ID: 920004067

View in Genome Browser
Species Human (GRCh38)
Location 1:202819972-202819994
Sequence TAGGAGATACATAAGGAAGT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 280
Summary {0: 1, 1: 1, 2: 1, 3: 28, 4: 249}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
920004064_920004067 1 Left 920004064 1:202819948-202819970 CCAACAGGAGGGAAGGAGAGAAT 0: 1
1: 0
2: 6
3: 54
4: 435
Right 920004067 1:202819972-202819994 TAGGAGATACATAAGGAAGTAGG 0: 1
1: 1
2: 1
3: 28
4: 249
920004059_920004067 18 Left 920004059 1:202819931-202819953 CCTAAGCGTCAGTGGAACCAACA 0: 1
1: 0
2: 0
3: 3
4: 67
Right 920004067 1:202819972-202819994 TAGGAGATACATAAGGAAGTAGG 0: 1
1: 1
2: 1
3: 28
4: 249
920004058_920004067 23 Left 920004058 1:202819926-202819948 CCGAGCCTAAGCGTCAGTGGAAC 0: 1
1: 0
2: 0
3: 3
4: 51
Right 920004067 1:202819972-202819994 TAGGAGATACATAAGGAAGTAGG 0: 1
1: 1
2: 1
3: 28
4: 249

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
920004067 Original CRISPR TAGGAGATACATAAGGAAGT AGG Intergenic
900039741 1:448977-448999 TTGGATATATACAAGGAAGTGGG - Intergenic
900061173 1:683953-683975 TTGGATATATACAAGGAAGTGGG - Intergenic
904230262 1:29064131-29064153 AAGGAGATATATAAGGTATTTGG + Intronic
905554580 1:38872549-38872571 TAGGAGATTCATAGCGAATTTGG - Intronic
905976581 1:42179480-42179502 TAGGAGCTACATAGGGCAGCTGG + Exonic
907567638 1:55451186-55451208 TAGTAGATACATTAGAAAGGAGG + Intergenic
907973766 1:59410951-59410973 TAGGAGAGAAAGAAAGAAGTTGG - Intronic
908484622 1:64578425-64578447 TAGGATATACATATTGAAGCAGG - Intronic
909055984 1:70821651-70821673 AAAGAGATTTATAAGGAAGTGGG + Intergenic
909600883 1:77459786-77459808 AAGGAGTTAGAAAAGGAAGTGGG + Intronic
910302819 1:85726673-85726695 TTGGAGATAGATAATGAAGATGG - Intergenic
910444033 1:87282519-87282541 CAGGAGCAACATAAGGAAGCTGG + Intergenic
911590303 1:99739948-99739970 TATTAGAAACATAAGGAAGAAGG - Intronic
915615673 1:157036271-157036293 TGGGAGATCCCTTAGGAAGTTGG - Intronic
915713551 1:157923880-157923902 AATGGGATCCATAAGGAAGTGGG - Intergenic
915790669 1:158666852-158666874 TAGGAGAAGCATAATGAGGTTGG + Intronic
915963166 1:160283806-160283828 TAGGTAATCCAGAAGGAAGTAGG - Intronic
916175675 1:162036279-162036301 TAGGAGATGTAAAAGGAAGGGGG - Intergenic
918893734 1:190312758-190312780 TAGGAGATAGCTAAGGATATGGG + Intronic
919171079 1:193954911-193954933 TGGGAGATAAGAAAGGAAGTGGG + Intergenic
920004067 1:202819972-202819994 TAGGAGATACATAAGGAAGTAGG + Intergenic
920235182 1:204498260-204498282 AAGGAGAAATATAAGGCAGTGGG + Intergenic
921059384 1:211570322-211570344 GAGTAGATAAATAAGAAAGTGGG - Intergenic
922029961 1:221788331-221788353 TAGGAGATTAATAAAGAAGACGG + Intergenic
923489320 1:234469771-234469793 TAGGAGATACACAATGAAGCTGG - Intronic
923504133 1:234591157-234591179 TAGAAGAGACCTAAGGATGTGGG + Intergenic
1063073472 10:2690638-2690660 TAGGAGGAACATACGGAAATGGG - Intergenic
1064090722 10:12381087-12381109 TTGGAAATAAAAAAGGAAGTAGG + Intronic
