ID: 920009102

View in Genome Browser
Species Human (GRCh38)
Location 1:202854915-202854937
Sequence GAGGCCCATTATCAGATGAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
920009102_920009110 26 Left 920009102 1:202854915-202854937 CCCATCATCTGATAATGGGCCTC No data
Right 920009110 1:202854964-202854986 GAGCAGGAGCCTATAGCACGTGG No data
920009102_920009106 10 Left 920009102 1:202854915-202854937 CCCATCATCTGATAATGGGCCTC No data
Right 920009106 1:202854948-202854970 GAAAGCCTTCCCTTCTGAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
920009102 Original CRISPR GAGGCCCATTATCAGATGAT GGG (reversed) Intergenic
No off target data available for this crispr