ID: 919989658

View in Genome Browser
Species Human (GRCh38)
Location 1:202700383-202700405
Sequence GGTGAAGCCCAGCCCAGAGC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 375
Summary {0: 1, 1: 0, 2: 4, 3: 35, 4: 335}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
919989658_919989661 4 Left 919989658 1:202700383-202700405 CCGGCTCTGGGCTGGGCTTCACC 0: 1
1: 0
2: 4
3: 35
4: 335
Right 919989661 1:202700410-202700432 ACAGCAGTTCTCAAACCTTTTGG 0: 1
1: 14
2: 48
3: 205
4: 748
919989658_919989663 26 Left 919989658 1:202700383-202700405 CCGGCTCTGGGCTGGGCTTCACC 0: 1
1: 0
2: 4
3: 35
4: 335
Right 919989663 1:202700432-202700454 GTTCTAAGACCCGTTTATTGAGG 0: 1
1: 0
2: 0
3: 2
4: 57

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
919989658 Original CRISPR GGTGAAGCCCAGCCCAGAGC CGG (reversed) Intronic
900206738 1:1434864-1434886 GGTGAGGCCCAGACGAGAGGTGG - Intronic
900288890 1:1915499-1915521 GGGGAAGCCCAGGCCAAAGCGGG + Intronic
900553670 1:3269277-3269299 GGAGAAGCGCAGCCCAGAGTAGG + Intronic
901175352 1:7294779-7294801 GGTGAGGACCAGCCCAGACCAGG + Intronic
902506009 1:16939343-16939365 GGTGAAGCCGAGCCCAGAAGTGG + Intronic
902733564 1:18385460-18385482 GCTGCAGACCAGGCCAGAGCGGG + Intergenic
902821039 1:18943674-18943696 GGTGCAGCCAAGCACAGGGCTGG + Intronic
903008433 1:20313867-20313889 GGAAAAGACCAGCCCAGATCAGG + Intronic
903154992 1:21437002-21437024 GGTGAAGCCGAGCCCAGAAGTGG + Intergenic
903332788 1:22604682-22604704 AGTGGTGCCCAGCACAGAGCAGG - Intergenic
903364711 1:22798892-22798914 GGTGGACACCAGCCCAGTGCTGG + Intronic
904209016 1:28873562-28873584 GCTGAAGTCCAGCTCAGGGCAGG + Intergenic
904528988 1:31155522-31155544 GGTGGAGCGCGGCCCAAAGCGGG - Intergenic
904857982 1:33514489-33514511 GGTGATGCCCAGCAGAGTGCTGG + Exonic
905454038 1:38075445-38075467 GGTGTGGCCCAGGCCAGGGCTGG - Intergenic
905622885 1:39464094-39464116 TTTGTAGCCCAGCTCAGAGCAGG - Intronic
905963776 1:42070621-42070643 GGAGAAGCCCAGTTCAGAACTGG + Intergenic
906201078 1:43960798-43960820 GCTGAAGCCCTGCACAGAGGGGG - Intronic
906689255 1:47781828-47781850 TGTGAAACCAAGCCCAGAGAGGG - Intronic
907298677 1:53471591-53471613 GGTGAAGCCTAGGCCACAGCAGG - Intergenic
908833306 1:68203446-68203468 AGTGACACCCAGCCCAGTGCTGG - Intronic
909605247 1:77501260-77501282 ACTGAAGACCAGTCCAGAGCTGG + Intronic
911104411 1:94118669-94118691 AGTGAACGCCAGCCCAGACCAGG + Intronic
911496594 1:98638405-98638427 GGTGAGGCCCAGCACTGTGCTGG + Intergenic
912264983 1:108148420-108148442 GGTGCAGCTCAGTCCACAGCAGG - Intronic
915005443 1:152630686-152630708 GCTGTACCCCAGCCCAGGGCAGG - Intergenic
916210704 1:162357355-162357377 AGCCAAGCCCAGCTCAGAGCAGG - Intronic
917678348 1:177341098-177341120 GGTGATGCCCACACCAGAGCTGG - Intergenic
919989658 1:202700383-202700405 GGTGAAGCCCAGCCCAGAGCCGG - Intronic
920540189 1:206772369-206772391 GGTGAGGGCCAGCCCAGGCCAGG - Exonic
921056734 1:211548298-211548320 AGTGATGCCTAGCCCACAGCAGG + Intergenic
922240988 1:223755439-223755461 AGAGGAGCCCAGCCCTGAGCAGG - Intronic
922452826 1:225750592-225750614 GCTGAAGCCAGCCCCAGAGCAGG + Intergenic
1062854774 10:774473-774495 GGCGAGGCCCAGCCCTGCGCAGG + Intergenic
1063067328 10:2623325-2623347 GGTAAACCCCTCCCCAGAGCTGG + Intergenic
1064148744 10:12845256-12845278 GTTGGATCCCAGCCCGGAGCAGG + Intergenic
1064149263 10:12849279-12849301 AGTGAAGCCCACCCCACACCAGG + Intergenic
