ID: 919988774

View in Genome Browser
Species Human (GRCh38)
Location 1:202694346-202694368
Sequence CTTTTTCCCTTCAATATTGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 439
Summary {0: 1, 1: 0, 2: 6, 3: 28, 4: 404}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
919988770_919988774 26 Left 919988770 1:202694297-202694319 CCTGCTGAAAGAATCTAGAAGCT 0: 1
1: 0
2: 0
3: 11
4: 162
Right 919988774 1:202694346-202694368 CTTTTTCCCTTCAATATTGAGGG 0: 1
1: 0
2: 6
3: 28
4: 404

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
919988774 Original CRISPR CTTTTTCCCTTCAATATTGA GGG Intronic
901004271 1:6164277-6164299 CTTTTCCCTCTCAATCTTGAAGG - Intronic
902971622 1:20056795-20056817 ATTTTTTCCTTAAATATTGGTGG + Intronic
905260606 1:36715571-36715593 CTTTTTTCCTTCAATATGAAGGG + Intergenic
905787106 1:40767159-40767181 CTCGTGCCCTACAATATTGATGG + Intronic
906067510 1:42992626-42992648 CTCTGTCTCTTCAATTTTGAGGG + Intergenic
908168722 1:61484013-61484035 CGCTTTCTCTGCAATATTGAGGG + Intergenic
908957337 1:69649328-69649350 TTTTTTTCCCTCAATTTTGAAGG + Intronic
908957339 1:69649335-69649357 TTCTCTCCCTTCAAAATTGAGGG - Intronic
909658083 1:78053131-78053153 CTTTTTCTACTCAATTTTGACGG - Intronic
909769933 1:79408962-79408984 ATTTTTCCCTTGAAGAATGAAGG + Intergenic
911380512 1:97107904-97107926 CATTTTCCCTTCAAAATTTGTGG - Intronic
911391138 1:97245387-97245409 CTTTTTGCCTACAATTTTAAAGG + Intronic
911752930 1:101519328-101519350 TTTTTTCCCTTCCAGATTGAAGG + Intergenic
912442013 1:109706309-109706331 CTTTTTTCCTTTAATATGTATGG - Intronic
913520856 1:119644970-119644992 CTGTTTCCATTCAATTATGAAGG - Intronic
914003711 1:143714808-143714830 CAGTTTCCCTTCTATATTAATGG - Intergenic
914828863 1:151156222-151156244 CTTCCTCCCTTCAGTATTAAGGG + Intergenic
916150722 1:161786314-161786336 CTTTTTCTCTTTAATATTTTAGG + Intronic
916176835 1:162048038-162048060 CTTTTTCCCCTCAAGATAGGTGG + Intergenic
916340399 1:163727206-163727228 CTTTTTTCCTGCAATGTTTATGG - Intergenic
916601734 1:166299707-166299729 CTTATTCCTTTGAATATTCATGG - Intergenic
917596648 1:176535921-176535943 CTTTGTGCCTTCGATTTTGATGG + Intronic
917824180 1:178799523-178799545 CCTTTTCCCTTCAAGACTCAGGG - Intronic
919466879 1:197931393-197931415 CTATTTCCCCTAAATATTTATGG + Exonic
919475340 1:198025912-198025934 CTTTTTCATTTCTATATTGCTGG + Intergenic
919988774 1:202694346-202694368 CTTTTTCCCTTCAATATTGAGGG + Intronic
922397932 1:225222174-225222196 CTCTTTACCTTCATTTTTGAGGG - Intronic
923359367 1:233194303-233194325 CATTTTGCCTTCACTTTTGAAGG - Intronic
924013994 1:239700007-239700029 CTTTTTTCCTTCCAGAGTGATGG - Intronic
924690884 1:246348997-246349019 TATTTTCCCTTCACTTTTGAAGG - Intronic
924793798 1:247277559-247277581 CATTCTCCCTTTAATGTTGAAGG + Intergenic
924793801 1:247277566-247277588 CTCTATCCCTTCAACATTAAAGG - Intergenic
924814927 1:247433247-247433269 GCTTTTCCTTTCAATATAGATGG + Intronic
1063545681 10:6979146-6979168 CTTTTTGGCTCCATTATTGATGG + Intergenic
1063990475 10:11555913-11555935 ATTTTTGCCTTCAGTTTTGAAGG - Intronic
1064540041 10:16396003-16396025 ATTTTTGCCTTTTATATTGAAGG + Intergenic
1065825811 10:29570064-29570086 CTTTTGCTCTTTAATATTTAGGG + Intronic
1066679772 10:37926504-37926526 TTTTTTCCCATCAACATTGTAGG + Intergenic
1068068668 10:52167772-52167794 CCTTTAGCCTTCAATACTGAAGG - Intronic
1068861555 10:61853116-61853138 ATTTTTCCCTCCTATGTTGAAGG - Intergenic
1069005704 10:63315511-63315533 TTTTTTCTCTTCACTTTTGAAGG + Intronic
1069131010 10:64702610-64702632 TTTTTTTCCTTCAATTTTTACGG - Intergenic
1069133457 10:64734227-64734249 CTTTTGTCCTCCAATATGGAGGG - Intergenic
1069577167 10:69538988-69539010 CCCAGTCCCTTCAATATTGAAGG - Intergenic
1069669445 10:70189429-70189451 CATTTTTCCTTCAAAATTCATGG + Intergenic
1070210158 10:74309694-74309716 CTTTTTCTTTTCAAGAGTGATGG - Intronic
1070304447 10:75231676-75231698 CTTTTTCCTTTCAATGATGCAGG - Intergenic
1070315036 10:75302096-75302118 TTATTTCCCTTCCATGTTGAAGG + Intergenic
