ID: 920002207

View in Genome Browser
Species Human (GRCh38)
Location 1:202807862-202807884
Sequence CGGCGGTGCCATGGGAGGGC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 280
Summary {0: 1, 1: 0, 2: 1, 3: 21, 4: 257}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
920002207_920002221 17 Left 920002207 1:202807862-202807884 CCGGCCCTCCCATGGCACCGCCG 0: 1
1: 0
2: 1
3: 21
4: 257
Right 920002221 1:202807902-202807924 ACGCTCCTCATCTCCCACCCTGG 0: 1
1: 0
2: 11
3: 1024
4: 2942

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
920002207 Original CRISPR CGGCGGTGCCATGGGAGGGC CGG (reversed) Intronic
900014263 1:137720-137742 TGGAGATGCCATCGGAGGGCAGG + Intergenic
900044126 1:492922-492944 TGGAGATGCCATCGGAGGGCAGG + Intergenic
900065535 1:727828-727850 TGGAGATGCCATCGGAGGGCAGG + Intergenic
901785654 1:11622805-11622827 CGGAGGGGCCATGGGAAGACAGG + Intergenic
901788155 1:11638246-11638268 CTGGGGTTCCCTGGGAGGGCGGG + Intergenic
902365167 1:15968429-15968451 TGGCGGTCTCATGGGAAGGCAGG + Intronic
902431543 1:16367320-16367342 CCGCCGTCCCATGGCAGGGCCGG + Intronic
902721962 1:18309770-18309792 CCAGGGTGCCCTGGGAGGGCTGG + Intronic
902863260 1:19260791-19260813 CGGCGGGGCCATGGCTGGGAGGG - Intergenic
902923979 1:19683488-19683510 CGGAGGTCCCTGGGGAGGGCTGG - Intronic
903235756 1:21949602-21949624 TGTCTGTGCCAGGGGAGGGCTGG - Intergenic
903474030 1:23607234-23607256 AGGGGGCGCCACGGGAGGGCAGG - Intronic
905252049 1:36655803-36655825 CGGAGCTGCCATGGGAGAGAAGG - Intergenic
905789958 1:40784451-40784473 CGGCCGTGCCCCGGGAGGCCAGG - Intronic
905885772 1:41491111-41491133 CAGAGGTGCCAAGGGTGGGCTGG - Intergenic
906528730 1:46511293-46511315 GAGGGGTACCATGGGAGGGCTGG + Intronic
912529838 1:110312385-110312407 CAGAGGAGCCATGGGAGGCCAGG - Intergenic
913957507 1:143318839-143318861 AGGCAGTGCCAGGGCAGGGCAGG + Intergenic
914051821 1:144144203-144144225 AGGCAGTGCCAGGGCAGGGCAGG + Intergenic
914127376 1:144822338-144822360 AGGCAGTGCCAGGGCAGGGCAGG - Intergenic
915345005 1:155192959-155192981 CGGCTGTGCCTAGGGCGGGCGGG - Intergenic
917452321 1:175157405-175157427 AGGCGGTGACCAGGGAGGGCTGG + Intronic
918059633 1:181049875-181049897 CAGCGATGCCATGGCAGGCCTGG + Intronic
919705344 1:200670021-200670043 CGGCAGTGGCTTGGGAGGGAGGG + Intergenic
919820829 1:201470858-201470880 GGGAGGAGCCATGGGAGGGCAGG - Intergenic
920002207 1:202807862-202807884 CGGCGGTGCCATGGGAGGGCCGG - Intronic
920195310 1:204222653-204222675 CGGCATTCCCATGGGAGTGCAGG + Exonic