1065671406 10:28122616-28122638 GGTGATGCCAAGCCCAGGGCAGG - Intronic
1066678536 10:37913874-37913896 GGTGAGGCCCAGCCAAGAAAAGG - Intergenic
1067161037 10:43825536-43825558 GGGGAGGCCCAGAGCAGAGCGGG + Intergenic
1067725981 10:48771401-48771423 GGGGAAGCTAAGCCCAGAGATGG - Intronic
1067849379 10:49745109-49745131 GGGGAAGTCCAGCCTTGAGCAGG - Intronic
1069661790 10:70127802-70127824 GGGGACACCCAGACCAGAGCAGG + Intronic
1069767511 10:70874137-70874159 GGTTAAGCCAAGGCCAGAACAGG + Intronic
1069781855 10:70961861-70961883 GGTCAAGACCAGCCCCAAGCTGG - Intergenic
1069868208 10:71517230-71517252 GGTGAGGCCTAGCACTGAGCTGG + Intronic
1070587283 10:77775781-77775803 TGGTCAGCCCAGCCCAGAGCTGG - Intergenic
1070886612 10:79905223-79905245 GGTGAATCCCTGCAGAGAGCCGG + Intergenic
1071568060 10:86681621-86681643 GGCCAAGACCAGCCCAGAGGGGG + Exonic
1072267592 10:93745455-93745477 GAAGAAACACAGCCCAGAGCTGG - Intergenic
1072294197 10:93993874-93993896 GGGAAAGCCCGGCCCAGGGCGGG + Intergenic
1072961991 10:99937695-99937717 GGTGAGGCCCAGCTGAGGGCAGG - Intronic
1074522652 10:114239569-114239591 GGTGAGTCCCAGCCCCGAGTTGG + Exonic
1074599455 10:114899073-114899095 AGTGAAGCCCAGCCCTAAGCTGG + Intronic
1075191480 10:120313454-120313476 GGTACAGCACAGCCTAGAGCTGG + Intergenic
1075395438 10:122123599-122123621 GGTCATGCCCAGCCTAGAACTGG + Intronic
1075702672 10:124479248-124479270 GGAACAGCCCATCCCAGAGCTGG + Intronic
1076543169 10:131227213-131227235 GCCGAAGCCCAACCCAGTGCTGG + Intronic
1076732723 10:132446559-132446581 GGCGAGGCCCAGCCTTGAGCCGG + Intronic
1076886222 10:133263810-133263832 GGTGATGTCCAGGCTAGAGCCGG - Intronic
1077015029 11:395600-395622 CGTGAGGCCCAGCCCGGAGTGGG - Intronic
1077263786 11:1638584-1638606 GGTGGAGCCCAGCCCAGGGTCGG - Intergenic
1077300818 11:1846152-1846174 GGTGAAGCCCAGCCCTGATCCGG - Intergenic
1078359682 11:10658625-10658647 GGGCAAGCCCAGCACAGACCTGG - Intronic
1078754542 11:14196646-14196668 GGGGAAACCCAGCACTGAGCTGG - Intronic
1080701853 11:34650698-34650720 GTTGGAGACCAGCCCAGATCTGG + Intronic
1082101707 11:48178218-48178240 TGTCAAGCCCCACCCAGAGCAGG - Intergenic
1083297540 11:61723132-61723154 GCTGCAGCCCACCCCAGACCAGG - Intronic
1083343434 11:61973584-61973606 GGGGAGGCCCAGCTCAGCGCAGG + Intergenic
1083454833 11:62771647-62771669 GGCCTAGCCCAGCCCAGATCGGG - Intronic
1083611452 11:64006357-64006379 GCTCAAGCCTAGCACAGAGCCGG - Intronic
1083796250 11:65018491-65018513 TGGGAGGGCCAGCCCAGAGCAGG + Intronic
1083829358 11:65221498-65221520 AATGAAGCACAGCCCAGAGAGGG + Intergenic
1085046149 11:73354904-73354926 AGTAAAGCCCAGCTCAGGGCAGG - Intronic
1085053778 11:73392705-73392727 GGTGAAGCCTTGCCCAGATGTGG + Intronic
1085127355 11:74010881-74010903 GTTGCATCCCAACCCAGAGCAGG - Intergenic
1085264710 11:75230468-75230490 GGTGGAGCCCTGCCCCTAGCAGG + Intergenic
1088437121 11:109826708-109826730 GCTGAAGCCCAGGTCAGAGATGG + Intergenic
1088469915 11:110180360-110180382 AATGAATCCCAGCCCAAAGCTGG - Intronic
1090658248 11:128861946-128861968 GGAGAAGCGCGGCCGAGAGCTGG - Intronic
1091304072 11:134525667-134525689 GGTGGTGCCCTGCTCAGAGCCGG - Intergenic
1091305990 11:134536376-134536398 GGAGAAGGCAGGCCCAGAGCAGG + Intergenic
1091595875 12:1878853-1878875 AGGCAAGCCAAGCCCAGAGCTGG - Intronic
1091846033 12:3656991-3657013 GGGGAAGCCCAGCCTAGGGAAGG - Intronic
1092209292 12:6635952-6635974 AGCCCAGCCCAGCCCAGAGCAGG - Exonic