1065212366 10:23416686-23416708 GGGCAGATAAATAAGGAAGTGGG - Intergenic
1066056056 10:31681247-31681269 TTGGAGATACAGAAAGAATTTGG + Intergenic
1068778677 10:60895942-60895964 TAGGAGTTACAAAAGAATGTTGG - Intronic
1068878513 10:62023628-62023650 TAGGAAAGAAAAAAGGAAGTGGG + Intronic
1069024940 10:63529358-63529380 CTGGAGATAGATAGGGAAGTAGG + Intronic
1069908992 10:71748569-71748591 TAGGAGATCAATCAGGAATTAGG - Exonic
1072109387 10:92303986-92304008 TAGGAGTAACATCAGCAAGTAGG + Intronic
1072118998 10:92389617-92389639 TAGGAGGTACATTTGGGAGTAGG + Intergenic
1072775294 10:98185398-98185420 TAGGAGATGTATATGGAAGGAGG + Intronic
1074309167 10:112307522-112307544 TAGGCAATACATCAGGAAGAGGG + Intergenic
1075833961 10:125437215-125437237 GGGGAGAAATATAAGGAAGTAGG - Intergenic
1076965964 11:84890-84912 TTGGATATATACAAGGAAGTGGG - Intergenic
1077458523 11:2695771-2695793 TAGGAGAAGCATTAGAAAGTAGG - Intronic
1078682747 11:13494344-13494366 TAGGAAGTACATAATGAAGAGGG - Intronic
1079743342 11:24092949-24092971 TAGGAAATACTTAAGGAACGAGG + Intergenic
1081462650 11:43286259-43286281 TAGATGATACATAAATAAGTTGG - Intergenic
1082663408 11:55943890-55943912 TAGGAGATACATATAGAAGCAGG + Intergenic
1082995121 11:59247940-59247962 TACAAGAAACAGAAGGAAGTGGG + Intergenic
1083206365 11:61151947-61151969 AAGGAGATACAAGTGGAAGTTGG - Intronic
1084723148 11:70922177-70922199 TAGGAGATGGATAAGGAAATTGG + Intronic
1085201418 11:74704482-74704504 AAGGAGAAACATAAGAAAGGTGG - Exonic
1085704676 11:78776013-78776035 TAAGAGAAACATAAAGAAATGGG - Intronic
1086182007 11:83963505-83963527 AGGGAGATACATTAGGAAGGAGG - Intronic
1086909497 11:92456185-92456207 TAGGAGAGACCTTATGAAGTAGG - Intronic
1087951833 11:104230248-104230270 TAATAGATACATATTGAAGTGGG + Intergenic
1090829956 11:130414473-130414495 AAGGAGAAACAAAAGGAAATGGG - Intronic
1092977274 12:13757542-13757564 TAGGAGATAAAAATGTAAGTGGG - Intronic
1093341273 12:17977140-17977162 TAGTAGATACAGAAGGATTTTGG - Intergenic
1093371546 12:18372405-18372427 TAGGAGATAAAGAATGAAATAGG + Intronic
1093698794 12:22194508-22194530 AAGGAAACACATAAGGAAGTAGG + Exonic
1094798008 12:33999151-33999173 TTATAGATACAAAAGGAAGTGGG + Intergenic
1096372463 12:51080505-51080527 TAGGAGATAGGTAAGAAAGAAGG + Intronic
1096980555 12:55726116-55726138 AAGGCGATCCATAAGGAGGTAGG - Exonic
1099188117 12:79537906-79537928 AATGAGACACAGAAGGAAGTGGG + Intergenic
1099260809 12:80380173-80380195 TAGGAGTTACAAAAGAAAATAGG + Intergenic
1100286582 12:93172630-93172652 TTGGAGGGACAGAAGGAAGTGGG - Intergenic
1100908634 12:99332614-99332636 TTGGAGACATATAAGGAAGGTGG + Intronic
1101757326 12:107631087-107631109 TAGGAGAGAGAGAAGGAAGGAGG - Intronic
1101789483 12:107914003-107914025 TAGGAAATTCCCAAGGAAGTGGG - Intergenic
1101870872 12:108564086-108564108 GAGGAGACACAAAAGGAATTGGG + Intronic
1103049784 12:117769004-117769026 TAGGAAATGCAGAAGGAAATTGG + Intronic
1104296798 12:127523257-127523279 TAGGAAATACTTAAGTAATTTGG + Intergenic
