAGAACTGGAGG - Intergenic
1060462222 9:123867713-123867735 GGGAGCAGGGGGAGAACTGGGGG - Intronic
1061778835 9:132984208-132984230 GTGAGCAGGAGGAGGACTGGGGG - Intronic
1185661904 X:1735138-1735160 GGGAGGAGGAGGAGAAGTGGAGG - Intergenic
1186663087 X:11689026-11689048 CTGAGTAGGCTGAAAACTGGAGG - Intergenic
1187450607 X:19392949-19392971 GTGACAAGGACTAGGACTGGAGG + Intronic
1192315090 X:70044833-70044855 GAGAGGAGGACGTGAATTGGAGG - Intronic
1193749813 X:85327476-85327498 GTGAGTAGAAAGAGAACTGAAGG + Intronic
1199160411 X:144603535-144603557 GTGTTTAGGAAGAGACCTGGTGG + Intergenic