1092758685 12:11789454-11789476 GCTGAAGCCCAGACCGAAGCAGG - Intronic
1092962422 12:13608906-13608928 GGTGAGTCCCTGCTCAGAGCAGG + Intronic
1093387492 12:18576287-18576309 AGTGCAGCCTACCCCAGAGCTGG - Intronic
1094493305 12:30974839-30974861 GGTGAAGCCCAGTCCAGCTGAGG + Intronic
1095719689 12:45386898-45386920 GGGGAAGGCCATCCCAGAGGAGG - Intronic
1096001692 12:48135441-48135463 GGTGAAGTGCAGCCCTGAGGGGG - Intronic
1096077533 12:48814742-48814764 GGCGCTGCCCAGGCCAGAGCAGG - Intronic
1096598753 12:52714658-52714680 GGTGACGCCCCGCCGAGATCCGG + Intergenic
1096972879 12:55681726-55681748 GCGGAAGCACAGCTCAGAGCTGG + Exonic
1097269443 12:57765275-57765297 GGTGAGTCCCAGGACAGAGCTGG - Exonic
1097435537 12:59549082-59549104 GGTGGAGCCCACCACAGGGCAGG - Intergenic
1101865316 12:108515784-108515806 GGTCAGGACCAGCCCAGAGCAGG + Intronic
1101893014 12:108732276-108732298 GGTGTGGCCCAGCCCAGGGGCGG - Intergenic
1101991752 12:109491464-109491486 GGAGAAGCCCAGCAAAGGGCAGG + Intronic
1102036112 12:109771381-109771403 GGTGAAGTCCAGGGCAGAGATGG + Intergenic
1102949983 12:117025033-117025055 GCAGCAGCCCAGCCCAGGGCTGG + Intronic
1104929163 12:132329251-132329273 GCTGAAGCCCAGGCCCGGGCGGG - Intronic
1105285303 13:18998549-18998571 TGGGAGGCCCCGCCCAGAGCAGG + Intergenic
1107385318 13:39902092-39902114 GCTGAAGTCCAGTCCAGAGAGGG + Intergenic
1108700189 13:52937219-52937241 GGTGAAGTCCAGGGAAGAGCAGG - Intergenic
1112012105 13:95301272-95301294 GGTGAAGCCCAACCCGCTGCAGG - Exonic
1114416717 14:22549813-22549835 GTTCAAGACCTGCCCAGAGCTGG + Intergenic
1114566993 14:23639936-23639958 GCTGGAGCCCAGTGCAGAGCTGG - Intronic
1115647094 14:35376189-35376211 GGTGACTCCCAGCCCAGAGAGGG - Intergenic
1115876950 14:37871660-37871682 GGTGAAGCTAAGCTCAGAGTTGG + Intronic
1118276900 14:64393595-64393617 AGTGCAGCAGAGCCCAGAGCTGG + Intronic
1120743622 14:88134184-88134206 AGTGCAGCCCAGCACAGAGATGG + Intergenic
1121096360 14:91220541-91220563 GGTGAAGGCCAAGACAGAGCTGG + Intronic
1121568742 14:94930539-94930561 GGTCAAGGCCAGCCAAGTGCAGG - Intergenic
1121819658 14:96956108-96956130 GGTGTAGCCCAGCCCACAGCTGG - Intergenic
1121846272 14:97174975-97174997 TGTGAAGCCAAGGGCAGAGCTGG - Intergenic
1121916438 14:97840296-97840318 GGTAATGCTCATCCCAGAGCTGG + Intergenic
1122532011 14:102434839-102434861 CGTGGAGCCCAGCCAAGAGCAGG + Exonic
1122794315 14:104198375-104198397 GGCCAAGCCCAGCCCAGCTCAGG - Intergenic
1122828720 14:104384979-104385001 GGTGAAGACCAGCTCAGGGAGGG - Intergenic
1123114191 14:105886533-105886555 GGTGAAGCCCAGGCCAGGTGAGG + Intergenic
1123114210 14:105886597-105886619 GGTGAAGCCCAGGCCAGGTGAGG + Intergenic
1123114234 14:105886677-105886699 GGTGAAGCCCAGGCCAGGTGAGG + Intergenic
1123114254 14:105886742-105886764 GGTGAAGCCCAGGCCAGGTGAGG + Intergenic
1123116408 14:105896141-105896163 GGTGAAGCCCAGGCCAGGTGAGG + Intergenic
1123118430 14:105905262-105905284 GGTGAAGCCCAGGCCAGATGAGG + Intergenic
1123120643 14:105914842-105914864 GGTGAAGCCCAGGCCAGGTGAGG + Intergenic
1123199932 14:106652765-106652787 GGTGAAAACAAGCCCAGACCTGG - Intergenic
1124558475 15:30748867-30748889 GGTGAAGCCCATGTCACAGCTGG + Intronic
1124567979 15:30833891-30833913 GGTTCAGCACAGCCCAGAGGAGG - Intergenic
1124672778 15:31656763-31656785 GGTGAAGCCCATGTCACAGCTGG - Intronic
1125604903 15:40934717-40934739 GGTGAGGCCCAGACCAGCGCAGG + Exonic