1072341948 10:94460347-94460369 TTTTTTTCCTTCACTTTTGAAGG + Intronic
1074171458 10:110942787-110942809 CATTTTACCTTCATTTTTGAAGG + Intronic
1074734941 10:116420961-116420983 TTTATTGACTTCAATATTGACGG - Intergenic
1075733949 10:124652764-124652786 CTTGCTACCTTCCATATTGAAGG - Intronic
1076088579 10:127658402-127658424 GCTGTTCCCCTCAATATTGATGG + Intergenic
1076198913 10:128542160-128542182 CTTTTTTCCTTGAACATTTAAGG - Intergenic
1076234292 10:128851748-128851770 CTTTCTCCCTTCAGAAATGAGGG - Intergenic
1076332949 10:129684605-129684627 CTTTTTCCTTTCAATGCTGTTGG - Intronic
1078178800 11:8992422-8992444 CTTTTTTCCTTCATTATGGTAGG - Intronic
1078989464 11:16632256-16632278 CTTTTTCCCTACATTACTGGGGG + Intronic
1079113307 11:17620475-17620497 GTTTATCCATTCATTATTGATGG + Intronic
1079648697 11:22899073-22899095 CTTTTTCCCTAATATTTTGAAGG - Intergenic
1080166637 11:29244943-29244965 CTCTGTCCCTCCAATTTTGAGGG - Intergenic
1080763169 11:35272256-35272278 CTCCTTCCCTTCTGTATTGATGG - Intronic
1080939923 11:36904458-36904480 TCTTTTGCCTTCATTATTGAAGG + Intergenic
1081095537 11:38929338-38929360 CTGTTTCCATACAATATTTAAGG - Intergenic
1081815335 11:45936362-45936384 CTTTTGCCCTTAACTATTGGAGG - Intronic
1082959913 11:58908474-58908496 CTTGTTCCCTTCAGTCTTCATGG - Intronic
1083131376 11:60626146-60626168 CTTTATCCATTCATCATTGATGG - Intergenic
1083720587 11:64601734-64601756 CTTTTCCCCTTCAGTATTGAAGG - Exonic
1084092563 11:66888266-66888288 CGTTTTCCCTCCAAAATTGGAGG - Intronic
1084346866 11:68558161-68558183 CGTTTTCCCTTCTTTAGTGAGGG + Intronic
1085140772 11:74139640-74139662 CTCTTTTCCATCAATTTTGATGG + Exonic
1086348132 11:85918728-85918750 TTTTCTCCTTTAAATATTGAAGG - Intronic
1086616601 11:88829064-88829086 GTTTTTCTCTTAAATATTGTTGG - Intronic
1086940167 11:92788860-92788882 CTATTTCCCTGCAATTTTTATGG - Intronic
1088583284 11:111335447-111335469 TGTTTTCCCTTGAATATTCAGGG - Intergenic
1088779065 11:113116327-113116349 CTCTTTCCCTTCTATAATGAAGG - Intronic
1089165500 11:116472999-116473021 CTTTGGACCTTCATTATTGAAGG + Intergenic
1090183334 11:124719497-124719519 CTTTTTCCTTTCTAAATTAAGGG - Intergenic
1091961483 12:4698805-4698827 TTTTCTCCTTTAAATATTGAAGG + Intronic
1092010567 12:5107580-5107602 CTTTTTTCCCCCAATATTTATGG - Intergenic
1092785984 12:12027307-12027329 CATTTTGCCTTCATTTTTGAAGG - Intergenic
1093527735 12:20122266-20122288 CCTTTTCCGTTCAATATTATGGG + Intergenic
1093532049 12:20177177-20177199 TTTTTTTCCCTCAACATTGATGG + Intergenic
1093942429 12:25069077-25069099 AAATTTCCCTTCTATATTGAGGG + Intronic
1094715425 12:33009821-33009843 CTTTTCCCCTTTTATATTTATGG + Intergenic
1096898224 12:54846527-54846549 CTTTTTCCCACTAATGTTGAAGG - Intronic
1096900498 12:54874591-54874613 CTTCTTCTCTTCAATATTTTAGG - Intergenic
1097606719 12:61764047-61764069 CTTTTTCCTTTTAAAAATGAAGG - Intronic
1097820573 12:64124696-64124718 CTGTTTGCCTTCAATATTTGTGG + Intronic
1098212710 12:68183446-68183468 CTTATTCCCTTACCTATTGAAGG - Intergenic
1099209359 12:79765374-79765396 CTTTTTCCCAGAAATCTTGATGG + Intergenic
1099330381 12:81277551-81277573 GTATTTCCCTCCAATACTGAAGG - Intronic
1099617794 12:84960495-84960517 TATTTCCCCTTCAATTTTGAAGG + Intergenic
1099744765 12:86688486-86688508 GTTTTTCCTTTCCATATTTAGGG + Intronic
1099882858 12:88489674-88489696 TTTTTTTTCTTCAATATTCAAGG + Intergenic
1101598956 12:106191787-106191809 CTTTTTCTCTTCTATGTTCAAGG - Intergenic
1102801114 12:115734806-115734828 CTATCTACCTTCATTATTGATGG - Intergenic
1103891420 12:124241767-124241789 TTTTTTCCCTTCCCCATTGAAGG - Intronic
1103956013 12:124577272-124577294 CCTCTTCCCTGCAAGATTGAGGG + Intergenic
1105017383 12:132793986-132794008 CTTTTTCCCTACAATATGGAGGG + Intronic
1105295026 13:19081141-19081163 CTTTATCCCTTTAATGTTGGTGG - Intergenic
1105572498 13:21616785-21616807 CTATGTCCCTAGAATATTGAGGG + Intergenic
1106210952 13:27645000-27645022 CTTTCTCCCCTTAATTTTGAAGG + Intronic