921171943 1:212558454-212558476 CGGCGGGGCCGTGGGAGGGACGG - Intergenic
924350235 1:243107672-243107694 GGGCGGTGCCAGGGGAAGACAGG - Intergenic
1063994979 10:11611198-11611220 CCGCGGGGCGATGGGCGGGCTGG - Intronic
1064103830 10:12484850-12484872 TGGGCGTGTCATGGGAGGGCAGG + Intronic
1069992149 10:72322522-72322544 TGGCGGTTCCATGGGAAGCCAGG + Intergenic
1073025659 10:100485575-100485597 CGGTGGTGGGAGGGGAGGGCAGG + Intergenic
1075533808 10:123253872-123253894 CGGTGGGGCCATGGAAGGGAGGG + Intergenic
1075834579 10:125442945-125442967 CGGCGGTGACAAGGCAGGGAAGG - Intergenic
1076459771 10:130633921-130633943 CGGCCGTGCCATGACAGGGAGGG - Intergenic
1076549429 10:131268127-131268149 CAGTGGTGCCCAGGGAGGGCTGG + Intronic
1076970460 11:129397-129419 TGGAGATGCCATCGGAGGGCAGG + Intergenic
1077278933 11:1733270-1733292 CAGTGGTGGGATGGGAGGGCAGG - Exonic
1078142421 11:8702039-8702061 GGGCTGGGCAATGGGAGGGCTGG - Intronic
1078402931 11:11044241-11044263 TGGGTGTGGCATGGGAGGGCAGG - Intergenic
1081787699 11:45759007-45759029 CGGTGGTGACATGGCAGAGCTGG - Intergenic
1081887253 11:46508440-46508462 GGGAGATGCCATGGGAGAGCTGG - Intronic
1083886973 11:65577665-65577687 AGGGGGTGCCTAGGGAGGGCAGG - Intronic
1083895214 11:65616302-65616324 CGGCGGGGCCATGGGGTCGCAGG + Exonic
1084385442 11:68840878-68840900 CGGCGGGGCCGCGGGAGGGTGGG - Intronic
1084431863 11:69115750-69115772 CGGCGGTGCCAGGACAGGGAGGG + Intergenic
1084478237 11:69400918-69400940 CTGCAGTGCCAGGAGAGGGCAGG - Intergenic
1084704136 11:70806179-70806201 GGGCCTTGCCATTGGAGGGCAGG - Intronic
1085454828 11:76659915-76659937 AGGCAGTGCCATGGGTGGCCTGG - Exonic
1086064805 11:82733366-82733388 CGGCGGCGCTCGGGGAGGGCGGG + Exonic
1090066774 11:123510302-123510324 TGGCGGGGTGATGGGAGGGCAGG + Intergenic
1091216016 11:133902702-133902724 CGACGGTGTCCTGGCAGGGCTGG - Intergenic
1091601835 12:1922506-1922528 CAGCAGTCCCGTGGGAGGGCTGG + Intergenic
1091750895 12:3020678-3020700 CGGCCCTGCCATGGGGGTGCCGG - Exonic
1097007960 12:55932283-55932305 CGGGGGTGCAGCGGGAGGGCTGG + Intronic
1097189485 12:57212633-57212655 CGGCGGGGCCAGGGAAGGGCTGG - Exonic
1097232955 12:57523119-57523141 CGGCGGGGGCAGGTGAGGGCGGG - Intronic
1102029408 12:109731359-109731381 TGGCTGTGCTGTGGGAGGGCCGG - Intronic
1103563539 12:121804463-121804485 CGGGGGTCCCCTGGGCGGGCTGG - Intronic
1103794114 12:123491503-123491525 AGGGGCTGCCGTGGGAGGGCAGG - Intronic
1105550839 13:21394383-21394405 GGGCGGTGGCATGATAGGGCAGG - Intronic
1106110524 13:26772698-26772720 CCGCGATGCCCTGGGAGGGAAGG - Intergenic