1125833899 15:42734644-42734666 GGTGACGCCCAGCCCAGCCTGGG - Intronic
1126309406 15:47298768-47298790 GGAGAAGCTGGGCCCAGAGCTGG - Intronic
1127186820 15:56489056-56489078 GGTGAAGGCCTGCCCAGCACAGG + Intergenic
1128227298 15:66011068-66011090 GGTGGTGACCATCCCAGAGCTGG + Intronic
1128314968 15:66654679-66654701 GGGAGAGCCCAGCCCTGAGCTGG - Intronic
1128359768 15:66953868-66953890 GGTTAAGCCCAGCCCAGAGTTGG - Intergenic
1129167010 15:73784445-73784467 GTCAAAGCCCAGCCCAGGGCTGG - Intergenic
1129252885 15:74318495-74318517 GACCAAGCCCAGCCCTGAGCTGG - Intronic
1130557554 15:84933399-84933421 AATGAAGCCCAAACCAGAGCAGG - Intronic
1131666198 15:94573347-94573369 GGTGGACGCCAGCCGAGAGCTGG - Intergenic
1132366878 15:101264284-101264306 GCTGAAGCCCAGCCCAGGCCTGG + Intergenic
1132498195 16:273685-273707 CGGGAAGCCCAGCCCAGGCCAGG - Intronic
1132524513 16:407669-407691 GGTGCAGCCCACCCCAGCACAGG - Intronic
1132695140 16:1198718-1198740 GCAGGAGGCCAGCCCAGAGCTGG - Exonic
1132935085 16:2475799-2475821 GGTGCAGCCCAGCCCAGGTGGGG - Intronic
1132945838 16:2531121-2531143 CGGGACGCCCAGTCCAGAGCTGG + Exonic
1134369606 16:13610774-13610796 TGTGGAGCCCAGCCAAGAGAAGG - Intergenic
1134691714 16:16195069-16195091 GGTAAACACCAGCCCACAGCAGG + Intronic
1134834650 16:17350789-17350811 GGTTAATCGAAGCCCAGAGCCGG + Intronic
1135425906 16:22335766-22335788 TGTGAGGGCCAGCCCAGTGCTGG - Intergenic
1136145220 16:28312467-28312489 AGTGCTGTCCAGCCCAGAGCTGG + Intronic
1136478379 16:30526752-30526774 AGTGCAGCCCAGCCCGGGGCCGG - Intronic
1136579414 16:31142702-31142724 GGTGCCGCCCGGCCCAGCGCCGG + Intronic
1136884461 16:33923104-33923126 GGTGATGCCCATCCCCGGGCTGG + Intergenic
1137444362 16:48522802-48522824 GGGGAAGCTCAGCCTAGAGCTGG - Intergenic
1138456721 16:57125273-57125295 GGAGAAGCCTGGCCCAGGGCTGG - Intronic
1138473900 16:57259330-57259352 TGTGAGGCCCAGCCCAGGACTGG - Intronic
1138598818 16:58043270-58043292 GGGGATGCCCAGGCCATAGCTGG - Exonic
1141194062 16:81846324-81846346 GGTGAAGCCCATCCCTAAGTGGG + Intronic
1141628200 16:85272572-85272594 GGTGGAGCCGTGCTCAGAGCTGG + Intergenic
1141749269 16:85947287-85947309 GGCCAAGTCCAGCCCAGAGTGGG - Intergenic
1142123338 16:88397958-88397980 GGTTCTGCCCTGCCCAGAGCCGG + Intergenic
1142298544 16:89242921-89242943 GTTGCTGACCAGCCCAGAGCTGG - Intergenic
1143030558 17:3964725-3964747 GGCGACGCGCAGCCCAGAGCCGG - Intergenic
1143116846 17:4585855-4585877 GGTCCAGCCCAGCCCACAGCGGG - Intronic
1143374872 17:6461578-6461600 GGTCCAGCCCTGCCCAGTGCAGG + Intronic
1143624937 17:8104272-8104294 GGTGAGCCCCAGTCCTGAGCTGG - Intronic
1145265884 17:21379420-21379442 GGAAGGGCCCAGCCCAGAGCTGG - Intronic
1145888657 17:28399566-28399588 CTGGAAGCCCAGCCCACAGCAGG - Exonic
1147145631 17:38482845-38482867 GGTGATGCCCATCCCCGGGCTGG - Intronic
1147449718 17:40496395-40496417 GGTGATGTCCAGCCCACTGCTGG - Exonic
1148587672 17:48792305-48792327 TGTAATGCCCAGCTCAGAGCTGG - Intronic
1148737227 17:49871603-49871625 GGCGAAGCACAGCCCTGACCTGG + Intergenic
1149913457 17:60587124-60587146 GTTCAAGACCAGCCTAGAGCTGG - Intergenic
1150281400 17:63931423-63931445 GGGGCAGCCCAGGCCAGAGGAGG - Intronic
1150437449 17:65165045-65165067 CCTGGAGCCCAGCCCAGTGCTGG - Intronic
1151569901 17:74921003-74921025 GATGGGGCCCAGCACAGAGCTGG + Intronic
1152069497 17:78127908-78127930 TGGGAAAACCAGCCCAGAGCTGG + Intronic
1152836849 17:82538793-82538815 ACTGAGGCCCAGCCCAGAGAAGG + Intronic