1106306934 13:28520771-28520793 CTTTATCCATTCATTATTGATGG + Intergenic
1107384304 13:39891201-39891223 CTTTTACCCTTAAATATTTCAGG - Intergenic
1107569639 13:41643280-41643302 CTTTTTCCTTTCTCTATTTAGGG + Intronic
1107650731 13:42542097-42542119 CCTTTTCCCTTCAGTTTTTAAGG + Intergenic
1107981882 13:45741840-45741862 ATGTTTCTCTTCAATAATGAAGG - Intergenic
1108139377 13:47402673-47402695 CTTTCTCCCTTTAGTCTTGAGGG + Intergenic
1108304817 13:49120341-49120363 GTTTTTCCTTTCCATATTTAGGG - Intronic
1108379319 13:49841315-49841337 CTTTTTTCCTTCCATATGGAAGG - Intergenic
1108545173 13:51486380-51486402 GTTTTTCCTTTCCATATTTAGGG + Intergenic
1108696301 13:52905431-52905453 TTTTTTCCCCTCTATTTTGAAGG + Intergenic
1108742761 13:53355720-53355742 CTCTTTCCCTTGACTCTTGATGG + Intergenic
1110351319 13:74511503-74511525 TATTTTGCCTTCATTATTGAAGG + Intergenic
1110890796 13:80695345-80695367 CTTTATCCAGTCTATATTGATGG - Intergenic
1111002368 13:82202085-82202107 CTTTTTTATTTCAATATTGGAGG - Intergenic
1112965204 13:105182544-105182566 ATTTTTCACTTAAATAGTGAAGG - Intergenic
1112987537 13:105469925-105469947 CTTTTTTTATTCCATATTGAGGG + Intronic
1115033352 14:28826505-28826527 CATTTTCCCTTTAGTTTTGAAGG + Intergenic
1115048489 14:29027518-29027540 GTTTTTCCTTTCCATATTTAGGG + Intergenic
1115082409 14:29472356-29472378 AATTTTCCCTTCATTTTTGAAGG + Intergenic
1116291654 14:43050966-43050988 CTTTTTGCCTACAATATTCCAGG + Intergenic
1116363649 14:44032880-44032902 CTCTTTCCATTGAATATGGAAGG + Intergenic
1116473788 14:45316612-45316634 CTTTTAACATTGAATATTGATGG + Intergenic
1116705378 14:48290295-48290317 TTTTTTCCATGTAATATTGATGG + Intergenic
1116913732 14:50499966-50499988 TTTTTTCCCTTGAATATTGTTGG - Intronic
1120148456 14:81005099-81005121 CTTTTTCCCTTAAATATTATAGG - Intronic
1122656557 14:103265398-103265420 CTATTTCCCTTCATTTTTGAGGG + Intergenic
1123487213 15:20752160-20752182 CTTCTTCCTTTCACTAATGAAGG + Intergenic
1123543703 15:21321215-21321237 CTTCTTCCTTTCACTAATGAAGG + Intergenic
1124205683 15:27718029-27718051 CTTTTTCCACTCAACTTTGAGGG + Intergenic
1125446593 15:39764651-39764673 CTTATTCTCTATAATATTGAGGG - Intronic
1125463633 15:39929647-39929669 CCTTTCCCCTTCATTCTTGAAGG - Intergenic
1126654969 15:50967248-50967270 CTTGTTACCTTAAACATTGAAGG + Intronic
1126947465 15:53838388-53838410 GTTTTTTCCATCAATATTTATGG + Intergenic
1127687483 15:61363249-61363271 GTTTTTCCTTTCCATATTTAGGG + Intergenic
1129617541 15:77111147-77111169 CAATTTCCAATCAATATTGAAGG + Exonic
1129919223 15:79305452-79305474 TGTTTTCCCTTCAATTTTGGCGG + Intergenic
1130049227 15:80469182-80469204 CTTTTTACCTTCAGGCTTGAAGG - Intronic
1131743185 15:95416737-95416759 TTTTCTCCCTTCAGTATTTAAGG - Intergenic
1202952020 15_KI270727v1_random:48341-48363 CTTCTTCCTTTCACTAATGAAGG + Intergenic
1133375627 16:5284302-5284324 CTTTTTTCCCTCATTATTTATGG + Intergenic
1133484270 16:6203470-6203492 CTTTATCCATTCATTGTTGATGG + Intronic
1134043443 16:11084891-11084913 CTTTCTGCCTTCAGAATTGATGG - Intronic
1134638409 16:15810001-15810023 CTTTTTCAATTTAATATTTACGG + Intronic
1134740723 16:16541530-16541552 CTACTTCTCTCCAATATTGAGGG + Intergenic
1134796582 16:17042962-17042984 CTTTATCCAGTCTATATTGATGG - Intergenic
1134796642 16:17043881-17043903 CTTTATCCAGTCTATATTGATGG + Intergenic
1134926781 16:18170650-18170672 CTACTTCTCTCCAATATTGAGGG - Intergenic
1135898954 16:26438346-26438368 CTTTTTCCCCTCAAAAGTTATGG + Intergenic
1136373314 16:29849382-29849404 CTTTTTCCACTCAATATTACAGG - Intergenic
1138060531 16:53885351-53885373 CTTTTTCATTTCAATGTTGTGGG - Intronic
1138648104 16:58439939-58439961 CTTTTCCCCTTCCTTTTTGAGGG + Intergenic
1139098736 16:63738306-63738328 TATTTTCCCTTCACTTTTGAAGG - Intergenic
1140843185 16:78861187-78861209 CTTTTTTCCTTCTCTGTTGAAGG + Intronic
1142828210 17:2528025-2528047 GTTTTTCCCATCCATATTCAAGG + Intergenic
1145181950 17:20761039-20761061 AGTTTTCCCTTCATTAATGAAGG + Intergenic