1106396254 13:29383741-29383763 GGACTGTGCCAAGGGAGGGCAGG + Intronic
1112299034 13:98213543-98213565 CAGCGGGGCCATTGGGGGGCGGG - Intronic
1113596923 13:111540046-111540068 CAGCGGTGCCCTGGGGGTGCTGG - Intergenic
1113743307 13:112725653-112725675 TGGCTGGGGCATGGGAGGGCTGG - Intronic
1115399214 14:32939034-32939056 CGGCGGCGCGAGGGGACGGCCGG + Intronic
1115592271 14:34875199-34875221 AGGCGGTCCCCTGGGAGGACGGG - Exonic
1119732057 14:76957214-76957236 TGGGGGTGCCAGGGGAGGGAAGG - Intergenic
1119788216 14:77328122-77328144 CGGGGGTGTCAAGGGAGGGAGGG + Intronic
1122081805 14:99272039-99272061 CCGCGGCGCCAGGGGAGCGCTGG - Intergenic
1122365917 14:101194794-101194816 CGGCGGTGGGCTGGGAGGCCTGG - Intergenic
1122417658 14:101558074-101558096 TGGCAGAGCCAGGGGAGGGCTGG - Intergenic
1122888037 14:104719248-104719270 AGGCAGTGCCATGGCAGGCCAGG + Exonic
1202930877 14_KI270725v1_random:31251-31273 AGGCAGTGCCAGGGCAGGGCAGG - Intergenic
1123443574 15:20306354-20306376 AGGCAGTGCCAGGGCAGGGCAGG - Intergenic
1126456651 15:48869786-48869808 CGGCGGTGCCATGGCTTGGTTGG - Intronic
1129218920 15:74119966-74119988 AGGCCGAGCCCTGGGAGGGCTGG - Intronic
1129743217 15:78000276-78000298 CTGCGGTGCCAGGGAAGGGCGGG + Intronic
1129842263 15:78751164-78751186 CTGCGGTGCCAGGGAAGGGGCGG - Intergenic
1130010841 15:80152480-80152502 GGGCGGGGCCAGGGGAGGGGCGG + Intronic
1130193949 15:81761611-81761633 AGGCGGGGCCTGGGGAGGGCTGG - Intergenic
1130194061 15:81762484-81762506 AGGCAGAGCCAGGGGAGGGCTGG - Intergenic
1132593944 16:739780-739802 CGGAGGTTCCCTGGGAGGCCAGG + Intronic
1132623346 16:878705-878727 CGGCGGTGCTCTGGCAGGGGTGG + Intronic
1132845189 16:1997984-1998006 GGGAGGTGCCAGGGGAGGGAAGG - Exonic
1132850002 16:2020628-2020650 CGGAGGCGCCACGGGCGGGCGGG - Exonic
1132900423 16:2251287-2251309 GGGCGGCGCCGAGGGAGGGCGGG - Intronic
1133012946 16:2925051-2925073 CAGCTGCGCCATGGGAGTGCAGG - Intronic
1133102511 16:3487878-3487900 CGCTGGTGCCCTGGGAGGCCAGG + Intergenic
1134689936 16:16184655-16184677 AGACGATGCCAAGGGAGGGCTGG - Intronic
1134861667 16:17565685-17565707 CGGCCATGCCATGGGGAGGCTGG - Intergenic
1136578061 16:31135769-31135791 GGGCGGGGCCAGGGGAGGGGCGG - Intergenic
1139451309 16:67029649-67029671 CGGCGCTGCGCTGGGAGGGCGGG + Intronic
1139548545 16:67661028-67661050 CGGCCGGGCCATGGCGGGGCCGG - Exonic
1141869592 16:86775635-86775657 AGGCGCTGCCATCCGAGGGCGGG + Intergenic
1142262874 16:89050837-89050859 CGCCTGTGCCATCTGAGGGCAGG + Intergenic
1142449789 16:90168085-90168107 TGGAGATGCCATCGGAGGGCAGG - Intergenic
