ID: 919994629

View in Genome Browser
Species Human (GRCh38)
Location 1:202737384-202737406
Sequence GTTGCCGATGCTAATACTGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 59
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 54}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
919994628_919994629 -8 Left 919994628 1:202737369-202737391 CCAGGTAAAGCTGCTGTTGCCGA 0: 1
1: 0
2: 2
3: 10
4: 125
Right 919994629 1:202737384-202737406 GTTGCCGATGCTAATACTGCTGG 0: 1
1: 0
2: 0
3: 4
4: 54
919994625_919994629 19 Left 919994625 1:202737342-202737364 CCATAAATTTGCACTTCTAACAA 0: 1
1: 0
2: 37
3: 280
4: 943
Right 919994629 1:202737384-202737406 GTTGCCGATGCTAATACTGCTGG 0: 1
1: 0
2: 0
3: 4
4: 54
919994627_919994629 -7 Left 919994627 1:202737368-202737390 CCCAGGTAAAGCTGCTGTTGCCG 0: 1
1: 0
2: 5
3: 27
4: 303
Right 919994629 1:202737384-202737406 GTTGCCGATGCTAATACTGCTGG 0: 1
1: 0
2: 0
3: 4
4: 54

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
919994629 Original CRISPR GTTGCCGATGCTAATACTGC TGG Intronic
912542351 1:110426571-110426593 GTTGGCATTGCTAATACTGGGGG - Intergenic
919994629 1:202737384-202737406 GTTGCCGATGCTAATACTGCTGG + Intronic
1065319946 10:24499914-24499936 CTTGGCGATGCTGATGCTGCTGG - Intronic
1072938288 10:99733921-99733943 CTGGCCGATGCTGATGCTGCCGG - Intronic
1073882796 10:108003027-108003049 GTTGCAGATGATATTACTTCTGG + Intergenic
1085321872 11:75579678-75579700 GTTGCAGATGCTATTATTCCAGG + Intergenic
1091585417 12:1813333-1813355 GTTGCCGATGCTGCTAGTCCAGG + Intronic
1093746168 12:22742952-22742974 ATAGGTGATGCTAATACTGCTGG - Intergenic
1095107473 12:38252559-38252581 GTTGCAGCTGCAAACACTGCTGG + Intergenic
1096071547 12:48778110-48778132 GCTGCCGATTCTCATGCTGCAGG + Exonic
1097872170 12:64610625-64610647 GTAGCCGCTGCTCATGCTGCCGG - Exonic
1105942020 13:25156160-25156182 GTTGCCCCTCCTAATGCTGCAGG + Intergenic
1106706658 13:32287741-32287763 GTGAGCAATGCTAATACTGCTGG + Intronic
1112586204 13:100721094-100721116 GCCGCCGATGCTAAGGCTGCTGG + Intergenic
1117072412 14:52068913-52068935 GCTGCCGTTGCTAATGTTGCGGG - Exonic
1126223175 15:46239006-46239028 GATGCTGATGCTGATGCTGCTGG - Intergenic
1126966729 15:54062655-54062677 CTTGTTGATGCTCATACTGCTGG - Intronic
1137572241 16:49574483-49574505 GCTGCTGATGCTGATGCTGCTGG + Intronic
1144394104 17:14826849-14826871 GGTGCTGATGCTGATGCTGCTGG - Intergenic
1155173168 18:23282168-23282190 TTTGCCTTTGCTAATCCTGCGGG + Intronic
1157710433 18:49846350-49846372 GATGCTGATGCTGATGCTGCTGG + Intronic
926972739 2:18483274-18483296 GTTGCCCATGCTATTCCTCCAGG + Intergenic
928947469 2:36784389-36784411 GATGCTGATGCTGATTCTGCTGG - Intronic
934832861 2:97549244-97549266 GATGCTGATGCTGATGCTGCTGG - Intronic
938551298 2:132384763-132384785 GATGCCGATGCCCATGCTGCCGG - Intergenic
1168775306 20:442262-442284 GTTGCTGCAGTTAATACTGCTGG + Intronic
1173475618 20:43357078-43357100 GCTGGCGATGCTAATGTTGCTGG + Intergenic
1175677772 20:60961616-60961638 TCTGCGGATGCTGATACTGCTGG - Intergenic
1177431626 21:20997925-20997947 GATGCTGATACTGATACTGCAGG - Intergenic
1183417960 22:37693347-37693369 GTTGCCGCTGCTGTTTCTGCTGG + Exonic
953891045 3:46751746-46751768 CTGGCTCATGCTAATACTGCTGG - Intronic
955779867 3:62472935-62472957 CGTGGCGATGCTAATGCTGCTGG - Intronic
957337986 3:78857568-78857590 GATGCTGATGCTGATGCTGCTGG - Intronic
963415228 3:144986469-144986491 CTTGCAGATGCTAATTCTGTAGG + Intergenic
964046549 3:152335040-152335062 GCTGCTGCTGCTAATATTGCTGG + Intronic
964771192 3:160225695-160225717 GCTGCCGCTGCTGCTACTGCTGG + Exonic
966072604 3:175896776-175896798 GTGGCAGAGGCTCATACTGCTGG - Intergenic
971796575 4:31236259-31236281 GTTGCTGATGCTCGTAATGCTGG - Intergenic
984663334 4:182397809-182397831 GTTGCTGATGTTGATGCTGCTGG + Intronic
990856667 5:60274893-60274915 GTCACAGATGCTAATACTGCTGG - Intronic
994540757 5:101093233-101093255 GTTGCCTAAGATAGTACTGCTGG + Intergenic
998002491 5:138636051-138636073 GATGCGGATGCCAATACTGCTGG + Intronic
1003412804 6:5880448-5880470 TGTGCCGATCCTAATAATGCTGG - Intergenic
1004667830 6:17764731-17764753 GTAGCCACTGGTAATACTGCTGG + Exonic
1007672042 6:43563666-43563688 GTTACCGTAGCCAATACTGCAGG + Intronic
1011755109 6:90490684-90490706 CATGGAGATGCTAATACTGCTGG + Intergenic
1011913270 6:92468713-92468735 CTTGGTGATGCTACTACTGCTGG + Intergenic
1014305431 6:119735520-119735542 GATGAAGATGCTAATACTGGAGG + Intergenic
1021027057 7:15682852-15682874 GTTGGCTTTGCTAATAATGCTGG + Intronic
1028023933 7:85812883-85812905 GTTGCCGTTGCTAATAGAGATGG - Intergenic
1041503542 8:58567459-58567481 GGTGCAGATGCTGATACTGGGGG - Intronic
1046166549 8:110443781-110443803 GTCTCCTTTGCTAATACTGCAGG - Intergenic
1186283614 X:8020843-8020865 GTTGCTGAAGCTAATAGTTCAGG - Intergenic
1187564012 X:20430424-20430446 GTTGCTGATGCTACTGCTGCTGG - Intergenic
1187617543 X:21013943-21013965 GATGCTGATGCTGATGCTGCTGG + Intergenic
1189136203 X:38552796-38552818 GTTGCTGCTGCTATTACTGCTGG + Intronic
1192370863 X:70511899-70511921 GTTGCCCAGGTTAATACTCCTGG + Intergenic
1201442037 Y:14018702-14018724 GTTGCTGAAGCTAATAGTTCAGG - Intergenic
1201442533 Y:14024005-14024027 GTTGCTGAAGCTAATAGTTCAGG + Intergenic