1146340417 17:32014408-32014430 CTTTTTGCCTTAATTGTTGAAGG - Intronic
1146774009 17:35596409-35596431 CTTTTTCGTTTCAATATCCATGG - Intronic
1147843945 17:43391937-43391959 TTTTTTCCTTTTAATAGTGATGG - Intergenic
1148295488 17:46498585-46498607 CTTTTTGCCTTAATTGTTGAAGG - Intergenic
1148753371 17:49959048-49959070 CATTTTCCCTACAATATATATGG - Intergenic
1149116235 17:53099687-53099709 CTTTATCCATTCATTGTTGATGG - Intergenic
1149156637 17:53638677-53638699 CTTTATCCATTCATCATTGATGG + Intergenic
1149841846 17:59972202-59972224 AGTTTTCCCTTCATTAATGAAGG + Intronic
1150407110 17:64911355-64911377 CTTTTTGCCTTAATTGTTGAAGG + Intronic
1150853534 17:68728841-68728863 CTTTATCCAGTCTATATTGATGG - Intergenic
1151060418 17:71085543-71085565 CTTTTGCAGTTCTATATTGATGG - Intergenic
1153334995 18:3914438-3914460 CTTTATCCATTCATTGTTGATGG + Intronic
1155855823 18:30833337-30833359 TTTTTTCATTTCAATACTGAGGG - Intergenic
1158540556 18:58349660-58349682 CTTTATCCGCTCAATGTTGATGG + Intronic
1158660907 18:59386645-59386667 ATTTCTTCCTTCAATTTTGAAGG + Intergenic
1158762856 18:60411108-60411130 CCTTCTCCCTTCAATATTCCAGG - Intergenic
1159050909 18:63420594-63420616 ATTTTTCCCTTGAGTATTAAAGG - Intronic
1160111207 18:76033591-76033613 CTTTTCCACTTCAATATGGCTGG - Intergenic
1160317832 18:77864755-77864777 TATTTTCCCTTCATTATGGAAGG + Intergenic
1162465890 19:10840031-10840053 CTTTAGCCATTCATTATTGAGGG + Intronic
1163889256 19:19996439-19996461 CTTTATCCACTCAATATTGATGG - Intergenic
1164477767 19:28588360-28588382 CTTTTTCCCTTCAAAACAGAAGG - Intergenic
1165093758 19:33399775-33399797 CTTTTTTCCTTGAACACTGAGGG + Intronic
1165504374 19:36215546-36215568 CTTTTTTACTTGAAAATTGAAGG + Intronic
1165989226 19:39797495-39797517 CTTCTTCCTTTCAATCTGGATGG + Intergenic
1167783962 19:51621252-51621274 CTTTTTCTTTCCTATATTGATGG - Intronic
1168580171 19:57548834-57548856 CTTTGTCCATTCATTGTTGATGG - Intronic
925014593 2:512841-512863 CTTTATTTCTTCATTATTGAAGG + Intergenic
925236196 2:2279681-2279703 CTTTTTACCTTCAAGTTTGTTGG + Intronic
925696885 2:6589825-6589847 CTTTCTTCCTTAAATCTTGAAGG + Intergenic
925728901 2:6902962-6902984 GTTTTTCCTTTCAATATTTAGGG + Intergenic
925885223 2:8389687-8389709 CTTTTTCCTGTAAACATTGAAGG - Intergenic
926575595 2:14576772-14576794 CATTTTCCCTTCATTCCTGAAGG + Intergenic
926666573 2:15531024-15531046 CTTTTTCCATTAAATTTTGAAGG - Intronic
927390683 2:22591289-22591311 GTTTTTCCTTTCCATATTTAGGG - Intergenic
928636895 2:33256010-33256032 CCTTTCCCCTTCACTATTCATGG + Intronic
928667525 2:33565264-33565286 GTTTTTCCTTTCAATTTTCAGGG - Intergenic
928812876 2:35250288-35250310 CTTTTTCCTCTCAATATATAGGG + Intergenic
929018092 2:37521740-37521762 CTAATTCCCTTAAATATTGAGGG + Intergenic
929912950 2:46107450-46107472 GTTTATCCATTCACTATTGAAGG + Intronic
930452733 2:51562522-51562544 CTTTATCCATTCATCATTGATGG + Intergenic
930730981 2:54727167-54727189 CTTTTTCCCTTCATCAGTTAAGG - Intronic
932073232 2:68642089-68642111 GTTTGTCCCTTCATCATTGATGG + Intergenic
932383686 2:71310096-71310118 ATTTTTCCTTTCAGTATTTATGG + Intronic
932805765 2:74781527-74781549 TTTTTTACCTTCAATTTTAAAGG + Intergenic
933318296 2:80741263-80741285 CTTTATCCAGTCTATATTGATGG - Intergenic
933381645 2:81555002-81555024 CCTTTGCTTTTCAATATTGATGG - Intergenic
933461360 2:82591280-82591302 CATCTTCCTTTTAATATTGAAGG - Intergenic
933580816 2:84124841-84124863 CTTCTTCTCTTCAATTTAGAGGG + Intergenic
934982345 2:98853391-98853413 TATTTTGCCTTCATTATTGAAGG - Intronic
935265537 2:101390420-101390442 CTTTATCCATTCATCATTGATGG + Intergenic
935376875 2:102408941-102408963 CTTTTTCCCTTCTTTCTAGATGG + Intergenic
935471756 2:103469253-103469275 GTTGTTTGCTTCAATATTGATGG - Intergenic
935999480 2:108812450-108812472 GTTTTTCCCTAAAATATTAATGG - Intronic
936101800 2:109588153-109588175 CATTTTGCCTTCATTTTTGAAGG - Intronic
936471312 2:112801178-112801200 CTTTTACCCTTTTTTATTGAGGG + Intergenic