1107342266 13:39420554-39420576 TTGTAGATACTGAAGGAAGTGGG + Intronic
1107368285 13:39710752-39710774 TATGAAATACAAAAGGGAGTAGG - Intronic
1107538088 13:41355974-41355996 TAAGAGACACATAAGGAACCCGG - Intronic
1107861125 13:44661705-44661727 TATGAGATACGTAAAGAAGTGGG - Intergenic
1108011932 13:46024315-46024337 AAGGATATACATCAGGAAGATGG - Intronic
1108782157 13:53849320-53849342 TATGAGACACATAAGGAAATAGG - Intergenic
1109714532 13:66204352-66204374 TTGGAGATGAATAAGGAAGTTGG - Intergenic
1110428002 13:75391262-75391284 TAGTAGTTAGAAAAGGAAGTGGG - Intronic
1110734605 13:78921262-78921284 TAGGAATTAAATAAGGTAGTGGG - Intergenic
1110795929 13:79638335-79638357 TTGGAGATGCACATGGAAGTTGG - Intergenic
1112971043 13:105263109-105263131 TAGGAGATACATATGGAAATTGG - Intergenic
1114503573 14:23190660-23190682 TAGGAGAAACATGTGGAAATTGG - Intronic
1115202425 14:30869061-30869083 TAGGTGAAAAATAAGGAAATCGG + Intergenic
1118538821 14:66800788-66800810 GAGGAGATACAGAAAGAAATAGG - Intronic
1119230607 14:72976482-72976504 GAGGAGAAAAATAAGGAAATCGG + Intronic
1121614589 14:95304759-95304781 TCGGAGCTGCAGAAGGAAGTGGG - Intronic
1124030922 15:26011000-26011022 TTGGAGATAGATAGGGAAATTGG - Intergenic
1128696034 15:69763528-69763550 GAGGAGATACATCAGGGAGTTGG + Intergenic
1128741704 15:70088355-70088377 AAGGAGAAACTTAAGGAAGGGGG - Intronic
1130311941 15:82763906-82763928 TTGGAGAAATATAAGGAATTTGG - Intronic
1131931071 15:97442452-97442474 TAGACGATACATAAACAAGTGGG + Intergenic
1132442167 15:101878635-101878657 TTGGATATATACAAGGAAGTGGG + Intergenic
1136400988 16:30018511-30018533 TAGGTGAGAGATAAGGAAGCAGG + Intronic
1136585737 16:31183472-31183494 CATGTGATACATAAGGAGGTGGG + Intronic
1137773696 16:51038986-51039008 TAGGAGTTAAGTAAGGAATTGGG - Intergenic
1144415184 17:15039625-15039647 TAGCAGAGATATCAGGAAGTAGG + Intergenic
1144766625 17:17736491-17736513 TAGGAGATGTAGAAGGAAGTGGG + Intronic
1146474695 17:33153413-33153435 CAAGAGTTACATGAGGAAGTGGG + Intronic
1147117785 17:38314955-38314977 CAGGAGAGACATAATGAAGTGGG - Intronic
1148530463 17:48385429-48385451 TTGGAGAGACATAATGAAGAAGG + Intronic
1148924375 17:51070446-51070468 TAGAATATATTTAAGGAAGTAGG - Intronic
1150420412 17:65029022-65029044 AATGAGAAACATAAGGATGTTGG + Intronic
1150653369 17:67024179-67024201 TAGGTGATAGACAAGGATGTGGG - Intronic
1151999859 17:77638462-77638484 TAGGAGAGACGGAAAGAAGTGGG + Intergenic
1153035546 18:758968-758990 TATGACATTCAAAAGGAAGTAGG + Intronic
1153498938 18:5728826-5728848 CAGGAGGTACAGAAGGAGGTCGG - Intergenic
1153601464 18:6784677-6784699 TAGGAGGTACATAACAAAGATGG + Intronic
1155220460 18:23680642-23680664 AAGTAGAGACATAGGGAAGTTGG + Intergenic
1156636086 18:39031215-39031237 TAAGAAATACTTAAGGAAGTTGG - Intergenic
1158316858 18:56220851-56220873 TAGGAGACACATAAGCGAGAAGG + Intergenic
1159364088 18:67443893-67443915 TTGGAGTTGCATGAGGAAGTGGG - Intergenic