1154489469 18:14908676-14908698 TGTGGAGCCCAGCTCAGAGCAGG + Intergenic
1154501403 18:14999600-14999622 GGTGTTGCCCAGCCGAGGGCGGG - Intergenic
1158980260 18:62753670-62753692 GGTGAAGCCCATCCTAGAGTGGG - Intronic
1159985538 18:74836529-74836551 GGCAAAGCCCAGGCCAGATCTGG - Intronic
1160143671 18:76347608-76347630 GATGGAGCTCAGCCTAGAGCAGG - Intergenic
1161196215 19:2987974-2987996 GGTGAGACCCAGGCCCGAGCTGG + Exonic
1161327116 19:3669289-3669311 ACTGCTGCCCAGCCCAGAGCAGG - Intronic
1161629683 19:5346698-5346720 CATGGAGCCCAGCACAGAGCAGG - Intergenic
1162020033 19:7864143-7864165 GCTGATGTCCAGCCCAGAGCTGG - Intronic
1163362961 19:16859624-16859646 CCTGAAGAACAGCCCAGAGCAGG + Intronic
1163580750 19:18137279-18137301 GGAGAAGCCCTGCCCAGTCCAGG - Exonic
1164176944 19:22783760-22783782 GGTGAAGAGCGGCCCAGAGAGGG + Intronic
1165079775 19:33300688-33300710 GGGGAAGCCCAGCCTATAGCAGG + Exonic
1165161908 19:33821206-33821228 GTAGAAGCCCAGCCCAGGGAGGG + Intergenic
1165347359 19:35257310-35257332 GGAGAAGCCCAGCCCACAGGGGG + Intronic
1165482333 19:36071971-36071993 GGTGAAGAACAGTGCAGAGCAGG + Intronic
1165487173 19:36103021-36103043 GGCGGAAGCCAGCCCAGAGCAGG + Exonic
1165779738 19:38425579-38425601 GATGAAGCCCATTCCAGAACCGG + Intronic
1166213671 19:41322682-41322704 GGATGCGCCCAGCCCAGAGCTGG + Exonic
1166752553 19:45171380-45171402 GCCAGAGCCCAGCCCAGAGCCGG + Intronic
1167278361 19:48552323-48552345 GGTGAGGCCCAGACCTGGGCAGG + Exonic
1167455047 19:49593458-49593480 GGGGAGGGCCAGCCCAAAGCGGG - Intronic
1167605526 19:50479850-50479872 GGCAAAGCCCAGCCCAGCGATGG - Intronic
1167743280 19:51337396-51337418 GTGGAAGTCCTGCCCAGAGCAGG + Exonic
1168644929 19:58053708-58053730 GGTGAAGACCATCCCACAGTCGG - Exonic
926171131 2:10553183-10553205 TGAGAAGCCCAGCCCACAGTGGG + Intergenic
926612248 2:14958220-14958242 GGAGAAGCCCAGGTGAGAGCAGG + Intergenic
927854478 2:26519220-26519242 TCTCCAGCCCAGCCCAGAGCTGG - Intronic
928606285 2:32947354-32947376 CGAGGAGCCCTGCCCAGAGCAGG - Exonic
931200883 2:60096396-60096418 GGTGAACTCCAGCCTAGACCTGG - Intergenic
931943430 2:67278476-67278498 GGTGAGGTACAGCCCACAGCAGG - Intergenic
934573343 2:95385360-95385382 GGAGAATGCCAGCCCAAAGCTGG + Exonic
934678471 2:96266075-96266097 CGTGAGGCCCTGCGCAGAGCCGG - Intergenic
935677041 2:105603688-105603710 TGACAAGCCCAGCCCAGAGCTGG + Intergenic
936090788 2:109500233-109500255 GGTGAGGCCCAGCCAAGAAGAGG + Intronic
937224004 2:120357800-120357822 GCTGCAGTGCAGCCCAGAGCAGG - Intergenic
937238253 2:120443363-120443385 AGTCAAGCTCAGCCCAGGGCTGG + Intergenic
943743358 2:191435396-191435418 TATGAATCCCAGCCCACAGCTGG + Intergenic
946950323 2:224867361-224867383 GGTGCAGGGCAGCCCAGAGGAGG - Intronic
947681577 2:232038398-232038420 GGTGTAGAGCAGACCAGAGCAGG + Intronic
947809786 2:232997132-232997154 GGTGATCCCCAGGCCAGTGCCGG - Intronic
948066862 2:235087516-235087538 GGGAGAGCCCAGCCCGGAGCAGG - Intergenic
948082862 2:235220640-235220662 GTCACAGCCCAGCCCAGAGCAGG + Intergenic
948706035 2:239792974-239792996 AGTGGAGCCCAGCCTGGAGCGGG - Intronic
948762466 2:240200717-240200739 GGTGAAGCCCCGCACTGACCCGG - Intergenic
1168916261 20:1490901-1490923 GGTGAGGCTCAGCCCTGGGCCGG - Intronic
1169080969 20:2797582-2797604 GGGGAAGCCAATCCTAGAGCTGG + Intronic
1169141125 20:3228051-3228073 GGAGGAGCCCAGCCTAGAGGTGG - Intronic