936896635 2:117435183-117435205 CTGTTTCCCTTCCACATTCATGG + Intergenic
937891945 2:126945734-126945756 TTTTTGCCTTTCAATGTTGATGG + Intergenic
939749918 2:146031450-146031472 ATTTTTCCCTTTAATATTTTAGG + Intergenic
940566735 2:155372809-155372831 CTTTTTACCTTCTATCTTGAAGG + Intergenic
940714386 2:157203103-157203125 CTTTTACCCTTTACTTTTGAAGG - Intergenic
941662662 2:168211120-168211142 TTTTTGCCCTAGAATATTGAGGG - Intronic
943146165 2:184048120-184048142 CTTTTTGTCTTCAATACAGAAGG + Intergenic
944841890 2:203632269-203632291 TTTTTTACCTTCAGAATTGAGGG + Intergenic
946469380 2:219943598-219943620 ATTTTTCCCTGCAATGTTTATGG + Intergenic
947235201 2:227934454-227934476 CATTTAACCTTCAAAATTGAAGG - Intergenic
948215242 2:236223914-236223936 CATTTTCCCATTGATATTGATGG + Intronic
1169938405 20:10910622-10910644 CTTTTTCCCATCATTTTTCACGG - Intergenic
1170413371 20:16114228-16114250 TTTTTTTCCTTCAATAATCATGG - Intergenic
1171005009 20:21455829-21455851 CTTTATCCGGTCTATATTGATGG + Intergenic
1172337497 20:34129457-34129479 CCTTTTCCCCCCAATTTTGATGG - Intergenic
1173947281 20:46961624-46961646 CTTTTTCCATTCATTGCTGATGG - Intronic
1174035216 20:47664498-47664520 CTTTTTCCTTTCTTTTTTGATGG + Intronic
1174282954 20:49452597-49452619 CCTTTTCCCTTCCATCTTCAGGG - Intronic
1174784438 20:53419328-53419350 CTTTTTATCTTCAAAATGGAAGG + Intronic
1176799559 21:13411447-13411469 CTTTTCACCTTCATTTTTGAGGG - Intergenic
1177204048 21:17991189-17991211 CTTTATCCATTCATCATTGATGG + Intronic
1177279771 21:18966255-18966277 TTTTTTCCTTTCAATATTGTAGG + Intergenic
1177413767 21:20768214-20768236 TTTTTTTCCTTGAAAATTGAAGG - Intergenic
1177602321 21:23331885-23331907 CTTTTTCTCCTCAATATAGGTGG - Intergenic
1178200758 21:30402158-30402180 TTTTTTTCCTTCATTTTTGAAGG - Intronic
1178349676 21:31863728-31863750 TTTTTTCCTTTCAAGAGTGATGG - Intergenic
1179529382 21:42008840-42008862 CTTTTTAACATCAATATTTAGGG + Intronic
1181716512 22:24734449-24734471 ATTTGTCTCTTCAATATTGGAGG - Intronic
1182380970 22:29887296-29887318 CTTCTTCCTTTCACTAATGAGGG - Intronic
1182975653 22:34621821-34621843 CCTTTTACCTTCACTATGGAGGG + Intergenic
1183707642 22:39484252-39484274 CTTGTTCCCTTCAATGCTCAAGG - Intronic
949430952 3:3975182-3975204 CATTTTACCTTCACTTTTGAAGG + Intronic
950856869 3:16113903-16113925 CATTTTCCCTTCAGTCTTTAAGG - Intergenic
951419090 3:22462638-22462660 CTGTTTCCTTTCACTACTGAGGG - Intergenic
951723596 3:25729408-25729430 TTTTTTCTTTTCAATTTTGAAGG - Intronic
951989903 3:28664869-28664891 CTTTTTCCCTTAACTCTTGGTGG + Intergenic
952607000 3:35159995-35160017 CTTTTTCTCTTCAATTTTGAAGG - Intergenic
952738578 3:36713984-36714006 CTTATTCCCTTCAGTCTTGGAGG + Exonic
953466059 3:43120397-43120419 CTTACTCCCTTGTATATTGAAGG - Intergenic
953711629 3:45276224-45276246 CTTGCTCCCTTCAAGATGGAAGG + Intergenic
953773033 3:45793223-45793245 TTTTCTCTCTGCAATATTGAGGG - Intronic
953857790 3:46514479-46514501 CTTTTCCCCTTCACTTCTGATGG + Intergenic
956332456 3:68126482-68126504 CTTTTTCTCTTCAAGATTTTGGG - Intronic
958126787 3:89366557-89366579 CTTTTTCTCTTCAACTTTCATGG - Intronic
958414587 3:93858843-93858865 CTTTTCCTCTTCAATAAAGAAGG + Intergenic
958735257 3:98001678-98001700 CTATTTCCCAGCCATATTGATGG - Exonic
958841109 3:99206535-99206557 CTTTTTCCCTCCAGTTTTCAAGG - Intergenic
959159841 3:102709917-102709939 TTTTCTCTCTTCCATATTGATGG - Intergenic
959332388 3:105022779-105022801 CTGATTCCTTTCAATATGGATGG - Intergenic
959417342 3:106091519-106091541 CTTTTTCCATTTAATTTTAAGGG - Intergenic
959904952 3:111701088-111701110 CTTCTTGCCTTAAATACTGATGG - Intronic
961165017 3:124757532-124757554 CTTTCTCCTTTCAATCTTGGCGG - Intergenic
962730533 3:138279616-138279638 ATTTTTTTCTTCAATTTTGATGG + Intronic
963336653 3:143982600-143982622 TTTTTTCCTTTCCATATTCAGGG - Intronic
968881265 4:3301407-3301429 CTTTTTCCCTTGAATCCTGTAGG + Intronic
971756497 4:30715138-30715160 CTATCTCCTTTCACTATTGATGG - Intergenic
971774450 4:30944014-30944036 TTTATTCCACTCAATATTGAAGG + Intronic