1142457297 17:63761-63783 TGGAGATGCCATAGGAGGGCAGG + Intergenic
1143106718 17:4533910-4533932 CAGGGGTGCCTGGGGAGGGCGGG + Intronic
1143548487 17:7614520-7614542 TGGCGGCGCCATGGGCGGCCTGG - Exonic
1143709965 17:8727376-8727398 AGGAGGTTCCAGGGGAGGGCGGG - Intergenic
1143731583 17:8885450-8885472 AGGTGGGGCCATGGGAGGGCGGG - Intronic
1143731650 17:8885614-8885636 AGGTGGGGCCATGGGGGGGCGGG - Intronic
1143731689 17:8885696-8885718 AGGTGGGGCCATGGGAGGGCGGG - Intronic
1143731704 17:8885729-8885751 AGGTGGGGCCATGGGAGGGCGGG - Intronic
1143731719 17:8885762-8885784 AGGCGGGGCCATGGGAGGGCGGG - Intronic
1143731734 17:8885795-8885817 AGGTGGGGCCATGGGAGGGCGGG - Intronic
1143731803 17:8885959-8885981 AGGCAGGGCCATGAGAGGGCGGG - Intronic
1145264192 17:21371686-21371708 GGGCGGGGCCACGGGAGTGCCGG + Intergenic
1145976265 17:28986066-28986088 CGGCGGGGCCATGCCAGGGCTGG - Intronic
1146402250 17:32509112-32509134 AGGCGGAGCCATCGGTGGGCTGG + Intronic
1146413903 17:32614239-32614261 GGGCGGGGGCATGGAAGGGCAGG - Intronic
1147382011 17:40061852-40061874 CGGCGGGGCCAGGGGGGTGCTGG + Intronic
1148166947 17:45490458-45490480 CGGCGGTGCAGGGGGAAGGCTGG + Intronic
1150398126 17:64836862-64836884 CGGCGGTGCAGGGGGAAGGCTGG + Intergenic
1152251310 17:79214058-79214080 GGGCGGCGCCATGCGAGGGTTGG - Intronic
1152663199 17:81552441-81552463 CGGCGGTGCCGGGGGCGGGCCGG + Intronic
1152716411 17:81902751-81902773 CAGCGGTGCCAGGAGAGGTCCGG - Exonic
1152756020 17:82087385-82087407 TGGCGGTGACACGGGTGGGCAGG + Exonic
1152854710 17:82658216-82658238 CGTCCGAGCCTTGGGAGGGCGGG - Intronic
1152864032 17:82711663-82711685 CGGCGGTGTCGTGGGGGCGCCGG + Intergenic
1153748226 18:8202266-8202288 AGGCATTGCCAAGGGAGGGCTGG - Intronic
1154164114 18:12001389-12001411 TGGCCGTGGCATGGGAGGGCTGG + Intronic
1160033709 18:75282848-75282870 GGGGTGGGCCATGGGAGGGCTGG + Intronic
1160647656 19:200866-200888 TGGAGATGCCATCGGAGGGCAGG + Intergenic
1160766823 19:812545-812567 CGGCGGGGCCGGGGGCGGGCGGG - Exonic
1161059630 19:2208442-2208464 CGGGGGAGCAGTGGGAGGGCGGG - Intronic
1161516475 19:4699472-4699494 TGGGGGTCCCCTGGGAGGGCAGG + Intronic
1161967223 19:7555356-7555378 GGGCGGGGCCAGGTGAGGGCGGG + Exonic
1162199490 19:9010319-9010341 CGTCGGTGCCCTGGGTGTGCAGG + Intergenic
1162380657 19:10329809-10329831 CAGCGGTGAGATGGGAGGGGAGG - Intronic
1162727831 19:12700659-12700681 TGGCGGTGACTGGGGAGGGCTGG - Exonic
1162947394 19:14052179-14052201 GGGCGGTGGCCTGGGCGGGCTGG - Exonic
1163420159 19:17209823-17209845 GGGCGGGGCCTTGGGTGGGCAGG + Intronic