1170671932 20:18442043-18442065 CTAGAAGCCCAGCTCAGAGCAGG + Intronic
1171449788 20:25227214-25227236 GGTGGAGGCCTGCACAGAGCAGG + Intergenic
1172272720 20:33663608-33663630 CGGGGAGCCCAGCCCAGCGCCGG - Exonic
1172885717 20:38229585-38229607 CATGAAGCCAAGCCCAGAGCAGG + Intronic
1173331369 20:42078707-42078729 GGGGGAGGCCAGCCCAGTGCGGG - Exonic
1173642956 20:44616290-44616312 GGAGAAGCTCAGTCTAGAGCAGG - Intronic
1174254940 20:49247540-49247562 TGAGATGCCCAGGCCAGAGCAGG + Exonic
1174368156 20:50068709-50068731 GCTGCACCCCAGCCCAGAGTGGG - Intergenic
1175271164 20:57735080-57735102 GGGGGCCCCCAGCCCAGAGCAGG - Intergenic
1175716352 20:61256702-61256724 TGTGCAGCCCAGCCCAGGGCTGG + Intronic
1176025713 20:62984480-62984502 GGAGCAGCCAAGCCCTGAGCTGG + Intergenic
1176038131 20:63050196-63050218 AGGGAAGCCCGGCCCAGGGCAGG + Intergenic
1176062736 20:63179307-63179329 GGTCCTGCACAGCCCAGAGCCGG - Intergenic
1176063487 20:63182422-63182444 GGTGGGGCCCAGCCCGGGGCTGG + Intergenic
1176111024 20:63410780-63410802 AATGAAGCCCAGGCCTGAGCTGG - Intronic
1176231129 20:64033473-64033495 GGAGAGGCCCTGCGCAGAGCTGG - Intronic
1176271817 20:64239345-64239367 GGTGAAGCTAAGACCACAGCAGG + Intronic
1176284494 21:5012344-5012366 AATGAAGCCCTGCCCAGTGCTGG - Intergenic
1178492056 21:33058682-33058704 GCTGGAACCCAGCCCAGGGCAGG + Intergenic
1179872687 21:44251131-44251153 AATGAAGCCCTGCCCAGTGCTGG + Intronic
1180055014 21:45353075-45353097 GGTGAAACCGGGCCCAGTGCAGG - Intergenic
1180949694 22:19715456-19715478 GGTGAAACCCAGCCGAGCTCAGG + Intronic
1180960981 22:19762228-19762250 GGTGAAGCCCAGCGCCGACAAGG - Intronic
1180968595 22:19803216-19803238 TGTGAACCCGAGGCCAGAGCTGG + Intronic
1181050894 22:20237754-20237776 GGAGCGGCCTAGCCCAGAGCAGG + Intergenic
1181477758 22:23179459-23179481 GGTGGAAGACAGCCCAGAGCAGG - Intergenic
1181745080 22:24950564-24950586 AGAGATGCCCAGCCCAGACCGGG - Intergenic
1183376099 22:37466341-37466363 GGTGGAGCCCAGGCCTGAGGAGG + Intergenic
1183432653 22:37774983-37775005 GGTCATGCCCAGCCCTGGGCAGG + Exonic
1183615052 22:38938980-38939002 GGAGAGGCCGAGCCCTGAGCAGG + Intergenic
1184354177 22:43967557-43967579 GGTGAAGGCAGGCCCAGTGCAGG - Intronic
1184453598 22:44597072-44597094 GGAGCAGCCCTGCCCAGAGAGGG + Intergenic
1184474310 22:44712297-44712319 GATGAAGCCCTGGGCAGAGCTGG + Intronic
1184931009 22:47681419-47681441 GAGGAAGCCCAGCTCAGAGCAGG - Intergenic
949289517 3:2448154-2448176 AGCGTAGCCAAGCCCAGAGCAGG + Intronic
949819103 3:8095885-8095907 AGTGAAGTCCAGCCCATTGCTGG - Intergenic
950034686 3:9877017-9877039 GCTGAATCCCAGCTCACAGCTGG + Intronic
950175121 3:10868142-10868164 GGTAAATGCCAGCCCAGAGAGGG + Intronic
950540192 3:13607840-13607862 GGAGGAGCCCAGCCCATAACAGG - Intronic
950556087 3:13696866-13696888 CCTGGAGCCCAGTCCAGAGCTGG - Intergenic
952217342 3:31290670-31290692 GGTGAAGCCCAGCCCAGGTATGG + Intergenic
954693256 3:52407037-52407059 GGTGAAACCCCAGCCAGAGCCGG + Intronic
961158307 3:124700033-124700055 GGTGAGTCCCAGCCCAGCCCTGG + Intronic
961756224 3:129128686-129128708 GGAGAAGCCCATCACACAGCGGG - Intronic
961920339 3:130418675-130418697 TGTCTAGCACAGCCCAGAGCTGG - Intronic
963515404 3:146301850-146301872 GGTGAGGCCCAGCACTGTGCTGG + Intergenic
967875811 3:194267885-194267907 GTTGAGGCCCAGCCCAGAGAGGG + Intergenic
967924756 3:194637387-194637409 GTGTAAGCCCAGCCCAGAGTAGG - Intergenic