973135021 4:46696645-46696667 TCAGTTCCCTTCAATATTGAAGG + Intergenic
973135023 4:46696652-46696674 TTTTTTTCCTTCAATATTGAAGG - Intergenic
973318358 4:48784144-48784166 CTTATTCTCATCAATATTAATGG - Intergenic
974140595 4:57881404-57881426 TTTTTTGCTTTCAATATTTATGG - Intergenic
974150816 4:58007183-58007205 CTTTTTCCTTTCCAATTTGACGG - Intergenic
974387136 4:61215996-61216018 CTTTTTCCCTAAAATATCCATGG + Intronic
974407300 4:61490687-61490709 TTTTTTTTTTTCAATATTGAGGG - Intronic
976044891 4:80933888-80933910 CTTTTTTCTTTCAAGTTTGAAGG + Intronic
976065226 4:81179439-81179461 CTTTTTGCCTTCATTTTTGAAGG - Intronic
976426745 4:84912903-84912925 CCTTTTCCCTTCAAGACTCAGGG - Intronic
976874851 4:89840372-89840394 ATTTTTCTTTTCATTATTGATGG + Intergenic
977274745 4:94962712-94962734 CTTTATCCATTCATTGTTGATGG + Intronic
977733002 4:100378121-100378143 CTTTTTCACATTAATAATGAAGG - Intergenic
978090504 4:104708869-104708891 GTTTTTCCTTTCCATATTTAGGG - Intergenic
978208728 4:106110349-106110371 CTTTTCACCTTCATTTTTGAGGG - Intronic
978361645 4:107937118-107937140 CTTTTTGCCTTCTATTTTTATGG - Intronic
978666194 4:111184738-111184760 TTTTTTTCCTTCACTTTTGAAGG + Intergenic
979062543 4:116081413-116081435 TTTTTTCACTTCAATTTTCATGG + Intergenic
979418638 4:120475895-120475917 CTTTTCACCTTCTATATAGAAGG - Intergenic
980182587 4:129419809-129419831 CTGTTTCTCTTGCATATTGATGG + Intergenic
980308188 4:131091926-131091948 ATTTTTTCTTTCAATATGGAAGG - Intergenic
980324629 4:131325032-131325054 TTTTTTCCCTTCTACAATGATGG + Intergenic
980633719 4:135472092-135472114 GTTTTTCCTTTCCATATTTAGGG + Intergenic
981524653 4:145697742-145697764 CTTTATCCATTCATTATTGATGG + Intronic
982424017 4:155235592-155235614 TATTTTCTCTTCATTATTGAAGG + Intergenic
984130333 4:175867296-175867318 CTTTTTAGGTTCAACATTGAAGG - Intronic
984246580 4:177282100-177282122 CTTTTTCCTTCAAATCTTGATGG + Intergenic
988879065 5:35480860-35480882 CTTTTTCCCTTGAGAACTGAAGG + Intergenic
989328936 5:40232724-40232746 CTTTTTCCTGTAAAAATTGAAGG - Intergenic
990830592 5:59952561-59952583 TCTTTTCCTTTGAATATTGAAGG + Intronic
991438314 5:66618598-66618620 CTGTCTCCCTTCAATACAGAGGG - Intronic
993069598 5:83143656-83143678 AATTTTGCCTTCAATCTTGAAGG + Intronic
993261762 5:85666653-85666675 TTTTTTCCCTTCAAGACTTAAGG - Intergenic
993803761 5:92377965-92377987 TTTTTTCCCTGTAAAATTGAAGG + Intergenic
993879350 5:93344907-93344929 CTCGTTGCCTTCACTATTGATGG - Intergenic
993921195 5:93805305-93805327 CTTTTTCCTTTATATAGTGAAGG - Intronic
994169778 5:96646133-96646155 CTCCTTCTCTGCAATATTGACGG - Intronic
994696417 5:103078187-103078209 GTTTTTCCTTTCCATATTTAGGG + Intergenic
994725145 5:103426701-103426723 TTTTTTCCCTCAAAAATTGAGGG + Intergenic
994934251 5:106233298-106233320 CTCTGTTCCTTTAATATTGAGGG - Intergenic
995022438 5:107381592-107381614 ATTTTTCCCCTCAATTTTTAAGG - Intronic
995061760 5:107818779-107818801 CATTGTCCCTTCAAAATTTATGG - Intergenic
995119751 5:108523133-108523155 TTTTTTCCCCTCAATGGTGATGG + Intergenic
995345527 5:111112018-111112040 TTTTTTTTCTTCAATTTTGAAGG - Intronic
995350656 5:111171574-111171596 GTTTTTCCCTTCTATTTTAAGGG + Intergenic
996161827 5:120175542-120175564 TTTTTCTCCTTCAATTTTGAAGG - Intergenic
996242766 5:121223234-121223256 GTTTTTCCTTTCCATATTTAGGG - Intergenic
996893505 5:128452723-128452745 CTTTTTCTTTTCAATTTTTATGG + Intronic
996924678 5:128810545-128810567 TTTTTTTCCTTTAATATTTATGG - Intronic
998273667 5:140731040-140731062 CTTATTCATTTTAATATTGATGG + Intergenic
998577958 5:143337690-143337712 CTTTTTTCATTCAACATTGTAGG - Intronic
998836407 5:146206311-146206333 TTTTTTCCCCTTAATGTTGAAGG + Intronic
999060622 5:148630477-148630499 CTTATTAGCTCCAATATTGAAGG + Intronic
1000392096 5:160733517-160733539 CTTTTTCCCTTAACTTTTTATGG - Intronic
1000524464 5:162339311-162339333 CTTTTTCCCTTCCACCATGAAGG + Intergenic
1000759415 5:165203943-165203965 GTTTTTCCTTTCCATATTGAAGG + Intergenic
