ID: 920005686

View in Genome Browser
Species Human (GRCh38)
Location 1:202832225-202832247
Sequence CCACCATGCCTGGCTGCTAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
920005686_920005690 5 Left 920005686 1:202832225-202832247 CCAGTAGCAGCCAGGCATGGTGG No data
Right 920005690 1:202832253-202832275 GCCTCTAATCCCAGCACTTTGGG 0: 1958
1: 240019
2: 277704
3: 178275
4: 139439
920005686_920005692 8 Left 920005686 1:202832225-202832247 CCAGTAGCAGCCAGGCATGGTGG No data
Right 920005692 1:202832256-202832278 TCTAATCCCAGCACTTTGGGAGG 0: 2826
1: 319470
2: 266870
3: 145698
4: 131355
920005686_920005697 21 Left 920005686 1:202832225-202832247 CCAGTAGCAGCCAGGCATGGTGG No data
Right 920005697 1:202832269-202832291 CTTTGGGAGGCCAAGGCAGGCGG 0: 25113
1: 73031
2: 147530
3: 156446
4: 127492
920005686_920005694 14 Left 920005686 1:202832225-202832247 CCAGTAGCAGCCAGGCATGGTGG No data
Right 920005694 1:202832262-202832284 CCCAGCACTTTGGGAGGCCAAGG 0: 79234
1: 201556
2: 232767
3: 156913
4: 93134
920005686_920005689 4 Left 920005686 1:202832225-202832247 CCAGTAGCAGCCAGGCATGGTGG No data
Right 920005689 1:202832252-202832274 TGCCTCTAATCCCAGCACTTTGG 0: 897
1: 102898
2: 241789
3: 242349
4: 212894
920005686_920005696 18 Left 920005686 1:202832225-202832247 CCAGTAGCAGCCAGGCATGGTGG No data
Right 920005696 1:202832266-202832288 GCACTTTGGGAGGCCAAGGCAGG 0: 56485
1: 171609
2: 226607
3: 184242
4: 115036

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
920005686 Original CRISPR CCACCATGCCTGGCTGCTAC TGG (reversed) Intergenic
No off target data available for this crispr