1159498192 18:69233277-69233299 TAGAAGATACAAAAACAAGTAGG - Intergenic
1160110465 18:76024815-76024837 TGGGAGCTACATAAGGAATCTGG + Intergenic
1160642768 19:154520-154542 TTGGATATATACAAGGAAGTGGG - Intergenic
1165164873 19:33845452-33845474 AAGGAGATACACAATGAAGTGGG + Intergenic
1166023985 19:40062707-40062729 CAGAAGATAAATAAGGAAATAGG - Intergenic
925080491 2:1059943-1059965 TAGGAGATATATAAGAAAAGTGG + Intronic
925933413 2:8730148-8730170 TAGGAAGTACATAATGAAGAGGG - Exonic
925958948 2:8996804-8996826 TAAGAGATACAGATTGAAGTAGG - Intronic
926938681 2:18113100-18113122 CAGGAGAGAGTTAAGGAAGTTGG + Intronic
929943843 2:46355698-46355720 TTGGAGATAAATAATGAACTAGG + Intronic
931012739 2:57936049-57936071 TGGGAGCTACATAAGCAAGTTGG - Intronic
931399991 2:61922799-61922821 TAGGAGAAAGATAAGAAAGGGGG + Intronic
933148963 2:78891346-78891368 AAGGAGAGACAGAAGGAAGGAGG - Intergenic
936588680 2:113782109-113782131 TAGGAGACACATCAGGAAAGGGG + Intergenic
939050670 2:137303540-137303562 TGAGAGATACATTAAGAAGTTGG + Intronic
939184209 2:138841344-138841366 TAGGAGCAAAAAAAGGAAGTTGG - Intergenic
939204011 2:139076649-139076671 TATGAGATAAATAAGTCAGTTGG + Intergenic
939949271 2:148449273-148449295 TTGAAAATACATAAGGAGGTGGG - Intronic
940164278 2:150751963-150751985 TATGAAACATATAAGGAAGTGGG - Intergenic
940740362 2:157500664-157500686 TAGGAGATGCATACTGAAGTAGG + Intergenic
940956235 2:159731191-159731213 TAGGTGATACAAAAAGATGTCGG - Intronic
942241656 2:173967798-173967820 TAAGAGATACATATGGAGGTAGG + Intergenic
942546222 2:177066967-177066989 TAAGAGATACAAAAGCATGTTGG + Intergenic
942811162 2:180002697-180002719 TGGGACATACAGAAAGAAGTAGG + Intronic
944019161 2:195079921-195079943 TAGGAATTACATAAGGTGGTTGG - Intergenic
944046687 2:195419611-195419633 TAGTAGATACATAAATAAGTAGG - Intergenic
944979215 2:205094905-205094927 TAGAAAAAACTTAAGGAAGTTGG - Intronic
945549781 2:211206619-211206641 TAGAAGATAGATAAGTAGGTAGG + Intergenic
945591466 2:211737394-211737416 TAGGAGAGACAAGAAGAAGTGGG - Intronic
945644929 2:212479270-212479292 TAAGAGATCTATAAGGAATTGGG - Intronic
945739419 2:213642374-213642396 TAAGAAATACTAAAGGAAGTTGG - Intronic
945947040 2:216004291-216004313 TAGGAGATAAATAAGTGTGTAGG - Intronic
945961555 2:216140526-216140548 TAGGAGAGACCTAAGGAAAGAGG + Intronic
946647088 2:221849317-221849339 TAGGAGATAAAAGCGGAAGTAGG + Intergenic
948719195 2:239886916-239886938 TAGAAGATAAACAAGGAAATAGG + Intergenic
1169170910 20:3464265-3464287 TAGGAGATACACACAGAAGACGG + Intergenic
1169323640 20:4656672-4656694 AAAGAGATACATAAAGAAGGAGG - Intergenic
1169926230 20:10787363-10787385 TAGAAGACACATAAGGCAGGTGG - Intergenic
1170214975 20:13882243-13882265 GGGGAGATACATAAGGGAGAGGG - Intronic
1170681633 20:18531195-18531217 TAGGAGATAGAAGAGGAAGTAGG + Intronic
1170795718 20:19545314-19545336 TGGGAGATCCATATGGAAATAGG - Intronic
1172747647 20:37225240-37225262 TAGGAGACACAAAAGAAAGAAGG - Intronic
1172974457 20:38895763-38895785 GAGGAGAGAAAGAAGGAAGTTGG - Intronic