1164639116 19:29811914-29811936 CGGCGGGGCGGTGCGAGGGCGGG + Exonic
1165349863 19:35269510-35269532 CGGCCGCGCCCGGGGAGGGCTGG + Intronic
1165784518 19:38453192-38453214 GGGCGGGGCCTTGGGAGGGGCGG + Intronic
1166945423 19:46393348-46393370 CGGAAGGGCCATGGGAGGGAGGG + Intergenic
1167037833 19:47004407-47004429 CGGCTCCGCCACGGGAGGGCTGG - Exonic
1167281634 19:48572676-48572698 CTGAGGTGCCACAGGAGGGCTGG + Intronic
1167525801 19:49983135-49983157 CTGGGGAGCCATGGGAGGGAGGG - Intronic
1167588291 19:50387582-50387604 CGGGGGTGCGGTGGGAGGGACGG - Intronic
1168069730 19:53942804-53942826 CTCCGGTGCAGTGGGAGGGCCGG + Exonic
1202691216 1_KI270712v1_random:96627-96649 AGGCAGTGCCAGGGCAGGGCAGG + Intergenic
927188082 2:20496961-20496983 CGGATGGGACATGGGAGGGCAGG + Intergenic
931657732 2:64524877-64524899 CGGCGGTGGCCGGGGAGGGAAGG - Intronic
932138035 2:69247732-69247754 CGGCAGTGCCATGGGGTGGGTGG - Exonic
932344913 2:70989051-70989073 CGGAGGTGCCAAGAGTGGGCTGG + Intronic
933955173 2:87357323-87357345 AGGCAGTGCCAGGGCAGGGCAGG - Intergenic
934239364 2:90253538-90253560 AGGCAGTGCCAGGGCAGGGCAGG - Intergenic
934273822 2:91563161-91563183 AGGCAGTGCCAGGGCAGGGCAGG + Intergenic
934461806 2:94216891-94216913 AGGCAGTGCCAGGGCAGGGCAGG - Intergenic
934636185 2:95991973-95991995 CGGAGGTGCCGCGGGAGGGCGGG + Intergenic
934797464 2:97113453-97113475 CGGAGGTGCCGCGGGAGGGCGGG - Intergenic
934835947 2:97589986-97590008 CGGAGGTGCCGCGGGAGGGCGGG + Intergenic
935550241 2:104445280-104445302 CTGTGGTGCCATGGTGGGGCAGG - Intergenic
937094045 2:119224257-119224279 CAGCGGTCCCAAAGGAGGGCTGG + Intronic
938369005 2:130756866-130756888 CTGCCTTGTCATGGGAGGGCTGG - Intronic
948270143 2:236667784-236667806 AGTGGGTGGCATGGGAGGGCTGG + Intergenic
948382983 2:237563979-237564001 CCTTGGTGCCCTGGGAGGGCAGG - Intergenic
948541624 2:238695081-238695103 TGGCGGTGCGAGGAGAGGGCAGG - Intergenic
948567027 2:238893916-238893938 AGGGGGTGTCAAGGGAGGGCTGG - Intronic
1168904591 20:1392986-1393008 CGCCGCCGCCATGGGAGTGCAGG - Exonic
1168990913 20:2095155-2095177 GGGTGGTGCCATGGGAAAGCAGG - Intergenic
1171367023 20:24632139-24632161 GGGCGGTGTCAGGAGAGGGCAGG + Intronic
1171452815 20:25247986-25248008 GGGCGGGGCCTCGGGAGGGCGGG - Intergenic
1173800169 20:45890385-45890407 CGGCCGTGCCATCGGGGCGCGGG + Exonic
1174357970 20:50010620-50010642 CGGAGCTGCCATGGTGGGGCTGG + Intergenic
1175894821 20:62331319-62331341 AGGCGGTACGATGGGGGGGCCGG + Intronic
1176042357 20:63072308-63072330 CCGCGGCCCCCTGGGAGGGCGGG - Intergenic