968656590 4:1780978-1781000 CGTGGTGTCCAGCCCAGAGCCGG + Intergenic
968830745 4:2931993-2932015 GGGGAAGCCCAGGGGAGAGCAGG + Intronic
969281298 4:6172450-6172472 GAAGAAACCCAGGCCAGAGCTGG - Intronic
969339049 4:6529042-6529064 GGTTCAGAGCAGCCCAGAGCTGG + Intronic
969622453 4:8285570-8285592 CGTGGGGCCCAGCCCAGAGCAGG - Intronic
969626143 4:8306672-8306694 GGTGGGGTCCAGCCCAGAGCAGG + Exonic
969660785 4:8526267-8526289 GGTGCAGCCCATCTCAGAGACGG + Intergenic
970969425 4:21964214-21964236 GCTGAATCCCAGCGCAGAACTGG - Intergenic
974062008 4:57043833-57043855 GGTGAGGCCCAGCCCTTTGCAGG - Intronic
975053547 4:69897861-69897883 GGTGTAGGCCAGGCAAGAGCAGG + Intergenic
978384395 4:108166558-108166580 TTTGAAGCCTAGTCCAGAGCTGG - Intronic
982758286 4:159250864-159250886 GGCCACGCCCAGCCCAGAGAGGG - Intronic
984956774 4:185053188-185053210 GGTGAGGCCCTGCCCCGACCTGG + Intergenic
985656903 5:1137085-1137107 AGTGTTTCCCAGCCCAGAGCTGG + Intergenic
985677333 5:1238800-1238822 GGTGGAGTCGGGCCCAGAGCAGG - Intronic
986169827 5:5306611-5306633 GCCGAAGCCCAGCCTGGAGCTGG + Exonic
986804278 5:11293920-11293942 GAACCAGCCCAGCCCAGAGCTGG + Intronic
987377095 5:17246117-17246139 GGCCAAGCCCATCCCACAGCTGG - Intronic
988772558 5:34447476-34447498 AGAGATGCCCTGCCCAGAGCAGG + Intergenic
990510525 5:56485362-56485384 GGTGCAGCCTTGCCCAGATCAGG + Intergenic
992620723 5:78589802-78589824 CCTGATGCCCAGTCCAGAGCAGG + Intronic
995263732 5:110135539-110135561 GCTGAAGCTGAGCCCACAGCTGG + Intergenic
996958639 5:129216516-129216538 TGTAAAGCCCAGCACTGAGCAGG - Intergenic
997226123 5:132210706-132210728 TGTGAACCCCAGTCCAGGGCAGG - Intronic
997434529 5:133864881-133864903 GGAGCTTCCCAGCCCAGAGCAGG + Intergenic
997697942 5:135876074-135876096 GGTGAAGCCCAGCCCTGGTGCGG + Intronic
998128340 5:139638668-139638690 TGCAAAGCCCAGCCCAGTGCCGG + Intergenic
998171533 5:139874744-139874766 GGTGAAGCCCAGATAAGACCTGG - Intronic
1001425856 5:171621961-171621983 GTTGCTGCCCTGCCCAGAGCTGG + Intergenic
1001435854 5:171698762-171698784 GGAGAGGCCCAGCACAGGGCAGG + Intergenic
1002182430 5:177437685-177437707 GTTGAAGGCCAGGCAAGAGCTGG - Intronic
1004466199 6:15887556-15887578 AGTGAAGCTCAGCAGAGAGCTGG + Intergenic
1006909805 6:37556637-37556659 TGAGAAGCCCAGCCCAGAAGAGG + Intergenic
1008191014 6:48457251-48457273 GGTGAAGCAGAGGCCAGAGAAGG + Intergenic
1010192491 6:73208764-73208786 GGGGAGGCCCAGCCCAGGGAAGG - Intergenic
1010194148 6:73223446-73223468 GGGGAGGCCCAGCCCAGGGAAGG - Intronic
1011624509 6:89272118-89272140 GCAGGTGCCCAGCCCAGAGCTGG - Intronic
1012388608 6:98710335-98710357 GGTGACACCCAGCTCAGAGTAGG - Intergenic
1013667877 6:112366707-112366729 GGAGCAGCCCAGCCAGGAGCAGG - Intergenic
1018736245 6:166689058-166689080 GCCGAAGGCCAGCCCTGAGCAGG + Intronic
1018746181 6:166764186-166764208 GCTGAGCCCCAGCTCAGAGCTGG + Intronic
1018913390 6:168117330-168117352 CGTGAAGCCCAGCCCTAAACAGG - Intergenic
1019321217 7:416163-416185 GGTGAGGCCCAGCCCCGTGGTGG - Intergenic
1019322159 7:420711-420733 GGGGAAGGCCAGCCTGGAGCTGG - Intergenic
1019530166 7:1499274-1499296 GGAGAAGCTGAGCCCCGAGCAGG - Exonic
1019572466 7:1719425-1719447 GGGGCTGCCTAGCCCAGAGCCGG - Intronic
1019637436 7:2083561-2083583 GGTGGAGGCCAGCGCAGGGCGGG + Intronic
1019693759 7:2432974-2432996 GGCGCAGCCCAGACCAGGGCCGG + Exonic
1019701337 7:2476213-2476235 GGTGAAGGTCCCCCCAGAGCTGG - Intronic
1019703759 7:2487855-2487877 GGAGGAGCCCAGCCCAGAGCTGG + Intergenic