1000772313 5:165370637-165370659 GTTTTTCACTTCATTTTTGAAGG + Intergenic
1002593461 5:180306703-180306725 CTTTTTTCCACCAAAATTGAGGG - Intronic
1003237618 6:4310891-4310913 ATTTCTCCCTTCATTTTTGAAGG - Intergenic
1003285771 6:4732699-4732721 CAGTATCCCTTCAATTTTGAGGG + Intronic
1003285774 6:4732706-4732728 TTTTTTCCCCTCAAAATTGAAGG - Intronic
1003684428 6:8287175-8287197 TCTTTTCTCTTAAATATTGAAGG + Intergenic
1004577755 6:16914581-16914603 CTATTTCCCATCAATATTTCAGG + Intergenic
1004860317 6:19797380-19797402 GATTTTTCCTTCATTATTGAAGG - Intergenic
1006036563 6:31217584-31217606 CTTTCTCCTTTAAATATTGAAGG - Intergenic
1007003763 6:38339795-38339817 CATTTTGCTTTCAATATTTAGGG - Intronic
1009249232 6:61277259-61277281 CTTTTTTCCTTGAATATATATGG - Intergenic
1010011779 6:71056084-71056106 GTGTATCCCTTCAGTATTGAAGG + Intergenic
1010064896 6:71670865-71670887 CTTTATCCATTCAAGTTTGATGG - Intergenic
1010107307 6:72184906-72184928 TTTTTTCCCTTCAACACTCAGGG - Intronic
1010216290 6:73404869-73404891 CATTTTCATTTGAATATTGAAGG - Intronic
1010350845 6:74872403-74872425 CTTTTTCCTTTCCACATTTAAGG - Intergenic
1011740372 6:90353595-90353617 CTTTTTCACTTCCAGATTGCAGG - Intergenic
1012060275 6:94469568-94469590 CTGTTGCCCTTCAATCCTGATGG + Intergenic
1012512788 6:100023554-100023576 ATTTCTCCTTTCTATATTGATGG - Intergenic
1014339461 6:120186076-120186098 CTTTTTGCCTTCACTTCTGAAGG + Intergenic
1015885868 6:137917974-137917996 GTTTATCCATTCACTATTGAAGG - Intergenic
1018670634 6:166173928-166173950 GTCTTTGCCTACAATATTGATGG - Intergenic
1020677432 7:11198194-11198216 TTTGTTTCCTTCAAGATTGAAGG - Intergenic
1020768369 7:12354753-12354775 CTTTTTGCCTTAACTATTAATGG - Intronic
1021006571 7:15402016-15402038 GTATTTCCCTTCAATACTGGTGG - Intronic
1023979153 7:45056488-45056510 CTTTTTTCTTTTAATAGTGACGG - Intronic
1024014424 7:45298381-45298403 CTTTTTGCCTTAAATGTTTAGGG - Intergenic
1024340500 7:48253352-48253374 TTTTTTCCCTTGTATACTGAGGG + Intronic
1024494298 7:50026360-50026382 CCTTTTATATTCAATATTGAAGG - Intronic
1024713171 7:52041153-52041175 GTTTTTCCCTTCATTTCTGAAGG - Intergenic
1024876255 7:54027387-54027409 CTTTTCCCCTTCATTCATGAAGG + Intergenic
1026603075 7:71792758-71792780 CCTTTTCCATTCCATCTTGAGGG + Intronic
1027473489 7:78601560-78601582 CTGTTTCCTTTCAGTATTTACGG + Intronic
1027660145 7:80978998-80979020 CTTCTTGCCTTCATTTTTGAAGG + Intergenic
1027815253 7:82960052-82960074 CTGTTTGCCTTCAATATGGAAGG - Intronic
1028344174 7:89760122-89760144 TTTTTTCCCTGCAATATTGAAGG - Intergenic
1030479627 7:110086320-110086342 GTTTTCTTCTTCAATATTGATGG - Intergenic
1030550291 7:110949966-110949988 CTTTTTTCCCTCATTATTCAGGG - Intronic
1030606820 7:111646516-111646538 CTTTTTCCATTTAATATATATGG - Intergenic
1031222295 7:118984348-118984370 TTTTTTCCTTTCAATATTGAGGG - Intergenic
1031513709 7:122677509-122677531 CTCTCTGCCTTAAATATTGATGG - Intronic
1031946871 7:127851430-127851452 CTTTTTTTCTTCTATATTCAAGG + Intronic
1032283083 7:130521836-130521858 CTTTTTCCCTTCCATATCTTTGG - Intronic
1033435564 7:141330508-141330530 CTTTATCCAGTCTATATTGAAGG + Intronic
1034933734 7:155184635-155184657 TATTTTACCTTCATTATTGAAGG + Intergenic
1035644190 8:1205846-1205868 ATTTTTCCCTTCAAAAATAAAGG + Intergenic
1038091125 8:24254381-24254403 CTTATTCCCATCCATATTTAAGG + Intergenic
1039265414 8:35817997-35818019 GTTTTTCCTTTCCATATTTAGGG - Intergenic
1042858454 8:73290954-73290976 CTTTTCCCATTAAATATTGATGG - Intronic
1043032842 8:75159579-75159601 CTTTTTCCATTAAATATTCTTGG + Intergenic
1043251103 8:78074159-78074181 TTTTCTCCCTTCAGTCTTGATGG - Intergenic
1045747491 8:105440756-105440778 CTTATTCCCTTCCTTCTTGATGG - Intronic
1045800883 8:106098968-106098990 TTATTTCCCTTCCATCTTGAAGG - Intergenic
1046150183 8:110213194-110213216 CATTTTTCCTTCATTCTTGAAGG - Intergenic
1046334753 8:112771080-112771102 CTTTTTCCAATTAATGTTGAAGG - Intronic
1046338344 8:112820133-112820155 CTTCTTTCCTTCTATATTGGAGG - Intronic