1176073604 20:63238763-63238785 GGGCTGTGCCATGTGAGGGTGGG + Intronic
1176156951 20:63626830-63626852 CGGCGGGGGGAGGGGAGGGCCGG - Intronic
1176592897 21:8659874-8659896 AGGCAGTGCCAGGGCAGGGCAGG - Intergenic
1176866368 21:14056995-14057017 GGGCAGTGCCAGGGCAGGGCAGG + Intergenic
1179713740 21:43277168-43277190 CCGCGGGGCCCTGGGAGGGTGGG - Intergenic
1180060836 21:45384070-45384092 CGGCGGTGGCATGGCCGTGCCGG + Intergenic
1180275750 22:10637016-10637038 AGGCAGTGCCAGGGCAGGGCAGG - Intergenic
1180913617 22:19470274-19470296 AGGAGGTGCAATGGGAGTGCAGG + Intronic
1181161697 22:20963585-20963607 CTGCGGTGTCCTGGGAAGGCTGG + Intergenic
1181354442 22:22289863-22289885 AGGCAGTGCCAGGGCAGGGCAGG + Intergenic
1181465649 22:23109324-23109346 GCTCGGGGCCATGGGAGGGCAGG - Intronic
1181480197 22:23193957-23193979 CAGGGGTGCCAAGGGTGGGCTGG + Intronic
1181500694 22:23314079-23314101 CTGGGCTGCCATGGGAGAGCTGG - Intronic
1182318490 22:29463502-29463524 CAGCCCTGCCATGGGTGGGCTGG - Intergenic
1182380493 22:29883466-29883488 AGGCAGCGCCCTGGGAGGGCTGG + Intronic
1183427784 22:37748741-37748763 GAGAGGGGCCATGGGAGGGCAGG + Intronic
1183536415 22:38404219-38404241 GGGCAGTGCTAGGGGAGGGCGGG - Intergenic
1183604702 22:38861587-38861609 CGGCGGTTCCGGGGGAGGGGTGG - Exonic
1183703179 22:39461319-39461341 AGGGGGAGGCATGGGAGGGCTGG + Intronic
949638899 3:6013474-6013496 TGGGGGTGCCATAGGAGGCCAGG - Intergenic
950094538 3:10321215-10321237 GGGCTGGGCCACGGGAGGGCGGG - Intergenic
950427577 3:12932791-12932813 TGGCGGTGCTGCGGGAGGGCAGG - Intronic
950556476 3:13699147-13699169 CAGCTGAGCCACGGGAGGGCGGG - Intergenic
951558803 3:23945827-23945849 CGGCCGGGCCATGTGAGGGGGGG - Intronic
954878369 3:53817983-53818005 CGGCAGTGGGATCGGAGGGCTGG + Exonic
956978965 3:74614585-74614607 CGGCGGTGGCAGCGGCGGGCGGG - Intergenic
960121785 3:113954343-113954365 CGGCAGTGCCATGCCCGGGCTGG - Exonic
960702491 3:120451340-120451362 GGGCGGTGCCGTGGGGGGCCCGG + Intergenic
968092889 3:195909325-195909347 CGGCGGTGCAGGAGGAGGGCGGG - Intronic
968186925 3:196639503-196639525 CGTTGGTGCCTTGGCAGGGCTGG - Intergenic
968370191 3:198219249-198219271 TGGAGATGCCATCGGAGGGCAGG - Intergenic
968518206 4:1023607-1023629 CGGAGGTGCACAGGGAGGGCAGG - Intronic
968560659 4:1279665-1279687 TGGCGGTGCCACAGGACGGCAGG - Intergenic
968620524 4:1601696-1601718 AGGGGGTGCCAGGGGAGGGCAGG - Intergenic
969100494 4:4764706-4764728 CGGCGGTGCCCTGGGTGGACGGG + Intergenic
969125545 4:4945273-4945295 GGGCTGTGCCATAGCAGGGCAGG + Intergenic