1174719368 20:52795486-52795508 TAGGAGATATGTCAGGGAGTTGG - Intergenic
1175398912 20:58688272-58688294 TAAGAGATACACAATGAGGTAGG + Intronic
1177038901 21:16081652-16081674 TAAGAGATACAAGAGGAAATAGG - Intergenic
1177562428 21:22773622-22773644 TAGGAAATACTTATGGAATTTGG - Intergenic
1179133326 21:38658721-38658743 TACCAGATACATAAGTAAGAAGG - Intronic
1183734924 22:39639140-39639162 TAGGAAATAGATAAACAAGTGGG - Intronic
951548899 3:23857147-23857169 TAGGAGAAGCATCAGGAAATTGG + Intronic
953185693 3:40636064-40636086 TAGGATATACCTAACCAAGTAGG + Intergenic
953584171 3:44184937-44184959 TAGGAGGTACAGAAAGAACTGGG + Intergenic
953625825 3:44570170-44570192 TATGACAAATATAAGGAAGTTGG + Exonic
954495129 3:50951240-50951262 TAGGAGAGAAAGAAGGAAGGAGG - Intronic
955931580 3:64062782-64062804 TAGGAGAGAGGAAAGGAAGTGGG + Intergenic
956893754 3:73638905-73638927 TAGGAGATAGCTAAGGGAGAAGG - Intergenic
957269360 3:78009342-78009364 CAGTAGATACAGAAAGAAGTAGG + Intergenic
959072967 3:101720294-101720316 TAGGTTATAGATAAGGAAGCAGG + Intergenic
960562145 3:119096271-119096293 TTGGACATACATGTGGAAGTGGG + Intronic
963809467 3:149760817-149760839 TAGCAGTTACCTAAAGAAGTTGG + Intergenic
963863613 3:150336179-150336201 GAGGATATACAGAAGGAGGTGGG - Intergenic
965171724 3:165274460-165274482 GTGGAGATGCATGAGGAAGTTGG - Intergenic
965801416 3:172497619-172497641 GAGAAGAGACATAAGGAAGGGGG + Intergenic
966243554 3:177781224-177781246 TGGGAGATAAATTAGGAACTAGG + Intergenic
967062506 3:185884623-185884645 TAGGAGCTACAAAAGGAAGAAGG + Intergenic
968197061 3:196715134-196715156 TACAAGATACATATGGAATTTGG + Intronic
969097899 4:4747885-4747907 TAGAAGATACACAAAGAACTGGG - Intergenic
969141379 4:5077284-5077306 AAGGAGATAGACAAGGTAGTGGG - Intronic
970867887 4:20780042-20780064 TAGGACATGGATAAGGAAGTAGG + Intronic
971216505 4:24666742-24666764 AAGGAGATGCACAAGGTAGTAGG - Intergenic
971414861 4:26415484-26415506 TAAGATATACACAAGGAGGTGGG - Exonic
972642859 4:40941596-40941618 TACCAGATACATAAGGATTTTGG + Intronic
972855404 4:43099621-43099643 AAGGAAATAGATAAGAAAGTTGG + Intergenic
977841389 4:101710554-101710576 TAGGAGACAAATAAGGGAGAGGG - Intronic
979756399 4:124345461-124345483 TAAGAGATATTTAAGGAACTTGG - Intergenic
980674216 4:136053539-136053561 TAGGATATACAGAAGTAGGTGGG + Intergenic
980890522 4:138810026-138810048 CTGGAAATACATAATGAAGTAGG + Intergenic
981471822 4:145144345-145144367 TAGGTGATAGAAAAGGAAGCAGG - Exonic
981863986 4:149392291-149392313 ACGGAGATACATAAGCAAGAAGG + Intergenic
982004235 4:151049249-151049271 TAGGAGAGCCAGAAGGAAGATGG + Intergenic
984276363 4:177615811-177615833 TACAAGATAGATAACGAAGTAGG - Intergenic
984444737 4:179822393-179822415 TAGGAGACACATAATATAGTTGG + Intergenic
986242487 5:5973465-5973487 TAGGAGCTACATAAAATAGTAGG - Intergenic
987759323 5:22139748-22139770 TAGGAGGAAGATAGGGAAGTTGG - Intronic
988617556 5:32790053-32790075 TTGGGGCTACATGAGGAAGTTGG + Exonic
