ID: 920008175

View in Genome Browser
Species Human (GRCh38)
Location 1:202848697-202848719
Sequence GTTGGATTTCTAATAGGGAC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
920008171_920008175 7 Left 920008171 1:202848667-202848689 CCATCTATGCGTTCTTGGGGGTC No data
Right 920008175 1:202848697-202848719 GTTGGATTTCTAATAGGGACCGG No data
920008165_920008175 13 Left 920008165 1:202848661-202848683 CCTGTCCCATCTATGCGTTCTTG No data
Right 920008175 1:202848697-202848719 GTTGGATTTCTAATAGGGACCGG No data
920008170_920008175 8 Left 920008170 1:202848666-202848688 CCCATCTATGCGTTCTTGGGGGT No data
Right 920008175 1:202848697-202848719 GTTGGATTTCTAATAGGGACCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
920008175 Original CRISPR GTTGGATTTCTAATAGGGAC CGG Intergenic
No off target data available for this crispr