1020139240 7:5603706-5603728 GGGGATGCCCAGCACAGAGCAGG - Intronic
1020571200 7:9864508-9864530 AGTGAAGCCCTCTCCAGAGCAGG - Intergenic
1022481590 7:30746971-30746993 GGTGATGCCCAGCACACAGTAGG - Intronic
1022570962 7:31453932-31453954 GGTGAATGCCATCCCAGATCAGG + Intergenic
1023541748 7:41273525-41273547 GGCAAAGCCAAGGCCAGAGCAGG + Intergenic
1023654377 7:42404965-42404987 GATGAAGGCCTGCCAAGAGCTGG + Intergenic
1024250968 7:47505433-47505455 GGGGAAGCCCTCTCCAGAGCAGG + Intronic
1024844660 7:53628526-53628548 TGTGAACCCTAGCCCAGAGAGGG + Intergenic
1026046738 7:66910946-66910968 GAGGAAGTCCAGCCCACAGCTGG - Intergenic
1026890993 7:73982404-73982426 GGTGAACCGCAGCCCACAGGAGG + Intergenic
1026966958 7:74446198-74446220 CGTGATGCCCAGCACAGAGAGGG + Intergenic
1028883988 7:95911303-95911325 GGAGAAGTCCAGTCCAGAGGAGG + Intronic
1029604065 7:101588030-101588052 ATTGCTGCCCAGCCCAGAGCAGG - Intergenic
1031921862 7:127608331-127608353 GCTGAAGCCTTGCACAGAGCCGG - Intergenic
1032440697 7:131940937-131940959 GGTGAACCCATGCCCAGAGCAGG - Intergenic
1035606800 8:934717-934739 GGTGGACCCCAGCCCTGTGCCGG + Intergenic
1036654607 8:10670075-10670097 GGTGAAGCCAAGGCCAGTGTGGG + Intronic
1036711709 8:11083560-11083582 GGGGAAACCCAGCCCAGCACTGG - Intronic
1036791617 8:11725022-11725044 CGTGAAGGCCACCCCTGAGCGGG - Intronic
1037845639 8:22279495-22279517 GGTGCTCCCCTGCCCAGAGCTGG - Exonic
1037879889 8:22567368-22567390 GGTGGAGCCTAGCCCAGGGGAGG + Intronic
1038196437 8:25372594-25372616 GGCGAAGACCTCCCCAGAGCTGG - Exonic
1038251802 8:25911888-25911910 GGTGACGCCGTGCCCAGAGTGGG + Intronic
1039443904 8:37614949-37614971 AATGAATCCCAGCCCAGAGTCGG - Intergenic
1039454388 8:37697645-37697667 GCCCAAGCCCAGCCCGGAGCCGG + Exonic
1040548526 8:48420729-48420751 GGTGCAGCAGAGCCCAGAGGAGG + Intergenic
1047965344 8:130042296-130042318 AGAGGAGCCAAGCCCAGAGCAGG - Intergenic
1048508703 8:135043332-135043354 GCTGTAGCTCAGCCCAGATCTGG - Intergenic
1049624794 8:143615154-143615176 GGTGGGGCCCAGCCCTGAGCTGG - Intronic
1051355306 9:16234923-16234945 GCTGCAGCCCTGCACAGAGCTGG + Intronic
1059411652 9:114136354-114136376 GATGGAGCCAAGCCCAGAGAGGG + Intergenic
1060201748 9:121655435-121655457 GCTGAAGCCCAGCACATAGTAGG - Intronic
1061119099 9:128632342-128632364 GGCCAGGCTCAGCCCAGAGCAGG + Intronic
1061376213 9:130226313-130226335 AGACAAGCCCAGCCCAGGGCCGG - Intronic
1061727118 9:132587977-132587999 GTTGAAGCCTGGCCCAGACCGGG + Intronic
1062046010 9:134424884-134424906 GGTGAGGCCCCGCCCAGCTCCGG + Intronic
1062195149 9:135268931-135268953 GGTGACTTCCAGCACAGAGCTGG + Intergenic
1203759475 EBV:4627-4649 GGTGCAGCACGGCCCAGAGACGG + Intergenic
1185680560 X:1885379-1885401 CCTGGAGCCCAGCGCAGAGCTGG + Intergenic
1186674831 X:11805110-11805132 AGTGAAGCCCAGAGCAGAACTGG - Intergenic
1189787163 X:44569403-44569425 GATGATGCCCTACCCAGAGCTGG + Intergenic
1190423609 X:50310758-50310780 GGAGAAGCCCAGCATTGAGCAGG + Exonic
1190423617 X:50310812-50310834 GGAGAAGCCCAGCACTGAGAAGG + Exonic
1190959857 X:55235134-55235156 GGTGCAGCCCAGCCCATGGAGGG - Intronic
1192082756 X:68064007-68064029 GTTGGAGCCCTGCCCAGAGGTGG - Exonic
1192362863 X:70450160-70450182 GCTGAAACCCAGGCCTGAGCGGG - Exonic
1195559329 X:106265755-106265777 GGTGAAACCCAGCACTGTGCTGG - Intergenic
1196966887 X:121065803-121065825 GATGATGCCCTTCCCAGAGCTGG + Intergenic