990628154 5:57637599-57637621 TGGGAGACAAGTAAGGAAGTTGG + Intergenic
991894040 5:71373177-71373199 TAGGAGGAAGATAGGGAAGTTGG - Intergenic
992408527 5:76482521-76482543 TAGTACATACAGAAGGAAGAGGG + Intronic
993527087 5:88978245-88978267 TAGTAAATACATAATGAAGGAGG - Intergenic
994311923 5:98282953-98282975 TAGGAAACACAGAAGGAAGAAGG - Intergenic
996617901 5:125463467-125463489 AAGGAGATACATAACAAATTAGG + Intergenic
997067255 5:130576037-130576059 TAATATATACATATGGAAGTTGG - Intergenic
999327893 5:150654698-150654720 ATGGAGATACAAAAGGAAGTCGG - Intronic
999543154 5:152596798-152596820 GAGAAGAAACATAAGCAAGTTGG + Intergenic
1000682618 5:164204703-164204725 AACGAGATTCATAAGGAAGGAGG - Intergenic
1000918949 5:167116164-167116186 AAGGATAAACAGAAGGAAGTAGG + Intergenic
1001316543 5:170644980-170645002 TAGGTCACACATAAGGAAGGTGG - Intronic
1002430727 5:179202424-179202446 TAGGAGATGGAGAAGGAAGAAGG - Intronic
1002449824 5:179312311-179312333 AAGGTGATATATTAGGAAGTGGG + Intronic
1002734106 5:181369966-181369988 TTGGATATATACAAGGAAGTGGG + Intergenic
1002750435 6:104160-104182 TTGGATATATACAAGGAAGTGGG - Intergenic
1002984971 6:2180820-2180842 GAGGAAATACCTAATGAAGTAGG - Intronic
1003279354 6:4678360-4678382 TAGGAGATATATTAGAAATTGGG - Intergenic
1003415899 6:5907605-5907627 TAGGAGATACATAAGAAAGTGGG - Intergenic
1003789443 6:9527299-9527321 TAAGAGACAGAAAAGGAAGTGGG + Intergenic
1004040036 6:11966381-11966403 TAGGAGGTACATATGGAGGATGG - Intergenic
1004143283 6:13041508-13041530 TGGGAGCTACATAAGGAAACAGG + Intronic
1005605899 6:27477261-27477283 TTGGAGCTACATAAAGAAATAGG + Intergenic
1005637234 6:27764088-27764110 AAGGTGAGACATAAGGAATTTGG + Intergenic
1008088491 6:47268877-47268899 TAGAAGATAAATAAGGATATTGG - Intronic
1008156713 6:48024452-48024474 TAGGAGAAACCTAAAAAAGTTGG + Intronic
1010635709 6:78256902-78256924 TAGGAGACATATAATGAACTTGG - Intergenic
1011347255 6:86384661-86384683 AAGGATCTACATAGGGAAGTGGG + Intergenic
1011503901 6:88020261-88020283 GAGAAGAGAGATAAGGAAGTAGG - Intergenic
1013163183 6:107565817-107565839 TGGGAAATACAAAAGGAAATTGG + Intronic
1013572461 6:111443141-111443163 TACTAGATATATAAAGAAGTAGG - Intronic
1015190977 6:130471881-130471903 AAGGAGAGAAAAAAGGAAGTTGG - Intergenic
1015408740 6:132867713-132867735 TAGGAGATAAATCAGGCAGAAGG + Intergenic
1017575127 6:155793850-155793872 GAGGAGGTACATAAGGAATGGGG + Intergenic
1019238354 6:170642280-170642302 TTGGATATATACAAGGAAGTGGG + Intergenic
1019835993 7:3384196-3384218 TAAGAAATACATAATAAAGTTGG - Intronic
1021514361 7:21466653-21466675 TAAGAGATACAGAAGGTACTCGG + Intronic
1022738951 7:33103022-33103044 AAGGAGATAGATAAGCATGTTGG - Intronic
1022995411 7:35750235-35750257 TAGGAGATAGATAGGTAGGTAGG + Intergenic
1024499032 7:50082472-50082494 TAGGAGATACAAAAGGAACCCGG + Intronic
1025724638 7:64045577-64045599 TGGGAGATCCATAGGGAAGAAGG + Intronic
1027732225 7:81888935-81888957 GTGGAGATACAAAAGGAAGCTGG + Intergenic