969138960 4:5052290-5052312 CGGAGGTGGCCTGGAAGGGCGGG + Intronic
969422114 4:7103477-7103499 GGGCGGAGCCAAGGAAGGGCGGG - Intergenic
970728659 4:19077788-19077810 TGGGAGTGACATGGGAGGGCAGG - Intergenic
982157167 4:152535088-152535110 CCGCGCTGCCAGGGGAGGGGAGG + Exonic
984811312 4:183798140-183798162 CGGCGGTGCCCGCGGCGGGCTGG - Intergenic
984928381 4:184826092-184826114 GGGCGGGGCCGCGGGAGGGCGGG - Intronic
985590242 5:760820-760842 CAGCGGTTCCTTGGGAGGGTGGG - Intronic
985634810 5:1030825-1030847 GGGCGGTGCCAAGGCAGGGTGGG - Intronic
989983429 5:50667970-50667992 CGGTGGTGTCAGGGGAGGCCTGG - Intronic
997238959 5:132293597-132293619 CGCCGGGTCCATGGGCGGGCGGG - Intronic
1002166610 5:177351586-177351608 CGGCGGTGCCTGGGAAGGCCTGG - Exonic
1002310901 5:178313168-178313190 AGGGGGTGCCATCGGTGGGCTGG + Intronic
1002729717 5:181326007-181326029 TGGAGATGCCATCGGAGGGCAGG - Intergenic
1006167479 6:32073556-32073578 CGGTGGTACCAAGGCAGGGCTGG + Intronic
1006408755 6:33859924-33859946 CGGCGGTGAGATGGGATGCCGGG + Intergenic
1007178120 6:39910065-39910087 GGGCCCTGCCATGGGAGGCCTGG - Intronic
1010790192 6:80055068-80055090 AGGAGGTGTCCTGGGAGGGCAGG - Intergenic
1013479705 6:110543255-110543277 TGGCAGTGCCAGGGGAGAGCTGG - Intergenic
1017185676 6:151598157-151598179 AGGTGGTGCCATGGGTGGGGAGG + Intronic
1018101558 6:160445358-160445380 AGGTGGTGCCAGGGCAGGGCAGG + Intronic
1018686539 6:166308116-166308138 CGGCGGCGGCATGGGCGGGAAGG + Exonic
1019058094 6:169237134-169237156 AGGCGGGGCCCTGGGTGGGCGGG - Intronic
1019395858 7:817100-817122 CGGCGGGGCCGTGGGTGGGGTGG + Intronic
1019663904 7:2241935-2241957 CGGCGGGGCCGTGGGGAGGCCGG - Intronic
1020223131 7:6256787-6256809 TGGGGGAGCCAAGGGAGGGCAGG + Intronic
1023875186 7:44282928-44282950 TGGTGGTGCCCTGGGAGGGGAGG + Intronic
1024075216 7:45814532-45814554 TGGAGATGCCATCGGAGGGCAGG - Intergenic
1024345501 7:48309616-48309638 CGGGGGTGGCATCGGAGGGTGGG + Intronic
1024623921 7:51188203-51188225 CGGGGATTCCAGGGGAGGGCAGG + Intronic
1025176279 7:56804028-56804050 TGGAGATGCCATCGGAGGGCAGG - Intergenic
1025695513 7:63772394-63772416 TGGAGATGCCATCGGAGGGCAGG + Intergenic
1026828436 7:73597522-73597544 GGGTGGTGCCATGGGAGGGAAGG + Exonic
1029887647 7:103890054-103890076 CAGAGGTGCCATGGAAGGGCTGG - Intronic
1032051436 7:128653128-128653150 TGGAGATGCCATCGGAGGGCAGG - Intergenic
1032284623 7:130531116-130531138 TGGGGGTTGCATGGGAGGGCAGG + Intronic
1034522533 7:151632020-151632042 CGGCCGGGCCGTGGGAGCGCCGG + Intronic
1034726201 7:153338264-153338286 CGGTGGTGCTATGGGAAGGTAGG - Intergenic