1046739668 8:117814716-117814738 CTTTGTCTCTTCAAAGTTGATGG - Intronic
1046959035 8:120090828-120090850 ATTTTTTAATTCAATATTGAAGG - Intronic
1047904238 8:129455694-129455716 CCTTTGCCCTTCAATACTTACGG + Intergenic
1050079570 9:1902342-1902364 CCTTTTCTCTTCAGTCTTGACGG - Intergenic
1050152568 9:2631418-2631440 CTTTACCCTTTCATTATTGATGG - Intronic
1050244238 9:3671316-3671338 GATTTTCTCTTCAATATTGAGGG - Intergenic
1050693252 9:8251963-8251985 TTTTTTCCCTTAAATAGTGTAGG - Intergenic
1051577962 9:18638901-18638923 CTTTTTGACTTCAATCTTGATGG - Intronic
1051972586 9:22908644-22908666 TTTTTTCCCTTCTACATTGGCGG - Intergenic
1051994206 9:23194595-23194617 CTTCTTCCCTCCTATATTCATGG - Intergenic
1052238415 9:26241646-26241668 TTTTTTCCCCTAAACATTGAAGG - Intergenic
1052296739 9:26904821-26904843 CTTTTGCCCTTCACTATTTGAGG - Exonic
1052369455 9:27647187-27647209 GTTTTTCCTTTCCATATTTAGGG - Intergenic
1052686313 9:31762194-31762216 CTTTCCCCTTTAAATATTGAAGG - Intergenic
1052822473 9:33148540-33148562 CTTTTTCCCTTCTGTAATGAGGG - Intronic
1054840118 9:69729459-69729481 CTGTAGCCCTTCAATAATGAGGG - Intronic
1055216246 9:73866355-73866377 CTTTTCCCCTTAAGTATAGAGGG + Intergenic
1055414891 9:76070986-76071008 CTTTTTTCCTTCTATTTTGGAGG - Intronic
1055448782 9:76411283-76411305 CTTTTTCCCTGCCATTTTGGGGG + Intergenic
1055677801 9:78682937-78682959 ATTTTTACCTTCACTTTTGAAGG + Intergenic
1055970216 9:81904501-81904523 CTTGTTCCTTTAAATTTTGAAGG + Intergenic
1055982385 9:82017124-82017146 GATTTTCCCTTCACTCTTGAAGG + Intergenic
1057396457 9:94684609-94684631 TTTTTTCACTTTAATAGTGACGG - Intergenic
1058359864 9:104132103-104132125 CTTTTGCCATGCAATATTTAGGG - Exonic
1058611298 9:106778972-106778994 TTTTTTCCCTTCCATCTTGATGG + Intergenic
1059491750 9:114673624-114673646 CATTTTGCCTTAATTATTGAAGG - Intergenic
1185984134 X:4811520-4811542 CTTTATCCAGTCATTATTGATGG + Intergenic
1186664034 X:11700351-11700373 CTTTCTCCCTTCTACAATGAAGG + Intergenic
1187180966 X:16943557-16943579 CTTTATCCATGCACTATTGAGGG + Intergenic
1188505876 X:30884378-30884400 CATTATCCCTTCAAAAATGAGGG + Intronic
1188823081 X:34798495-34798517 CTTTTTTCCTTGAATGTGGATGG - Intergenic
1188935351 X:36168959-36168981 CTTTTCTCCTTCATTTTTGAAGG + Intergenic
1190419767 X:50217572-50217594 ATTTTTCCCTTCACTGTTGAAGG + Intronic
1190480929 X:50876039-50876061 CCTTTTCCCTTGAATATGGATGG - Intergenic
1193119034 X:77804242-77804264 ATTTTTTCCTTCATTTTTGAAGG + Intergenic
1193317508 X:80080604-80080626 ATTTTCTCCTTCATTATTGAAGG + Intergenic
1195112943 X:101665639-101665661 CTTTTCCCCTTCAGTAGTGGTGG + Intergenic
1195133817 X:101882876-101882898 TTTTTTTCCTTCAACTTTGAAGG + Exonic
1195162116 X:102181119-102181141 CTTTTCACCTTCATTTTTGAGGG + Intergenic
1195173006 X:102286921-102286943 ATTTTCCCCTTCATTTTTGAAGG + Intergenic
1195185860 X:102400174-102400196 ATTTTCCCCTTCATTTTTGAAGG - Intronic
1195214460 X:102685049-102685071 CTGTTTCCCTTCTATATACAGGG + Intergenic
1195501136 X:105601502-105601524 CTTTTTCCCTATAATAGGGAGGG - Intronic
1196363134 X:114890439-114890461 CTTGTTCCCTTCATTATTTCTGG + Intronic
1196363142 X:114890578-114890600 CATTTCACCTTCAATTTTGAGGG + Intronic
1197121738 X:122901270-122901292 CTGTTTTCCTTCATTTTTGAAGG - Intergenic
1197234635 X:124046277-124046299 CATTTTCTCTTTAATAATGAAGG - Intronic
1197862023 X:130980892-130980914 CTTTATCCATTCATTGTTGATGG - Intergenic
1199702266 X:150390897-150390919 TATTTCCCCTTCATTATTGAAGG + Intronic
1199907619 X:152250108-152250130 GTTTGTCCCTTGAATCTTGAAGG - Intronic
1200747677 Y:6916865-6916887 CTTTTTTCCGTCACTTTTGAAGG + Intronic
1200753129 Y:6965231-6965253 CCTTTTCCCCCCAATTTTGATGG + Intronic
1200832270 Y:7698573-7698595 CTTATTTCCTTGAAAATTGAGGG - Intergenic
1200849391 Y:7867087-7867109 CTTTTCACCTTCATTTTTGAGGG + Intergenic
1201260508 Y:12154449-12154471 CTTTATCCCATCAATATTCCTGG - Intergenic
1202050240 Y:20773353-20773375 CTTATTTTCTTCAATTTTGAAGG + Intronic