1028288330 7:89032704-89032726 TAAGAGAGACATCAGGGAGTAGG + Intronic
1028548731 7:92032642-92032664 AAGGAAATATATAAGGAATTAGG + Intronic
1030399470 7:109030426-109030448 TAGGAAACACATATGGAATTAGG + Intergenic
1030807544 7:113936387-113936409 AAGGAGATGGAGAAGGAAGTTGG - Intronic
1031068228 7:117131947-117131969 TTGGAGATAAATGAGTAAGTGGG + Exonic
1031439492 7:121776206-121776228 TAGAAGATACATCATGCAGTAGG + Intergenic
1031754549 7:125621863-125621885 TAGAAGAGACAGAAGAAAGTTGG + Intergenic
1033398318 7:140996593-140996615 TAGGAGAGACAGAAGGATGGAGG - Intergenic
1034695741 7:153051684-153051706 TAGGAGATAGTTAAGGACGATGG - Intergenic
1035509415 8:164327-164349 TTGGATATATACAAGGAAGTGGG - Intergenic
1038898298 8:31812587-31812609 GAGGAGATAAAAAAGGAAGGAGG - Intronic
1039108615 8:34017657-34017679 TATGAGATACATAATCCAGTAGG + Intergenic
1039700872 8:39960518-39960540 AAGGAGAGCCATAAGGCAGTAGG - Intronic
1042940312 8:74100643-74100665 CAGGAGAAAGATAAGGAAGTGGG - Intergenic
1044422817 8:92017686-92017708 TAGAAAATAGATGAGGAAGTGGG + Intronic
1046003873 8:108455998-108456020 TAATAGATACATAAGGAACTAGG + Intronic
1047783161 8:128126358-128126380 TAGGAGCTGGAAAAGGAAGTGGG - Intergenic
1047908434 8:129498988-129499010 TATGAGATTCCTAAGGAAGTAGG + Intergenic
1048100717 8:131348326-131348348 TCGGAGACACATTAGGAAGTAGG + Intergenic
1048608827 8:135999800-135999822 CAGCAGATAGAGAAGGAAGTAGG - Intergenic
1050995977 9:12218106-12218128 TATGAGAAATATGAGGAAGTGGG - Intergenic
1051952137 9:22648629-22648651 AAGGGGATAAATAAGGGAGTTGG - Intergenic
1052312363 9:27081192-27081214 TAGGAGATAAATTAGGAGATTGG + Intergenic
1053069023 9:35090036-35090058 TAGGAGAGAGATCAGGGAGTTGG - Intronic
1055852028 9:80643067-80643089 TAGGATATACAGAAGTAAGGTGG + Intergenic
1056278246 9:85014168-85014190 GAGGAGATTCATAGGGAAGTAGG + Intronic
1057396939 9:94689032-94689054 CAGGAAATACACAAGGAAGGTGG - Intergenic
1058185110 9:101845640-101845662 AAGGAGCTACATAAAGAAATAGG - Intergenic
1058897102 9:109409890-109409912 CCTGAGCTACATAAGGAAGTTGG - Intronic
1061166508 9:128925782-128925804 TGGGAGGAACATAAGGAATTGGG - Intronic
1062758558 9:138322572-138322594 TTGGATATATACAAGGAAGTGGG + Intergenic
1186440055 X:9578083-9578105 TGGGAGATCGATAAGGAAGTGGG + Intronic
1192704932 X:73519325-73519347 TAGTATGGACATAAGGAAGTTGG - Intergenic
1192734865 X:73840943-73840965 TAGAATAAACTTAAGGAAGTGGG - Intergenic
1195710069 X:107766508-107766530 AAGCAGATACAAAAGGAAGAGGG + Intronic
1197272943 X:124445707-124445729 TAGGAGATACACAAGCAAGATGG - Intronic
1197922835 X:131613578-131613600 TAGAAGATACATAAACAAATGGG - Intergenic
1199470596 X:148191464-148191486 TAGGAGGTAGATAAAGAAGGAGG - Intergenic
1199525219 X:148784415-148784437 AAGGAGAGACAAGAGGAAGTTGG + Intronic
1200752183 Y:6956597-6956619 TGTGAGAAACATAAGGGAGTTGG - Intronic
1200755929 Y:6989998-6990020 TGGGAGATTGATGAGGAAGTGGG + Intronic
1201296888 Y:12471353-12471375 TGTGAGAAACATAAGGGAGTTGG + Intergenic