1035663112 8:1362166-1362188 CGGCACTGGCAGGGGAGGGCAGG + Intergenic
1036454160 8:8893290-8893312 CGGCCGGGCCATGGGCGCGCCGG + Exonic
1039579319 8:38651019-38651041 CGGCGCTGCCGTGGGGTGGCCGG + Intergenic
1039687457 8:39820384-39820406 CGGCAGTACCATGGGAGGTTAGG - Intronic
1045115190 8:98973723-98973745 CGGGGCTGCCAGGGGAGGGGTGG - Intergenic
1049575600 8:143388443-143388465 CAGGGCTGGCATGGGAGGGCAGG + Intergenic
1049612412 8:143561717-143561739 GGGCAGGGGCATGGGAGGGCAGG - Intronic
1051046359 9:12879456-12879478 CGGCAGTACCATGGGAGAGGGGG + Intergenic
1053466401 9:38311706-38311728 CGGCGGCTCCATCAGAGGGCTGG + Intergenic
1054175905 9:61875169-61875191 CGGTGGGGCCATTGCAGGGCAGG + Intergenic
1054272520 9:63044942-63044964 AGGCAGTGCCAGGGCAGGGCAGG + Intergenic
1054303538 9:63393509-63393531 AGGCAGTGCCAGGGCAGGGCAGG - Intergenic
1054402316 9:64720019-64720041 AGGCAGTGCCAGGGCAGGGCAGG - Intergenic
1054435920 9:65204334-65204356 AGGCAGTGCCAGGGCAGGGCAGG - Intergenic
1054494472 9:65817353-65817375 AGGCAGTGCCAGGGCAGGGCAGG + Intergenic
1054661634 9:67705639-67705661 CGGTGGGGCCATTGCAGGGCAGG - Intergenic
1057182549 9:93037881-93037903 GGGCTGTGGGATGGGAGGGCTGG - Intergenic
1058851235 9:109013564-109013586 CGGCGGAGCCCTGGGGGGGCGGG - Intergenic
1058851288 9:109013704-109013726 GGGCGGGGCCATGTGGGGGCGGG - Intergenic
1059191862 9:112333938-112333960 CCGCGGGGCCGCGGGAGGGCGGG - Intergenic
1059734214 9:117085575-117085597 TGGTGGTGCCCTGGGACGGCTGG + Intronic
1061306399 9:129735605-129735627 TGGCTCTGCCGTGGGAGGGCAGG - Intergenic
1061901776 9:133676576-133676598 CAGAGGTGCCAGGGGAGGCCGGG + Intronic
1061996706 9:134189857-134189879 TGGCCCTGCCATGGGAGGACGGG + Intergenic
1062208640 9:135351243-135351265 CGGCTGTGCCTGGGGAGTGCCGG - Intergenic
1062311890 9:135942773-135942795 AGGGGCTGCCCTGGGAGGGCGGG + Intronic
1062636067 9:137492531-137492553 GGGCGGGGCCATGGGCGGGTGGG + Intronic
1062754131 9:138278519-138278541 TGGAGATGCCATCGGAGGGCAGG - Intergenic
1203577689 Un_KI270745v1:21276-21298 TGGAGATGCCATCGGAGGGCAGG - Intergenic
1203622943 Un_KI270749v1:138680-138702 AGGCAGTGCCAGGGCAGGGCAGG - Intergenic
1185466671 X:358936-358958 CGGCGGGGGTAGGGGAGGGCGGG + Intronic
1190233965 X:48602003-48602025 GGGCTGTGCCCTGGGAGGGCTGG - Intronic
1190714318 X:53091118-53091140 CGGCTGAGCCATGTGAGGACAGG + Intergenic
1195531058 X:105958910-105958932 CTGGGGTGGCATGGGAGGGAAGG - Intergenic
1196816340 X:119667839-119667861 TGGAGGAGCCCTGGGAGGGCTGG - Intronic